Abnormal expressions of circadian-clock and circadian clock ... - Nature

International Journal of Obesity (2010) 34, 227–239 & 2010 Macmillan Publishers Limited All rights reserved 0307-0565/10 $32.00 www.nature.com/ijo

ORIGINAL ARTICLE Abnormal expressions of circadian-clock and circadian clock-controlled genes in the livers and kidneys of long-term, high-fat-diet-treated mice M-C Hsieh1,2,3,8, S-C Yang4,8, H-L Tseng2,5, L-L Hwang6, C-T Chen7 and K-R Shieh1,2,5 1 Institute of Physiological and Anatomical Medicine (formerly Institute of Integrative Physiology and Clinical Sciences), Tzu Chi University, Hualien, Taiwan; 2Institute of Neuroscience, Tzu Chi University, Hualien, Taiwan; 3Department of Internal Medicine, Buddhist Tzu Chi General Hospital, Hualien, Taiwan; 4General Education Center, Tzu Chi College of Technology, Hualien, Taiwan; 5Institute of Medical Sciences, Tzu Chi University, Hualien, Taiwan; 6Department of Physiology, Taipei Medical University, Taipei, Taiwan and 7Division of Biotechnology and Pharmaceutical Research, National Health Research Institutes, Zhunan, Miaoli, Taiwan

Objectives: Physiological and behavioral circadian rhythmicities are exhibited by all mammals and are generated by intracellular levels of circadian oscillators, which are composed of transcriptional/translational feedback loops involving a set of circadianclock genes, such as Clock, Per1–3, Cry1–2, Bmal1, Dbp, E4BP4 and CK1e. These circadian-clock genes play important roles in regulating circadian rhythms and also energy homeostasis and metabolism. Determining whether obesity induced by high-fat diet affected the expressions of circadian-clock genes and their related genes in peripheral tissues, was the main focus of this study. To address this issue, we fed male C57BL/6 mice a high-fat diet for 11 months to induce obesity, hyperglycemic, hypercholesterolemic and hyperinsulinemic symptoms, and used quantitative real-time reverse transcription-PCR to measure gene expression levels. Results: We found that the expressions of circadian-clock genes and circadian clock-controlled genes, including Per1–3, Cry1–2, Bmal1, Dbp, E4BP4, CK1e, PEPCK, PDK4 and NHE3, were altered in the livers and/or kidneys. Conclusions: These results indicate that obesity induced by high-fat diet alters the circadian-clock system, and obesity and metabolic syndrome are highly correlated with the expressions of circadian-clock genes and their downstream, circadian clockcontrolled genes. International Journal of Obesity (2010) 34, 227–239; doi:10.1038/ijo.2009.228; published online 10 November 2009 Keywords: diurnal rhythm; metabolic syndrome; liver; kidney

Introduction Obesity and being overweight pose major risks for chronic diseases, including type-2 diabetes, cardiovascular disease, hypertension, stroke and certain forms of cancer.1 Recently, the pre-disease condition, which is named metabolic syndrome, has become the center of attention; it is provoked by high-nutrient diets in both developed and developing

Correspondence: Professor K-R Shieh, Institute of Neuroscience and Institute of Physiological and Anatomical Medicine, Tzu Chi University, 701 Chung Yang Road, Section 3, Hualien 970, Taiwan. E-mail: [email protected] 8 These two authors contributed equally to this work. Received 30 June 2009; revised 8 September 2009; accepted 20 September 2009; published online 10 November 2009

countries.2 Metabolic syndrome, first described by Kylin in the 1920s as a clustering of hypertension, hyperglycemia and gout, is associated with insulin resistance and is known to precede the onset of type-2 diabetes.3 Four criteria for metabolic syndrome include central obesity, dyslipoproteinemia (high triglycerides and low high-density lipoprotein cholesterol), hypertension and glucose intolerance.4 Although metabolic syndrome is easy to identify, its pathophysiological mechanism is complex, and insulin resistance seems to play a significant role in its pathogenesis.5 As diet plays a pivotal role in producing metabolic syndrome in humans, using a high-fat diet to precipitate metabolic syndrome in animals is a proper way to study this syndrome.6 In mammals, the main molecular circadian-clock systems were originally found to play important roles in regulating

