Development of an Oligonucleotide Array for Direct Detection of Fungi ...

JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2009, p. 142–152 0095-1137/09/$08.00⫹0 doi:10.1128/JCM.01668-08 Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Vol. 47, No. 1

Development of an Oligonucleotide Array for Direct Detection of Fungi in Sputum Samples from Patients with Cystic Fibrosis䌤† Jean-Phillippe Bouchara,1,2‡ Hsin Yi Hsieh,3‡ Sabine Croquefer,1 Richard Barton,4 Veronique Marchais,1 Marc Pihet,1 and Tsung Chain Chang3* Host-Pathogen Interaction Study Group, UPRES-EA 3142, Angers University,1 and Laboratory of Parasitology and Mycology, Angers University Hospital,2 Angers, France; Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan, Taiwan, Republic of China3; and Mycology Reference Centre, Department of Microbiology, Leeds General Infirmary, Leeds, LS1 3EX, United Kingdom4 Received 27 August 2008/Returned for modification 19 October 2008/Accepted 12 November 2008

Cystic fibrosis (CF) is the most common inherited genetic disease in Caucasian populations. Besides bacteria, many species of fungi may colonize the respiratory tract of these patients, sometimes leading to true respiratory infections. In this study, an oligonucleotide array capable of identifying 20 fungal species was developed to directly detect fungi in the sputum samples of CF patients. Species-specific oligonucleotide probes were designed from the internal transcribed spacer (ITS) regions of the rRNA operon and immobilized on a nylon membrane. The fungal ITS regions were amplified by PCR and hybridized to the array for species identification. The array was validated by testing 182 target strains (strains which we aimed to identify) and 141 nontarget strains (135 species), and a sensitivity of 100% and a specificity of 99.2% were obtained. The validated array was then used for direct detection of fungi in 57 sputum samples from 39 CF patients, and the results were compared to those obtained by culture. For 16 sputum samples, the results obtained by the array corresponded with those obtained by culture. For 33 samples, the array detected more fungal species than culture did, while the reverse was found for eight samples. The accuracy of the array for fungal detection in sputum samples was confirmed (or partially confirmed) in some samples by cloning and resequencing the amplified ITS fragments. The present array is a useful tool for both the simultaneous detection of multiple fungal species present in the sputa of CF patients and the identification of fungi isolated from these patients. Opportunistic molds are the most common agents of fungal colonization and/or infection of the airways of CF patients. Among them, Aspergillus fumigatus has been reported with a prevalence ranging from 16 to 45.7% in CF patients (2, 3, 7, 8, 18). This fungus is well known to clinicians involved in the follow-up of these patients since it may cause various diseases, the most common being allergic bronchopulmonary aspergillosis (3, 12, 26, 43). In addition, other Aspergillus species, including Aspergillus flavus and Aspergillus niger, may be present as transient colonizers of the airways, usually without any associated clinical signs (28, 38). More intriguing is the relatively high frequency of the Pseudallescheria boydii/Scedosporium apiospermum complex and Aspergillus terreus, which rank second and the third, respectively, among filamentous fungi associated with CF. In a longitudinal 5-year study, prevalence rates of 8.6% and 6.3%, respectively, were reported for S. apiospermum and A. terreus in CF patients (7, 10). More recently, a similar prevalence rate of 10% was reported for the S. apiospermum complex in another study conducted in Australia (48). However, the fungal biota colonizing the airways of CF patients could be even more complex, as suggested by the recent description of two strictly thermophilic fungi, Penicillium emersonii (anamorph state of Talaromyces emersonii) and Acrophialophora fusispora, in these patients (9, 11). Additionally, other fungal species seem to be more common in some geographic areas, such as Scedosporium prolificans, which has mainly been reported for CF patients in Spain (14, 17, 35), and Exophiala dermatitidis, which has been isolated from CF patients in Germany (4, 15, 25, 29, 31). Due to the propensity of some of these molds to disseminate in an

Cystic fibrosis (CF), the major genetic disease among Caucasian populations, is caused by mutations in the gene CFTR (cystic fibrosis transmembrane conductance regulator), encoding a membrane transporter involved in electrolytic exchanges through the plasma membrane. It occurs in 1 in 1,900 to 1 in 3,700 live births in people of European ancestry (22). The mutations result in a thickening of the bronchial mucus, which facilitates the entrapment of inhaled bacteria and fungal spores (21, 39). Respiratory infections are the major cause of morbidity and mortality in CF patients. Besides bacteria, which are the major infectious agents, many fungi also colonize the respiratory tract of CF patients (40), but their involvement in respiratory infections remains controversial. Candida species, especially Candida albicans, are often recovered from sputum samples of CF patients (45, 46). Less frequently, Candida glabrata, Candida parapsilosis, and Candida tropicalis may be isolated (6, 21, 36, 40). Moreover, a prevalence of 11.1% for Candida dubliniensis in CF patients has been reported (41). However, it is likely that most Candida isolates derive from oral colonization or infection. * Corresponding author. Mailing address: Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, 1 University Rd., Tainan 701, Taiwan. Phone: 886-6-2353535, ext. 5790. Fax: 886-6-2363956. E-mail: tsungcha@mail .ncku.edu.tw. † Supplemental material for this article may be found at http://jcm .asm.org/. ‡ Jean-Phillippe Bouchara and Hsin Yi Hsieh contributed equally to this study. 䌤 Published ahead of print on 19 November 2008. 142

VOL. 47, 2009

MOLECULAR DETECTION OF FUNGI IN CF PATIENTS

143

TABLE 1. Fungal strains used for sensitivity test of the array Reference strainsa

Species

Clinical isolate(s)

Acrophialophora fusispora Aspergillus flavus

CBS 380.55T, 138.69, 484.70,b 916.79; IHEM 15939, 19209, 19591 BCRC 30006, 30007, 30008, 30009, 30144, 30165T, 30187

Aspergillus fumigatus

BCRC 30099, 30502T, 32120, 32149, 33373, 33378, 33379, 33380, 33381 ATCC 11267, 13833; BCRC 30100T, 31120, 32131, 32208, 32211, 32425, 33355; CBS 670.78A; IHEM 6365, 9679, 18780 BCRC 30201, 30204, 30505, 30506, 30507, 31130T, 31494, 31512, 32073, 32720, 33046; IHEM 5077, 17033, 17168 BCRC 30135, 31128, 32068, 32652, 32653, 32670, 32677, 32800, 32877

Aspergillus nidulans Aspergillus niger Aspergillus terreus Candida albicans Candida dubliniensis Candida glabrata Candida lusitaniae Candida parapsilosis complex Candida tropicalis Exophiala dermatitidis

BCRC 20511, 20512T, 20513, 21538, 22063 CBS 2747, 7987T, 7988, 8500, 8501 BCRC 20586T; CBS 860, 861, 2175, 7307 BCRC 21740, 20326, 21387T; CBS 7270 BCRC 20515T, 20865, 21253, 21544

Fomitopsis pinicola Paecilomyces lilacinus

CBS 169.31, 223.39, 314.82 BCRC 31616T, 32816; CBS 328.93, 100229; IHEM 10102, 18502, 19942 BCRC 33174; CBS 102.74T, 370.70, 112279; IHEM 13329, 15768, 16627 ATCC 44329, 44331, 44332

Paecilomyces variotii Pseudallescheria boydii/ Scedosporium apiospermum complex Scedosporium prolificans Scopulariopsis brevicaulis Talaromyces emersonii Total no. of strains

7 LM 33, LMA 95510, 901219, 941007, 40110521, 49707905, 40600639, 40600868, 40601102, 40601360 LM 375, 376, 378, LMA 92414, 93622, 895657, 40010506, 40101263 LM 23

17

LMA 882313

15

LM 13, LMA 40007733, 40101515, 40108901, 40202399, 49705866, 405002679, 40505504, 40506495

18

17 14

5 5 5 4 4

BCRC 20520T, 20521, 21436, 21437, 21560 ATCC 38714, 42053, 44502; IHEM 3275

LMA 041747, 044447, 40504384, 036905, 40502454, 40501366, 40601416

5 11 3 7 7

CBS 336.95, 494.92, 742.96, 100390; IHEM 14076, 19435, 21157 ATCC 7903, 62614; BCRC 31751; CBS 398.54; IHEM 13381, 15574, 19599 CBS 393.64T, 395.64, 549.92; IHEM 14262, 16128, 16292, 18732, 20178 133

Total no. of strains

LM 7, LMA 904595, 974241, 49708674, 49801691, 49807676, 40505525, 40505764, 40505787 LMA 40601651

12 8 7

LMA 49707800, 49907568, 40505666 49

11 182

a

ATCC, American Type Culture Collection, Manassas, VA; BCRC, Bioresources Collection and Research Center, Hsinchu, Taiwan; CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; IHEM, Institute of Hygiene and Epidemiology-Mycology Section, Scientific Institute of Public Health, Brussels, Belgium. Strains with a superscript “T” represent type strains. b The strain was deposited at the CBS as Acrophialophora levis, which is now synonymized with Acrophialophora fusispora (1).

immunocompromised host and to their usually low susceptibility to current systemic antifungals, it may be important to detect and identify mold species which colonize the respiratory tract of the patients. The variations in the prevalence of the different fungal species between studies may reflect variations in the geographic distribution of these fungi and/or the lack of standardization of the mycological examination methods, such as the number and nature of culture media, incubation times, and temperatures. Furthermore, identification of molds usually relies exclusively on morphological features, and misidentifications of some species associated with CF have been reported (23, 42). Molecular tools allowing both identification and direct detection of the different fungi in specimens from CF patients may constitute a valuable alternative to culture. Here we report on the development and validation of an oligonucleotide array that can

identify 20 species of fungi, followed by using this array to directly detect fungi in the sputum samples of CF patients. MATERIALS AND METHODS Fungal strains and DNA extraction. A collection of 182 target strains (20 species) were used in this study (Table 1). This collection, which comprised 133 reference strains and 49 clinical isolates, included most of the fungal species that have been reported as colonizers of the airways in CF patients in general or that have been recovered from respiratory secretions of CF patients at Angers University Hospital (Angers, France) during the past 5 years. Reference strains were obtained from the American Type Culture Collection (ATCC; Manassas, VA), the Bioresources Collection and Research Center (BCRC; Hsinchu, Taiwan), the Centraalbureau voor Schimmelcultures (CBS; Utrecht, The Netherlands), and the Institute of Hygiene and Epidemiology-Mycology Section culture collection (IHEM; Scientific Institute of Public Health, Brussels, Belgium). Clinical isolates were obtained from the Mycology Reference Centre, Division of Microbiology, University of Leeds (Leeds, United Kingdom), and the Laboratory of Parasitology and Mycology of Angers University Hospital. All isolates were

144

BOUCHARA ET AL.

J. CLIN. MICROBIOL. TABLE 2. Oligonucleotide probes used to identify 20 fungal species

Species

Acrophialophora fusispora Aspergillus flavus Aspergillus fumigatus Aspergillus nidulans Aspergillus niger Aspergillus terreus Candida albicans Candida dubliniensis Candida glabrata Candida lusitaniae Candida parapsilosis complex Candida tropicalis Exophiala dermatitidis Fomitopsis pinicola Paecilomyces lilacinus Paecilomyces variotii Pseudallescheria boydii/ Scedosporium apiospermum complex Scopulariopsis brevicaulis Scedosporium prolificans Talaromyces emersonii Positive control

Probe code

Sequence (5⬘to 3⬘)a

Length (ntb)

Locationc

Tm d

GenBank accession no.

Acfus2a

CCGTTAAAAGCCTCYAAATAACCC(TTTTTTT)f

24

ITS 2

58.1

EU006075e

Acfus2b Asfla4g Asfum2a Asnid2g Asnig2g Aster2g CAB5h CDU1ah CGL1h CLUS1h CP6h

CCGTTAAAAGCCTCYAATACCC(TTTTTTT) CGAACGCAAATCAATCTTTTTCCAGGT GCCGACACCCAACTTTATTTTTCTAAG(TTTTTTT) GCGTCTCCAACCTTATTTTTCTCAGGT ACGTTTTCCAACCATTCTTTCCAGGT CCGACGCATTTWTTGTGCAACTTGTTT TTATCAACTTGTCACACCAGATTATTACT(TTTTT) AAACTTGTCACGAGATTATT(TTTTTTTTTTTTTTT) TGGGAGTGTGCGTGGATCTCTCTATTCCAA TCAAACACGTTTACAGCACGACATTTC TTCCACTCATTGGTACAAACTCCAAAACTT

22 27 27 27 26 27 29 20 30 27 30

ITS ITS ITS ITS ITS ITS ITS ITS ITS ITS ITS

2 2 2 2 2 2 1 1 1 2 2

55.7 63.1 58.7 60.1 60.9 63.6 53.3 40.5 68 60.2 61

DQ648459 AY373848 AY939790 AY373888 AY373852 AJ001333 AY207067 AB049124 AY207068 AY139788 AY207079

CP8h CP10h CT3ch Exder1g Fopin1 Palil4 Pavar2 Psboy3g

TTTGGTAGGCCTTCTATATGGGGCCT(TTTTTTT) TTAACTGCGACCCTTTTCTTTCTACACA ACTCATTTTAAGCGACTTAG(TTTTTTTTTT)i ACTCTTGAATCAAATCGTGTCCAATGTCTG CAATCGTCCTTCACGGGACAATAACTT GAAATGCAGTGGCGACCYCGC(TTTTTTTT) CCGAAGACCCCTSGAACGC(TTTTTTTTTT) GGTTGCCTTCTGCGTAGTAAGTCTCTTTTG

26 28 20 30 27 21 19 30

ITS ITS ITS ITS ITS ITS ITS ITS

1 1 2 1 2 2 1 2

61.9 59.6 41.2 62.4 61.3 65.2 58.9 62.5

AY207072 AY391849 AY207080 AF050270 DQ491405 AY624189 AY373941 AY228118

Scbre3g Scpro4g Taeme4 Taeme6 PC

TGCGTAGTAGATCCTACATCTCGCATCG GGCCAGCCGTCAAACCCTCTATTCTTAT AGGTTGTCTGAGTGAGATTGCA(TTTTTTT) CCTCGTGAACGCTGTCKTGA(TTTTTTTT) GCATCGATGAAGAACGCAGC(TTTTTTTTT)