Diet-induced obesity on circadian-clock systems M-C Hsieh et al

228 circadian rhythms. The circadian-clock genes in this molecular system include Clock (circadian locomotor output cycles kaput), Bmal1 (brain and muscle Arnt like protein-1), Per1 (period-1), Per2, Per3, Cry1 (cryptochrome-1) and Cry2.7 Proteins made from Bmal1 and Clock form a dimer and a transcriptionally active complex to bind to cis-acting elements (E-boxes) within the promoter of various target genes, including Per1-3 and Cry1-2. Then the proteins made from Per1-3 and Cry1-2 function as negative regulators to suppress Clock and Bmal1 expressions. Furthermore, casein kinase-1e (CK1e) protein is thought to phosphorylate the PER proteins, thereby enhancing their instability and degradation.8–11 The CK1e protein also phosphorylates and partially activates the transcription factor, Bmal1.9 Bmal1’s expression is negatively regulated by the transcription factor reverse erythroblastosis virus-a (Rev-erb-a)12 and positively regulated by retinoic acid-receptor-related orphan receptor-a (RORa)13 via its response element.14 Additionally, the albumin-D-site-binding protein (Dbp) and the basic leucinezipper transcription factor, E4BP4, are also circadian clockcontrolled genes. Dbp is involved in the circadian transcriptional regulation of several metabolic enzymes and members of the PAR family of transcription factors,15–17 while E4BP4 inhibits the transcriptional activity of PAR transcription factors by competing for the same promoter-binding sites in target genes. The levels of protein and gene expressions of E4BP4 and Dbp also fluctuate in almost an opposite phase. Thus, these circadian-clock genes, Bmal1, Clock, Per1-3, Cry1-2 and CK1e, control the circadian rhythms of physiological output by regulating the expressions of multiple circadian clock-controlled genes, including Dbp and E4BP4.7 Interestingly, the hypothalamic suprachiasmatic nucleus is not the sole rhythmic tissue, which expresses these molecular circadian-clock systems.18,19 Lots of peripheral organs also express these circadian-clock and circadian clock-controlled genes, but the physiological roles of these genes in peripheral organs are unclear. Recently, two studies demonstrated relationships between circadian mechanism dysfunction and metabolic abnormalities. Rudic et al.20 found that Bmal1- or Clock-mutant mice exhibited impaired glucose metabolism, and Turek et al.21 found that Clock-mutant mice increased their caloric intake and total body weight relative to wild-type controls and exhibited obesity and metabolic syndrome. Zvonic et al.22 showed the circadian profiles of circadian-clock and circadian clock-controlled genes in the liver and adipose tissues, and implied that characterizations of these genes have potential therapeutic relevance with respect to the pathogenesis and treatments of obesity-related diseases, such as type-2 diabetes and metabolic syndrome. In contrast, the effects of a high-fat diet on the expressions of circadian-clock and circadian clock-controlled genes in the liver are still controversial. Yanagihara et al.23 reported that 8 weeks of high-fat-diet feeding in female C57BL/6 mice had minor effects on the expressions of circadian-clock and circadian clock-controlled genes, such as Clock, Bmal1, Per1, Per2, Cry1, International Journal of Obesity

Cry2 and Dbp, in the liver. Satoh et al.24 also reported similar results for levels of Per1, Per2 and Dbp in the liver of male ICR (Imprinting Control Region) mice after high-fatdiet treatments. Bray and Young25 also found that 4 weeks of high-fat-diet feeding had no significant effect on any circadian-clock gene oscillations in the rat liver. Recently, Kohsaka et al.26 reported that 6 weeks of high-fat-diet feeding in male C57BL/6 mice decreased the levels of Clock and Bmal1 expressions, but did not affect Per1 expression in the liver. Whether differences in the duration of the high-fat-diet treatments, sex or strain produced distinctions among the expressions of circadian-clock and circadian clockcontrolled genes in the livers in these different studies, is still an open question. However, increasing evidence has demonstrated that changes in the cellular redox potential affect the activity of circadian-clock gene transcription factors,27,28 and expressions and functions of circadian-clock genes, which regulate energy metabolism and vice versa.20,21,29,30 Here, we focused on whether the expression levels of circadian-clock and circadian clock-controlled genes in the liver and kidney were affected by long-term, high-fat-diet feeding treatments. In the current study, we demonstrated that long-term high-fat-diet feeding induced metabolic syndrome-like changes and produced abnormal expression levels of circadian-clock and circadian clock-controlled genes in the liver and kidney.

Materials and methods Animals Weaning male C57BL/6 mice were obtained from the National Laboratory Animal Center (Taipei, Taiwan) and housed under specific, pathogen-free conditions in a temperature- (21±1 1C) and 12-h light/12-h dark cyclecontrolled room. According to the experimental designs, some intact male mice (n ¼ 24) were fed a regular chow (Purina 5001; Purina Mills, St Louis, MO, USA) for 10 weeks and killed every 6 h from zeitgeber time 3 (ZT3), ZT9 and ZT15, to ZT21, for which ZT0 was defined as the lights-on period. The other animals were randomly divided into two groups. The control group (n ¼ 12) was fed a regular chow (Purina 5001) and the experimental group (n ¼ 12) was fed a high-fat diet (D12451; 4.73 kcal g1, with 45% of the kilocalories from fats, 20% from proteins and 35% from carbohydrates; Research Diet, New Brunswick, NJ, USA). After 11 months, the animals were killed to obtain trunk blood, liver and kidneys at ZT3 or ZT9. There are two reasons for selecting only ZT3 and ZT9 as the time points for killing the animal for data collection. First, the costs for chronic (11-month) high-fat diet treatment and maintenance were quite high and reached US$3000 per mouse, and the other reason was that we previously obtained detailed circadian profiles of circadian-clock genes in different brain regions18,19 and peripheral organs. We found that the


229 expression levels of most circadian-clock genes at ZT3 and ZT9 were either relatively higher or lower. Animals were treated without suffering in accordance with the guidelines of the Institutional Animal Care and Use Committee of Tzu Chi University, and National Health Research Institutes, Taiwan.