28 28 22 20 20

ITS 2 ITS 2 ITS 1 ITS 1 5.8S rRNA gene

62.4 64.1 51.4 56.9 55.7

AY625065 AY228117 DQ317583 AB176615 EF134625

a

Y stands for C or T, W stands for A or T, and K stands for T or G. nt, number of nucleotides. The ITS 1 or ITS 2 region from which the probe was designed. d Tm, melting temperature. e Sequence determined in this study and submitted to GenBank. f Multiple bases of thymine were added to the 3⬘ end of the probe. g Probes designed by Hsiao et al. (30). h Probes designed by Leaw et al. (33). i The underlined nucleotide was a mismatch intentionally introduced into the probe to avoid cross-hybridization by other species. b c

identified to the species level by using established procedures based on morphological identification, including microscopic and macroscopic characteristics (13, 32). In addition, a total of 141 nontarget strains corresponding to 135 species (see Table S1 in the supplemental material) were used to test the specificity of the array. Fungal DNA was extracted as described previously (30, 33). Clinical specimens and DNA extraction. Fifty-seven sputum samples from 39 CF patients followed in Angers University Hospital were analyzed by this array, in parallel with standard mycological examination. All clinical samples referred to the laboratory of Parasitology and Mycology of Angers University Hospital during the study period were used to evaluate the array, depending on the volume available. Briefly, sputum samples were first incubated for 30 min at room temperature with an equal volume of a mucolytic agent (Digest-Eur; Eurobio, Les Ulis, France) and then diluted 1:10 in sterile water. Aliquots (20 ␮l) were then inoculated on five agar plates: CHROMAgar Candida (Becton Dickinson, Paris, France), Sabouraud dextrose agar supplemented with chloramphenicol and gentamicin (Becton Dickinson), Sabouraud dextrose agar supplemented with chloramphenicol and cycloheximide (8), Dichloran-Rose Bengal agar supplemented with benomyl (19), and erythritol-chloramphenicol agar (29). Plates were incubated for 1 week at 37°C for the first two media and at 25°C for the others. Yeasts were identified using ID 32C test strips (bioMe´rieux, Marcyl’Etoile, France), and molds were identified by their morphological features. For DNA extraction from sputum samples, the remainders of the undiluted digested samples were first ground in liquid nitrogen with a mortar and pestle. DNA was then extracted using the DNA plant minikit (Qiagen, Les Ulis, France) according to the manufacturer’s instructions. Design of oligonucleotide probes and fabrication of arrays. Species-specific oligonucleotide probes (19- to 30-mers) were designed from the internal tran-

scribed spacer (ITS) 1 or ITS 2 regions according to sequence data in the GenBank database. The designed probes were checked for melting temperature, internal repeat, secondary structure, and GC content by using the software Vector NTI Advance 9 (Invitrogen, Carlsbad, CA) and checked for potential cross-reactivities with other fungal species by using the BLASTN program (http: //blast.ncbi.nlm.nih.gov/). A total of 24 probes (final concentration, 10 ␮M), including some previously described probes (30, 33), were used to fabricate the arrays by using nylon membranes (Table 2). In addition, a positive-control probe was designed from a conserved region in the 5.8S rRNA gene. Five to 15 bases of thymine were added to the 3⬘ end of probes that exhibited weak hybridization signals after preliminary testing (5). Oligonucleotide probes were synthesized by MDBio Inc. (Taipei, Taiwan). Arrays were prepared with an automatic arrayer (Ezspot, Taipei, Taiwan) by using a 400-␮m-diameter solid pin as described previously (33). The array (0.5 by 0.5 cm) contained 36 dots (6 ⫻ 6 dots); among them, 23 dots were used for identification of the fungal species listed in Table 2, one dot was a positive control (code PC), two dots were negative controls (code NC, tracking dye only), and 10 dots were position markers (code M, a digoxigenin-labeled ITS4 primer). The layout of different probes on the array is shown in Fig. 1. ITS amplification. For pure cultures, the ITS regions of fungi were amplified using the fungus-specific universal primers ITS1 (5⬘-TCCGTAGGTGAACCTG CGG-3⬘) and ITS4 (5⬘-digoxigenin-TCCTCCGCTTATTGATATGC-3⬘) (47), with the reverse primer being labeled with a digoxigenin molecule. Amplification of the fungal ITS regions from sputum DNA was performed by nested PCR. The first amplification was conducted using the universal primer pair V9D (5⬘-TTA AGTCCCTGCCCTTTGTA-3⬘) and LS266 (5⬘-GCATTCCCAAACAACTCGA CTC-3⬘) (37). PCR was performed with 2.5 ␮l of template DNA in a total

VOL. 47, 2009

FIG. 1. Layout of oligonucleotide probes on the array (0.5 by 0.5 cm). The positive-control probe PC located at the lower right corner was designed from a conserved region of the fungal 5.8S rRNA gene. Probe NC was a negative control (tracking dye only). Probe M was a digoxigenin-labeled universal fungal primer (ITS4) and was used as a position marker. The corresponding sequences of all probes are listed in Table 2.

MOLECULAR DETECTION OF FUNGI IN CF PATIENTS

145

genin antibodies were described previously (30). The hybridized spot (400 ␮m in diameter) could be read with the naked eye. A strain was identified as one of the species listed in Table 1 when both the positive-control probe and the speciesspecific probe (or any one of the multiple probes designed for a species) were hybridized (Fig. 2). The image of a hybridized array was captured by a scanner (Powerlook 3000; Umax, Taipei, Taiwan). Analysis of discrepant identification. If pure cultures (or clinical specimens) produced discrepant identification between culture and array hybridization, the amplicons obtained by PCR (or nested PCR) were cloned with a TOPO TA cloning kit (Invitrogen) following the manufacturer’s instructions. The ITS regions of positive clones were reamplified by using the primers ITS1 and ITS4 and sequenced on a 3130xl genetic analyzer (Applied Biosystems, Taipei, Taiwan) with a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems). Portions of the 18S, 5.8S, and 28S rRNA genes were removed from the determined sequences to obtain the exact ITS 1 and ITS 2 sequences, which were then used to search for homologous sequences in GenBank using the BLASTN program (34).

RESULTS reaction volume of 25 ␮l consisting of 10 mM Tris-HCl (pH 8.8); 50 mM KCl; 0.08% Nonidet P-40 (vol/vol) (Sigma-Aldrich, St. Louis, MO); 1.5 mM MgCl2; 1.25 U Taq DNA polymerase (Fermentas, Glen Burnie, MD); 0.2 mM each of dATP, dGTP, and dCTP; 0.1 mM each of dTTP and dUTP (Epicentre Biotechnologies, Madison, WI); 0.7 ␮M primer (each); 0.5 U uracil DNA glycosylase (Invitrogen); and 0.4% (wt/vol) bovine serum albumin (Sigma-Aldrich). The PCR mixture was incubated at 37°C for 20 min to digest possible carryover DNA by the uracil DNA glycosylase. The thermocycling conditions used for the first run of PCR were as follows: initial denaturation, 94°C, 10 min; 25 cycles of denaturation (95°C, 1 min), annealing (60°C, 1 min), and extension (72°C, 1 min); and a final extension step at 72°C for 7 min. One microliter of the product from the first reaction was then used for the second run of PCR using the universal primer pair ITS1 and ITS4 (5⬘ end labeled with a digoxigenin molecule). The reaction mixture (50 ␮l) and the thermocycling conditions of the second run of PCR were the same as those for the first run except that the uracil DNA glycosylase was omitted and 35 amplification cycles were performed. A negative control was performed with each test run by replacing the template DNA with sterile water in the PCR mixture. Hybridization procedures. The procedures for prehybridization, hybridization (55°C for 90 min), and color development after hybridization by using antidigoxi-

Probe development. Twenty-four oligonucleotide probes were designed to identify the 20 fungal species listed in Table 1 (Table 2). Under most conditions, a single probe was used to identify a fungal species, except for Acrophialaphora fusispora, Candida parapsilosis, and Talaromyces emersonii. For A. fusispora, each of the two probes (Acfus2a and Acfus2b) designed for this species produced a weak hybridization signal; however, the hybridization intensities were significantly enhanced by mixing the two probes together (with each probe at a concentration of 10 ␮M) prior to spotting on the array (Fig. 1). In addition, two probes (Taeme4 and Taeme6) were used to identify Talaromyces emersonii due to intraspecies sequence divergence in the ITS regions (Table 2). Similarly, the C. parapsilosis complex was identified by a combination of three probes (33). One base mismatch was intentionally introduced into the probe used to identify C. tropicalis to eliminate weak crosshybridization caused by a few nontarget Candida species, but

FIG. 2. Hybridization results for 20 fungal species that may colonize the airways of CF patients. The chips are alphabetically arranged according to the species names. The corresponding probes hybridized on the arrays are indicated in Fig. 1, and the corresponding sequences of the hybridized probes are shown in Table 2.

146

BOUCHARA ET AL.

the modified probe still had a good hybridization signal with C. tropicalis. The hybridization pattern of each of the 20 fungal species is shown in Fig. 2. Performance of the array for identification of pure cultures. A total of 182 target strains, including 133 reference strains and 49 clinical isolates, were tested by the array (Table 1). Of these strains, 181 were correctly identified to the species level by the array. One clinical isolate (Exophiala dermatitidis LMA 40502454) was not identified by the array. Sequencing of the ITS regions of LMA 40502454 revealed that both ITS 1 and ITS 2 sequences had 100% similarity with those of Exophiala oligosperma (GenBank accession no. DQ836797), a nontarget species in this study. Therefore, E. dermatitidis LMA 40502454 was a misidentification of E. oligosperma by the conventional identification method, and the sensitivity of the array for identification of the 20 fungal species was 100% (181/181) if isolate LMA 40502454 was excluded. Of the 141 nontarget strains (135 species) (see Table S1 in the supplemental material), only one was misidentified by the array. Aspergillus oryzae BCRC 30102 was misidentified as Aspergillus flavus (data not shown). BLAST searching revealed that the ITS 1 and ITS 2 sequences of A. oryzae BCRC 30102 displayed sequence similarities of 97% and 95%, respectively, with A. flavus as described in a previous study (30). As one nontarget strain was misidentified, a specificity of 99.2% (140/ 141) was obtained by the array. Detection limit of the array. Serial 10-fold dilutions of DNAs extracted from two strains (Aspergillus fumigatus BCRC 30502 and Paecilomyces variotii CBS 370.70) were used to determine the detection limit of the array. The array was able to detect genomic DNA of both species at a concentration of 1 pg per assay by PCR or at a concentration of 10 fg per assay by nested PCR. Direct detection of fungi in sputum samples of CF patients. Once the array was established, it was used to analyze 57 sputum samples (from 39 CF patients) for direct detection of fungi in these specimens (Table 3). The hybridization patterns of several sputum specimens are shown in Fig. 3. Among the 57 samples, 16 produced concordant results between culture and the array. For example, three species (Aspergillus fumigatus, A. terreus, and Candida albicans) were detected in specimens 1126 (patient 2) and 1821 (patient 5) by both methods (Table 3). Interestingly, A. fumigatus and C. albicans were detected by the array in four specimens (2582, 2732, 3502, and 5896) collected from a patient (patient 20) during a period of more than 4 months, and the same results were obtained by culture. For 33 sputum samples, the array detected more fungal species than did culture (Table 3). For example, Aspergillus fumigatus, Candida albicans, and C. parapsilosis were detected by the array in specimen 1305 (patient 3), while C. parapsilosis was not recovered by culture (Table 3 and Fig. 3). Five of six other sputum samples obtained from patient 3 in the following 3 months consistently revealed the presence of C. parapsilosis (data not shown), suggesting that the fungal load of the microorganism might be very low in the first sputum sample. Another example was specimen 3674 (patient 25): A. fumigatus and C. albicans were detected by array hybridization (Table 3 and Fig. 3), but only C. albicans was recovered from cultures. The detection of A. fumigatus and C. albicans in specimen 3674 by the array was confirmed by cloning and resequencing of the

J. CLIN. MICROBIOL.

ITS fragments amplified from sputum DNA by PCR. An extreme example was specimen 5911 (patient 24): four species (A. flavus, A. terreus, C. albicans, and Scedosporium prolificans) were detected by the array, while culture yielded only A. terreus (Table 3). However, A. flavus and C. albicans were recovered from subsequent sputum samples obtained from this patient (data not shown), suggesting that A. flavus and C. albicans might be present in the first clinical sample at a low level and thus were not detected by culture. Candida albicans and Candida krusei were isolated from specimen 9023 (patient 38), whereas the array detected C. albicans and C. glabrata, but not C. krusei, which was not a target species in this study (Table 3). No fungus was recovered from 12 of the 57 sputum samples, but the array detected one to seven fungal species in these specimens (Table 3). The detection of different fungi in some of these specimens was confirmed by cloning and resequencing of the ITS fragments. For example, the detection of A. fumigatus in specimen 2097 (patient 13), of C. albicans in specimen 2098 (patient 14), and of C. glabrata in specimen 6070 (patient 30) was confirmed by the cloning experiments (Table 3), but the detection of Scedosporium prolificans in specimen 6070 (patient 30) was not confirmed by the cloning experiment (Table 3). Surprisingly, no fungus was recovered from specimen 2027 (patient 10) by culture, but as many as seven species (A. flavus, A. fumigatus, A. niger, A. terreus, C. albicans, Scedosporium apiospermum, and S. prolificans) were detected by the array (Table 3). However, only three (A. flavus, A. niger, and S. prolificans) of the seven fungi were confirmed in specimen 2027 by the cloning experiment (Table 3). It should be noted that only partially discordant samples were used for the confirmation test. No fungus was isolated from specimens 2443 (patient 16), 2710 (patient 21), and 3942 (patient 27) (Fig. 3) by culture. However, the positive-control probe was hybridized in each of the three cases (Table 3). The results indicated the presence of other fungi not included in Table 1 in these sputum samples. Conversely, the array detected fewer microorganisms than did the culture methods in eight sputum samples. For example, Aspergillus fumigatus, A. terreus, Candida albicans, and Scedosporium apiospermum were recovered from specimen 1717 (patient 2) by culture, while S. apiospermum was not detected by the array (Table 3 and Fig. 3). A. fumigatus, C. albicans, Scedosporium prolificans, and A. terreus were isolated from specimen 1644 (patient 6), but the array failed to detect A. terreus in this sample (Table 3 and Fig. 3). However, A. terreus was not isolated in a specimen collected from the same patient just 1 day after specimen 1644 (data not shown), suggesting a transient colonization of the airways with a very low fungal load of the fungus. In brief, among the 57 sputum samples obtained from 39 CF patients, 16 produced concordant results between the array and culture. The array detected more fungal species than culture did in 33 samples, while the reverse was found for eight samples (Table 3). DISCUSSION In this study, an oligonucleotide array was developed to identify 20 fungal species that may be isolated from CF patients, including common and some less common species (Table 1). After a collection of 182 target and 141 nontarget strains were tested, a sensitivity of 100% and a specificity of

VOL. 47, 2009

MOLECULAR DETECTION OF FUNGI IN CF PATIENTS

147

TABLE 3. Fungal species detected in sputum samples from CF patients by means of culture, array hybridization, and cloning of the ITS regions Patient, date of sampling (yr/mo/day)

Species detected by:

Specimen no.

Culture

Aspergillus fumigatus Candida albicans Aspergillus flavus Candida albicans Aspergillus fumigatus Aspergillus terreus Candida albicans Aspergillus fumigatus Aspergillus terreus Candida albicans Scedosporium apiospermum Aspergillus fumigatus Candida albicans Aspergillus fumigatus Candida albicans

P1, 2006/02/14

1102

P1, 2006/11/13 P2, 2006/02/15

7864 1126

P2, 2006/03/09

1717

P2, 2006/03/21

2025

P3, 2006/02/22

1305

P4, 2006/02/28

1440

P5, 2006/03/06

1603

P5, 2006/03/13

1821

P5, 2006/09/08

6071

P6, 2006/03/07

1644

P6, 2006/03/08

1679

P6, 2006/11/17

8030

P7, 2006/03/08 P8, 2007/03/15

1681 1888

P9, 2006/03/16

1933

Candida albicans Aspergillus fumigatus Aspergillus terreus Candida albicans

P10, 2006/03/21

2027

Negative

Candida albicans Candida parapsilosis Aspergillus flavus Aspergillus fumigatus Aspergillus terreus Candida albicans

Aspergillus fumigatus Aspergillus terreus Candida albicans Aspergillus terreus Aspergillus fumigatus Aspergillus fumigatus Candida albicans Scedosporium prolificans Aspergillus terreus Aspergillus fumigatus Candida albicans Scedosporium prolificans Aspergillus flavus Aspergillus fumigatus Candida albicans Scedosporium prolificans

P11, 2006/03/23

2095

Aspergillus fumigatus

P11, 2006/11/14

7909

Negative

Array hybridization

ITS cloning

A. fumigatus C. albicans C. A. A. C. A. A. C.

albicans fumigatus terreus albicans fumigatus terreus albicans

A. C. A. C. C. C.

fumigatus albicans fumigatus albicans parapsilosis albicans

A. flavus A. fumigatus A. terreus C. albicans A. niger Scedosporium apiospermum S. prolificans A. fumigatus A. terreus C. albicans A. terreus A. fumigatus C. albicans S. prolificans A. fumigatus C. albicans S. prolificans A. flavus A. fumigatus C. albicans S. prolificans S. apiospermum C. albicans A. fumigatus C. albicans Aspergillus flavus A. fumigatus A. niger Scedosporium apiospermum S. prolificans Aspergillus flavus A. fumigatus A. niger A. terreus C. albicans Scedosporium apiospermum S. prolificans A. fumigatus A. flavus A. terreus Candida albicans Exophiala dermatitidis Scedosporium apiospermum Aspergillus fumigatus

A. flavus A. niger

S. prolificans

Continued on following page

148

BOUCHARA ET AL.

J. CLIN. MICROBIOL. TABLE 3—Continued

Patient, date of sampling (yr/mo/day)

Specimen no.

P12, 2006/03/23

2096

Negative

P13, P14, P15, P16, P17, P18,

2006/03/23 2006/03/23 2006/03/23 2006/04/07 2006/04/07 2006/03/28

2097 2098 2099 2443 2444 2227

Negative Negative Negative Negative Negative Scedosporium apiospermum

P19, 2006/04/10

2484

P20, 2006/04/14

2582

P20, 2006/04/21

2732

P20, 2006/05/30

3502

P20, 2006/08/30

5896

P21, 2006/04/20 P22, 2006/05/05

2710 2992

Candida albicans Aspergillus fumigatus Aspergillus fumigatus Candida albicans Aspergillus fumigatus Candida albicans Aspergillus fumigatus Candida albicans Aspergillus fumigatus Candida albicans Negative Aspergillus flavus Aspergillus fumigatus Candida albicans Scedosporium apiospermum

P22, 2006/06/06

3637

Aspergillus fumigatus Candida albicans Scedosporium apiospermum

P22, 2006/12/13

8889

Aspergillus fumigatus Candida albicans Scedosporium apiospermum

P23, 2006/05/16

3198

Aspergillus fumigatus Scedosporium apiospermum

P23, 2006/08/02

5232

Aspergillus fumigatus Scedosporium apiospermum

P23, 2006/11/03

7623

Aspergillus fumigatus Candida albicans Scedosporium apiospermum

P24, 2006/06/01

3540

Aspergillus flavus Aspergillus fumigatus Aspergillus terreus Candida parapsilosis

P24, 2006/08/30

5911

Aspergillus terreus

P25, 2006/06/07

3674

Candida albicans

P25, 2006/08/11

5433

P26, 2006/06/13

3893

Candida albicans Candida parapsilosis Candida albicans Scedosporium apiospermum

Species detected by: Culture

Array hybridization

ITS cloning

Candida glabrata Aspergillus flavus A. fumigatus A. terreus Candida albicans Exophiala dermatitidis Scedosporium apiospermum Aspergillus fumigatus Candida albicans Candida albicans Nonidentified species Candida albicans S. apiospermum Candida albicans C. glabrata C. albicans Scedosporium apiospermum A. fumigatus C. albicans A. fumigatus C. albicans A. fumigatus C. albicans A. fumigatus C. albicans Nonidentified species A. flavus A. fumigatus C. albicans S. apiospermum C. glabrata A. fumigatus C. albicans S. apiospermum C. glabrata S. prolificans A. fumigatus C. albicans S. apiospermum C. parapsilosis A. fumigatus S. apiospermum Candida albicans C. glabrata A. fumigatus S. apiospermum Candida glabrata A. fumigatus C. albicans S. apiospermum C. glabrata A. flavus A. fumigatus A. terreus C. parapsilosis C. glabrata A. terreus A. flavus Candida albicans Scedosporium prolificans C. albicans Aspergillus fumigatus C. albicans C. parapsilosis C. albicans S. apiospermum

A. fumigatus C. albicans

C. albicans

C. albicans A. fumigatus

Continued on following page

VOL. 47, 2009

MOLECULAR DETECTION OF FUNGI IN CF PATIENTS

149

TABLE 3—Continued Patient, date of sampling (yr/mo/day)

P27, P28, P29, P30,

Specimen no.

Species detected by: Culture

Array hybridization

2006/06/15 2006/07/21 2006/07/27 2006/09/08

3942 4897 5089 6070

Negative Candida albicans Candida albicans Negative

P31, 2006/09/14

6194

Candida albicans

P32, 2006/09/15 P33, 2006/09/29

6225 6630

Candida albicans Aspergillus fumigatus Candida parapsilosis

P34, 2006/11/03 P35, 2006/11/15

7622 7931

P35, 2006/12/20

9098

P36, 2006/12/05

8630

Candida albicans Aspergillus fumigatus Candida glabrata Scedosporium apiospermum Aspergillus fumigatus Candida glabrata Scedosporium apiospermum Candida albicans Scedosporium apiospermum

P37, 2006/12/13 P38, 2006/12/13

8902 9023

P39, 2006/12/19

9056

Negative Candida albicans Candida krusei Aspergillus fumigatus Candida albicans

99.2% were obtained by the array. The prominent feature of the current method is the use of a standardized protocol encompassing DNA extraction, ITS amplification, and membrane hybridization for fungal detection in sputum samples. Instead of using multiple semiselective agar plates (five agar plates used in this study) and two incubation temperatures (37°C and 25°C), the current array is relatively simple and time-saving, and results suggest that it is more sensitive than culture. However, neither the array method nor cultures will allow differentiation between colonization and a true respiratory infection. The most common fungi recovered from CF patients are Aspergillus fumigatus and Candida albicans (2, 7, 36). In this study, A. fumigatus was detected from 21 CF patients (53.8%) by the array (Table 3); this incidence rate is similar to that (45.7%) reported by Bakare et al. (2). Aspergillus fumigatus is an important fungus responsible for various diseases in CF patients, the most common being allergic bronchopulmonary

Aspergillus fumigatus Nonidentified species C. albicans C. albicans C. glabrata Scedosporium prolificans C. albicans Aspergillus fumigatus C. albicans A. fumigatus C. parapsilosis C. albicans C. glabrata C. albicans A. fumigatus C. glabrata

ITS cloning

C. glabrata C. albicans A. fumigatus

C. glabrata

A. fumigatus C. glabrata C. albicans S. apiospermum C. glabrata C. glabrata C. albicans C. glabrata A. fumigatus C. albicans C. glabrata

C. albicans

C. albicans

aspergillosis (43). Allergic bronchopulmonary aspergillosis occurs in 1 to 15% of CF patients depending on the studies, and a prevalence rate of about 2% was reported by the Cystic Fibrosis Foundation in the United States (22). Although the prevalence of non-A. fumigatus Aspergillus species is not well documented in the literature, our array results revealed that eight CF patients (20.5%) were colonized by A. flavus and the same number of patients (20.5%) were colonized by A. terreus. The role of A. flavus and A. terreus in the progression of pulmonary disease in CF patients is not clear, and their clinical role in CF needs further investigation. In addition to C. albicans, C. krusei was isolated from specimen 9023 (patient 38), but the array detected C. glabrata (Table 3). C. krusei was not included in the list of the target species (Table 2) since the yeast was rarely found in sputum samples from CF patients (22). In our previous study, the probe (code CGL1, Table 2) used to identify C. glabrata was found to have no cross-hybridization with C. krusei (33). There-

FIG. 3. Hybridization results for several sputum samples from CF patients. The corresponding probes hybridized on each array are shown in Fig. 1. The fungi detected by each array were as follows: specimen 1305 (patient 3), Aspergillus fumigatus, Candida albicans, and C. parapsilosis; specimen 1644 (patient 6), A. fumigatus, C. albicans, and Scedosporium prolificans; specimen 1679 (patient 6), A. fumigatus, C. albicans, and S. prolificans; specimen 1717 (patient 2), A. fumigatus, A. terreus, and C. albicans; specimen 3674 (patient 25), A. fumigatus and C. albicans; specimen 3942 (patient 27), an unidentified fungus; specimen 3540 (patient 24), A. flavus, A. fumigatus, A. terreus, C. glabrata, and C. parapsilosis.

150

BOUCHARA ET AL.

fore, it was highly probable that the yeast was misidentified as C. krusei. Several plates were inoculated for specimen 9023, and only two yeast colonies were detected on Sabouraud dextrose agar. The colonies were identified as C. krusei by using a latex-based agglutination kit (Fumouze Diagnostics, Asnie`res, France). However, a search in the Medline database revealed a report dealing with the evaluation of the sensitivity and specificity of the kit (16). Although sensitivity was evaluated as 100%, the specificity of the latex kit was only 95%, and falsepositive results were reported for yeast species including C. parapsilosis, C. tropicalis, C. glabrata, and several other Candida species. Unfortunately, colonization by this yeast species was quantitatively very low and transient, since two additional samples (one collected before and another collected after the specimen analyzed in this paper) revealed C. albicans exclusively. To confirm the presence of either C. krusei or C. glabrata in specimen 9023, the PCR-amplified ITS fragments were cloned and sequenced. However, the result revealed the exclusive presence of C. albicans, again indicating the very low level of ITS amplicons of other yeast species in specimen 9023 (Table 3). In the clinical settings, besides cultures, the follow-up of CF patients also comprises a serological examination, usually restricted to searching for anti-Aspergillus fumigatus serum antibodies, and a respiratory infection is suggested by the detection of a humoral immune response. In this context, a better knowledge of the fungal species colonizing the airways of a patient may help the laboratory in the selection of the most appropriate antigens to be used in this serological examination (a search for serum antibodies directed toward the fungal species detected by the array). Additionally, apart from a true respiratory infection, it may be important to detect an early colonization by some fungal species like Scedosporium apiospermum. Diabetes is a common complication of CF, and lung transplantation remains the ultimate treatment of CF patients; both situations are associated with a defective immune response and a risk for a disseminated fungal infection. Considering the low susceptibility of S. apiospermum and the tendency of this fungus to disseminate in immunocompromised patients (24, 44), it may be important to detect airway colonization by this fungus as early as possible and to initiate rapidly an appropriate antifungal therapy in order to eradicate it before chronic colonization can develop. Candida albicans was detected in 31 patients (79.5%) by the array, a value which was in agreement with the high frequency of colonization of the airways of CF patients already reported for this microorganism (2, 29). Scedosporium apiospermum was recovered from sputum samples in 8.6% of CF patients and was considered the most frequent filamentous fungus after A. fumigatus (10). In addition, 21.1% of CF patients were serologically positive for S. apiospermum, and allergic bronchopulmonary disease was observed in some patients chronically colonized by this fungus (10). In this study, a high frequency of S. apiospermum was observed (detected in 30.7% of the patients by the array method) (Table 3), suggesting that colonization by this fungus is underestimated and that, as it may trigger an inflammatory response, the fungus may have a greater pathogenic role in CF patients. The occurrence of S. prolificans in CF patients has been reported mainly in Spain (14, 17, 35). Scedosporium prolificans was detected in seven patients

J. CLIN. MICROBIOL.

(17.9%) by the array, while the microorganism was recovered from only one patient (patient 6, specimen 1644) by culture (Table 3). This reflects the difficulty of recovering S. prolificans from sputum by culture. Consequently, as with S. apiospermum, the role of S. prolificans in disease progression in CF patients may be underestimated. The black yeast Exophiala dermatitidis was detected in two patients (patients 11 and 12) by the array, but the fungus was not recovered from any of the 57 sputum samples by culture (Table 3), even though a semiselective isolation medium (erythritol-chloramphenicol agar) was used as recommended (29). In Germany, the prevalence rate of E. dermatitidis was reported in a prospective study to be 6% in CF patients (29). Moreover, clinical deterioration in a CF patient has been found to coincide with isolation of this fungus, and it was suggested that E. dermatitidis may be an etiologic agent of invasive pulmonary disease in the CF patient population (15). Currently, culture is the gold standard for the detection of fungi in sputum specimens. At the most, four fungal species were recovered from sputum samples by culture in this study, while as many as seven fungi (for example, specimens 1603 [patient 5] and 2027 [patient 10]) were detected by the array (Table 3), suggesting the inadequacy of culture in detecting the fungal diversity in these specimens. This inadequacy might be caused by differences in the growth rates of fungal species, low fungal loads in the specimens, or the administration of antifungals that may have adverse effects on the recovery of some fungi. The development of more-selective culture media is also necessary for the isolation of uncommon fungi from respiratory secretions of CF patients. However, it is also obvious that different volumes of the samples were analyzed by culture and the array method, which may account for some of the discrepancies observed in the current study. However, one cannot disregard the possible detection of nonviable fungal elements by the DNA array, but this seems to be difficult to assess. The detection of nonviable microorganisms is a common problem of PCR-based molecular methods. In this study, 12 of the 57 sputum samples were culture negative, but the array detected one to several fungal species in each of these specimens (Table 3). In general, fewer species were detected by the array in culture-negative specimens than in culture-positive samples. For example, only a single species was detected by the array in specimens 2097 (patient 13), 2098 (patient 14), 2099 (patient 15), 2444 (patient 17), and 8902 (patient 37). Multiple species were detected in other culturenegative samples by array hybridization, such as specimens 2027 (patient 10) and 2096 (patient 12); six to seven species were detected in the two samples by the array. The presence of fungal DNA in several selected culture-negative samples was confirmed by cloning and resequencing of the ITS fragments amplified by PCR (Table 3). The failure of the cloning experiments to confirm the presence of some fungi detected by the array might be caused by variation in the amounts of different fungal DNAs in the sputum extracts. It should be noted that only 10 sputum samples producing discrepant results between culture and the array methods were selected for the cloning experiments. For those specimens (patients 1, 2, 4, 5, 6, 8, and 35) in which the array detected fewer microorganisms than did the culture methods (Table 3), the follow-up data for these patients dem-

VOL. 47, 2009

onstrated a low and transient colonization of the airways by the fungal species that were not detected by the array (patients 1, 2, 4, 5, 6, 8, and 35). For patient 1, Aspergillus flavus was not detected by the array from specimen 1102 (collected on 14 February 2006). However, only one plate was positive for this fungus, yielding a unique colony, and the fungus was not recovered from five additional samples collected from 23 May 2006 to 26 February 2008. For patient 2, the detection of Scedosporium apiospermum from specimen 1717 (collected on 9 March 2006) by culture exclusively corresponded to a very low and transient colonization, since only two out of eight samples collected from 15 February 2006 to 21 February 2007 were culture positive for this fungus, with only one colony recovered from a specimen collected on 9 June 2006 and four colonies recovered from a specimen collected on 9 March 2006. For patient 4, Candida parapsilosis was not detected by the array method from specimen 1440 (collected on 28 February 2006), whereas the yeast was detected by culture. Four additional sputum samples were collected from this patient from 13 September 2006 to 29 February 2008, and C. parapsilosis was recovered from only one of these specimens, collected on 14 March 2007 (only three colonies). Similar situations were found for patients 6 and 8 (data not shown). Another situation might be the eradication of a fungus (perhaps because of the use of antifungal treatment). For example, in patient 5, two samples, collected on 13 March 2006 (specimen 1821) and 8 September 2006 (specimen 6071), were culture positive for Aspergillus fumigatus, while this fungus was detected by the array method only from the first specimen (Table 3). For this patient, a previous specimen (collected on 6 March 2006) revealed a total number of 18 colonies distributed on four plates. However, only two plates were positive, with a total number of three colonies for two specimens collected on 13 March (specimen 1821) and 11 August 2006, and the last specimen available for this patient, collected on 5 December 2006, was culture negative for A. fumigatus. The situation was a bit more complex for patient 35. For this patient, two samples were analyzed, collected on 15 November (specimen 7931) and 20 December (specimen 9098) 2006. Both samples revealed the presence of Scedosporium apiospermum by culture, but this fungus was not detected by the array method. For this patient, 10 other specimens, collected from 19 April to 20 October 2006, were analyzed, and all these samples showed the presence of S. apiospermum. Likewise, six additional samples from 2007 and five samples from 2008 were analyzed, and they were all culture positive for this fungus. An explanation for this false-negative result obtained by the array may be that a recent revision of this species (19, 20) revealed that S. apiospermum is a complex of several distinct species, and at least three of these species (undistinguishable morphologically) have been detected from respiratory specimens of CF patients. It was possible that the probe designed for S. apiospermum could not detect all these species, and further studies are needed to optimize the array. The airways of CF patients represent a surprisingly complex ecosystem. The precise contributions of the different fungal species to patient morbidity and the interspecies interactions are largely unelucidated. Understanding the microbial flora of the CF respiratory tract is of considerable importance, as patient morbidity and mortality are primarily caused by chronic

MOLECULAR DETECTION OF FUNGI IN CF PATIENTS

151

respiratory infections (21, 22, 27). Here, we have developed an array to identify 20 fungal species that can be recovered from CF patients. The whole procedure for fungal detection in sputum specimens by the array can be finished within a working day, starting from extracted DNA samples. Compared with the array method, the culture method is easier to use and requires only basic equipment. However, with the development of automated DNA extraction systems, the array method may become easier to use in the near future, especially for large CF centers. The array method may constitute a valuable tool in clinical research to determine the optimal culture conditions (number and nature of the culture media to be used and temperature and duration of incubation) for detecting the whole fungal biota that may be associated with CF and to define guidelines for the mycological examination of respiratory secretions in this particular clinical context. The current method may avoid the need for knowledge of the morphological features of filamentous fungi which are necessary for their identification and permits a shorter time to achieve results as well as the correct identification of morphologically indistinguishable species. In conclusion, the current method can be used as a potential alternative to culture or to complement culture for detection of the fungal biota colonizing the airways of CF patients. ACKNOWLEDGMENTS This study was partially supported by grants from the National Science Council (96-2320-B-006-024-MY3 and 96-2218-E-006-0294) and from the Center for Frontier Materials and Micro/Nano Science and Technology (D97-2700 and A0052), National Cheng Kung University, Taiwan. All authors are members of the ISHAM working group on filamentous fungi and respiratory infections in CF. REFERENCES 1. Al-Mohsen, I. Z., D. A. Sutton, L. Sigler, E. Almodovar, N. Mahgoub, H. Frayha, S. Al-Hajjar, M. G. Rinaldi, and T. J. Walsh. 2000. Acrophialophora fusispora brain abscess in a child with acute lymphoblastic leukemia: review of cases and taxonomy. J. Clin. Microbiol. 38:4569–4576. 2. Bakare, N., V. Rickerts, J. Bargon, and G. Just-Nubling. 2003. Prevalence of Aspergillus fumigatus and other fungal species in the sputum of adult patients with cystic fibrosis. Mycoses 46:19–23. 3. Becker, J. W., W. Burke, G. McDonald, P. A. Greenberger, W. R. Henderson, and M. L. Aitken. 1996. Prevalence of allergic bronchopulmonary aspergillosis and atopy in adult patients with cystic fibrosis. Chest 109:1536–1540. 4. Blaschke-Hellmessen, R., I. Lauterbach, K. D. Paul, K. Tintelnot, and W. Weissbach. 1994. Detection of Exophiala dermatitidis (Kano) De Hoog 1977 in septicemia of a child with acute lymphatic leukemia and in patients with cystic fibrosis. Mycoses 37(Suppl. 1):86–96. (In German.) 5. Brown, T. J., and R. M. Anthony. 2000. The addition of low numbers of 3⬘ thymine bases can be used to improve the hybridization signal of oligonucleotides for use within arrays on nylon supports. J. Microbiol. Methods 42:203–207. 6. Burns, J. L., J. Emerson, J. R. Stapp, D. L. Yim, J. Krzewinski, L. Louden, B. W. Ramsey, and C. R. Clausen. 1998. Microbiology of sputum from patients at cystic fibrosis centers in the United States. Clin. Infect. Dis. 27:158–163. 7. Cimon, B., J. Carre`re, J. P. Chazalette, J. L. Ginie`s, D. Chabasse, and J. P. Bouchara. 2000. Bronchopulmonary mycoses in cystic fibrosis. Results of a longitudinal epidemiologic study over a five-year period. J. Mycol. Me´d. 10:128–135. (In French.) 8. Cimon, B., J. Carre`re, J. P. Chazalette, J. L. Ginie`s, P. Six, D. Chabasse, and J. P. Bouchara. 1995. Fungal colonization and immune response to fungi in cystic fibrosis. J. Mycol. Me´d. 5:211–216. (In French.) 9. Cimon, B., J. Carre`re, J. P. Chazalette, J. F. Vinatier, D. Chabasse, and J. P. Bouchara. 1999. Chronic airway colonization by Penicillium emersonii in a patient with cystic fibrosis. Med. Mycol. 37:291–293. 10. Cimon, B., J. Carre`re, J. F. Vinatier, J. P. Chazalette, D. Chabasse, and J. P. Bouchara. 2000. Clinical significance of Scedosporium apiospermum in patients with cystic fibrosis. Eur. J. Clin. Microbiol. Infect. Dis. 19:53–56.

152

BOUCHARA ET AL.

11. Cimon, B., S. Challier, H. Beguin, J. Carre`re, D. Chabasse, and J. P. Bouchara. 2005. Airway colonization by Acrophialophora fusispora in patients with cystic fibrosis. J. Clin. Microbiol. 43:1484–1487. 12. de Almeida, M. B., M. H. Bussamra, and J. C. Rodrigues. 2006. Allergic bronchopulmonary aspergillosis in paediatric cystic fibrosis patients. Paediatr. Respir. Rev. 7:67–72. 13. De Hoog, G. S., J. Guarro, J. Gene, and M. J. Figueras. 2000. Atlas of clinical fungi, 2nd ed. Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands. 14. del Palacio, A., M. Garau, E. Amor, I. Martinez-Alonso, T. Calvo, A. Carrillo-Munoz, and J. Guarro. 2001. Case reports. Transient colonization with Scedosporium prolificans. Report of four cases in Madrid. Mycoses 44:321– 325. 15. Diemert, D., D. Kunimoto, C. Sand, and R. Rennie. 2001. Sputum isolation of Wangiella dermatitidis in patients with cystic fibrosis. Scand. J. Infect. Dis. 33:777–779. 16. Freydiere, A. M., L. Buchaille, R. Guinet, and Y. Gille. 1997. Evaluation of latex reagents for rapid identification of Candida albicans and C. krusei colonies. J. Clin. Microbiol. 35:877–880. 17. Garcia, E., V. Rodriguez, S. Gartner, and J. Gene. 1998. Isolation of Scedosporium prolificans in patients with cystic fibrosis. Enferm. Infecc. Microbiol. Clin. 16:488–489. (In Spanish.) 18. Geller, D. E., H. Kaplowitz, M. J. Light, A. A. Colin, et al. 1999. Allergic bronchopulmonary aspergillosis in cystic fibrosis: reported prevalence, regional distribution, and patient characteristics. Chest 116:639–646. 19. Gilgado, F., J. Cano, J. Gene´, and J. Guarro. 2005. Molecular phylogeny of the Pseudallescheria boydii species complex: proposal of two new species. J. Clin. Microbiol. 43:4930–4942. 20. Gilgado, F., J. Cano, J. Gene´, and J. Guarro. 2008. Molecular and phenotypic data supporting distinct species statuses for Scedosporium apiospermum and Pseudallescheria boydii and the proposed new species Scedosporium dehoogii. J. Clin. Microbiol. 46:766–771. 21. Gilligan, P. H. 1991. Microbiology of airway disease in patients with cystic fibrosis. Clin. Microbiol. Rev. 4:35–51. 22. Gilligan, P. H., D. L. Kiska, and M. D. Appleman. 2006. Cumitech 43, Cystic fibrosis microbiology. Coordinating ed., M. D. Appleman. ASM Press, Washington, DC. 23. Guarro, J., and J. Gene´. 2002. Acrophialophora fusispora misidentified as Scedosporium prolificans. J. Clin. Microbiol. 40:3544. 24. Guignard, S., D. Hubert, B. Dupont, P. Anract, D. Alioua, H. Guerini, A. Paugam, and M. Dougados. 2008. Multifocal Scedosporium apiospermum spondylitis in a cystic fibrosis patient. J. Cyst. Fibros. 7:89–91. 25. Haase, G., H. Skopnik, and G. Kusenbach. 1990. Exophiala dermatitidis infection in cystic fibrosis. Lancet 336:188–189. 26. Hanley-Lopez, J., and L. T. Clement. 2000. Allergic bronchopulmonary aspergillosis in cystic fibrosis. Curr. Opin. Pulm. Med. 6:540–544. 27. Harrison, F. 2007. Microbial ecology of the cystic fibrosis lung. Microbiology 153:917–923. 28. Helmi, M., R. B. Love, D. Welter, R. D. Cornwell, and K. C. Meyer. 2003. Aspergillus infection in lung transplant recipients with cystic fibrosis: risk factors and outcomes comparison to other types of transplant recipients. Chest 123:800–808. 29. Horre´, R., K. P. Schaal, R. Siekmeier, B. Sterzik, G. S. de Hoog, and N. Schnitzler. 2004. Isolation of fungi, especially Exophiala dermatitidis, in patients suffering from cystic fibrosis. A prospective study. Respiration 71:360– 366. 30. Hsiao, C. R., L. Huang, J. P. Bouchara, R. Barton, H. C. Li, and T. C. Chang. 2005. Identification of medically important molds by an oligonucleotide array. J. Clin. Microbiol. 43:3760–3768.

J. CLIN. MICROBIOL. 31. Kusenbach, G., H. Skopnik, G. Haase, F. Friedrichs, and H. Dohmen. 1992. Exophiala dermatitidis pneumonia in cystic fibrosis. Eur. J. Pediatr. 151:344– 346. 32. Larone, D. H. 2002. Medically important fungi: a guide to identification, 4th ed. ASM Press, Washington, DC. 33. Leaw, S. N., H. C. Chang, R. Barton, J. P. Bouchara, and T. C. Chang. 2007. Identification of medically important yeasts by an oligonucleotide array. J. Clin. Microbiol. 45:2220–2229. 34. Leaw, S. N., H. C. Chang, H. F. Sun, R. Barton, J. P. Bouchara, and T. C. Chang. 2006. Identification of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol. 44: 693–699. 35. Lopez, L., L. Gaztelurrutia, M. Cuenca-Estrella, A. Monzon, J. Barron, J. L. Hernandez, and R. Perez. 2001. Infection and colonization by Scedosporium prolificans. Enferm. Infecc. Microbiol. Clin. 19:308–313. (In Spanish.) 36. Ma ´iz, L., M. Cuevas, S. Quirce, J. F. Can ˜o ´n, A. Pacheco, A. Sousa, and H. Escobar. 2002. Serologic IgE immune responses against Aspergillus fumigatus and Candida albicans in patients with cystic fibrosis. Chest 121:782–788. 37. Masclaux, F., E. Gueho, G. S. de Hoog, and R. Christen. 1995. Phylogenetic relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J. Med. Vet. Mycol. 33:327–338. 38. Mehrad, B., G. Paciocco, F. J. Martinez, T. C. Ojo, M. D. Iannettoni, and J. P. Lynch III. 2001. Spectrum of Aspergillus infection in lung transplant recipients: case series and review of the literature. Chest 119:169–175. 39. Moss, R. B. 1995. Cystic fibrosis: pathogenesis, pulmonary infection and treatment. Clin. Infect. Dis. 21:839–851. 40. Nagano, Y., B. C. Millar, E. Johnson, C. E. Goldsmtih, J. S. Elborn, J. Rendall, and J. E. Moore. 2007. Fungal infections in patients with cystic fibrosis. Rev. Med. Microbiol. 18:11–16. 41. Peltroche-Llacsahuanga, H., H. Do ¨hmen, and G. Haase. 2002. Recovery of Candida dubliniensis from sputum of cystic fibrosis patients. Mycoses 45:15–18. 42. Sigler, L., and D. A. Sutton. 2002. Acrophialophora fusispora misidentified as Scedosporium prolificans. J. Clin. Microbiol. 40:3544–3545. 43. Stevens, D. A., R. B. Moss, V. P. Kurup, A. P. Knutsen, P. Greenberger, M. A. Judson, D. W. Denning, R. Crameri, A. S. Brody, M. Light, M. Skov, W. Maish, G. Mastella, et al. 2003. Allergic bronchopulmonary aspergillosis in cystic fibrosis—state of the art: Cystic Fibrosis Foundation Consensus Conference. Clin. Infect. Dis. 37(Suppl. 3):S225–S264. 44. Symoens, F., C. Knoop, M. Schrooyen, O. Denis, M. Estenne, N. Nolard, and F. Jacobs. 2006. Disseminated Scedosporium apiospermum infection in a cystic fibrosis patient after double-lung transplantation. J. Heart Lung Transplant. 25:603–607. 45. Valenza, G., D. Tappe, D. Turnwald, M. Frosch, C. Ko ¨nig, H. Hebestreit, and M. Abele-Horn. 2008. Prevalence and antimicrobial susceptibility of microorganisms isolated from sputa of patients with cystic fibrosis. J. Cyst. Fibros. 7:123–127. 46. Webb, A. K., and E. Woolnough. 2006. Candida albicans infection in adults with cystic fibrosis. J. R. Soc. Med. 99(Suppl. 46):13–16. 47. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315–322. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA. 48. Williamson, E. C., D. Speers, I. H. Arthur, G. Harnett, G. Ryan, and T. J. Inglis. 2001. Molecular epidemiology of Scedosporium apiospermum infection determined by PCR amplification of ribosomal intergenic spacer sequences in patients with chronic lung disease. J. Clin. Microbiol. 39:47–50.