Blood chemistry and hormone measurements Fasting blood was sampled from the orbital sinus of a (12-month-old) mouse into heparinized capillary tubes at ZT3 and then centrifuged (at 6000 g for 10 min) at room temperature to obtain the plasma sample. The plasma levels of glucose, triglycerides and total cholesterol were measured by spectrophotometry (Photometer LP420; Dr Bruno Lange, Berlin, Germany) using the respective colored reagents for glucose (LCN 400), triglycerides (LCN351) and cholesterol (LCN 350). After 1 week of recovery, the serum levels of insulin were measured from trunk blood prepared by centrifugation (at 1200 g for 10 min at 4 1C) with an ultrasensitive mouse insulin ELISA kit (Mercodia, Uppsala, Sweden).

RNA isolation and reverse transcription Total RNA was purified from tissues using Trizol reagent (Gibco-BRL, Grand Island, NY, USA) according to the manufacturer’s instructions. In brief, after homogenization, chloroform was added to the samples, which were centrifuged at 12 000 g for 15 min at 4 1C. Isopropyl alcohol was added to the supernatants, which were centrifuged at 12 000 g for 10 min at 4 1C. We used chilled 75% ethanol to rinse the RNA pellet and then centrifuged it at 7500 g for 5 min at 4 1C. The RNA was resuspended in DEPC-H2O and quantified by spectrophotometry (A260/280). All RNA samples were reverse-transcribed into cDNA at the same time using the ImProm-II Reverse Transcription System (Promega, Madison, WI, USA) as well as oligo(dT)20 and random hexamer primers at 70 1C for 5 min. The master mix contained the following (per sample): ImProm-II 1 reaction buffer, 3 mM MgCl2, 0.5 mM dNTP and ImProm-II reverse transcriptase. cDNA extension was performed at 50 1C for 60 min according to the manufacturer’s instructions. Finally, the cDNA was stored at 20 1C.

Real-time quantitative PCR Primers for genes of interest (listed in Table 1) were designed using Primer Express software v2.0 (Applied Biosystems, Foster City, CA, USA) on the basis of sequence information from the National Center for Biotechnology Information database. Real-time quantitative PCR was performed in triplicate using an ABI PRISM 7700 Real-time PCR System (Applied Biosystems) with iTaq SYBR Green Supermix using ROX (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions and protocols. The universal cycling conditions (95 1C for 10 min, 40 cycles of 95 1C for 15 s and 60 1C for 1 min) were applied to all the samples. b-Actin was

Table 1

Sequences of primers for the real-time PCR

Gene

Primer sequence

b-Actin Forward Reverse

50 GCTGAGAGGGAAATCGT30 50 CGTCAGGCAGCTCATAG30

Per1 Forward Reverse

50 GTGGGCTTGACACCTCTTCT30 50 TGCTTTAGATCGGCAGTGGT30


50 GTTCCAGGCTGTGGATGAA30 50 GGCGTCTCGATCAGATCCT30


50 GTCTGGAAGGTTAGTGCACATTTCT30 50 CACACTTGCCTCCGAAATAACTC30

Clock Forward Reverse

50 CACAGGCCAGCACATGAT30 50 CACTCATTACACTCTGTTGACTCTGA30

Bmal1 Forward Reverse

50 ATTCCAGGGGGAACCAGA30 50 GAAGGTGATGACCCTCTTATCCT30

Cry1 Forward Reverse

50 ATCGTGCGCATTTCACATAC30 50 TCCGCCATTGAGTTCTATGAT30

Cry2 Forward Reverse

50 GGGAGCATCAGCAACACAG30 50 GCTTCCAGCTTGCGTTTG30

CK1e Forward Reverse

50 GCCTCTATCAACACCCACCT30 50 GGAGCCCAGGTTGAAGTACA30

Dbp Forward Reverse

50 ACAGCAAGCCCAAAGAACC30 50 GAGGGCAGAGTTGCCTTG30

E4BP4 Forward Reverse

50 GTCTTCTGATGGGGAAGACG30 50 TCCACTGGAGAATGGATGG30

PGC1a Forward Reverse

50 AGCCGTGACCACTGACAACGAG30 50 GCTGCATGGTTCTGAGTGCTAAG30

PGC1b Forward Reverse

50 CGCTCCAGGAGACTGAATCCAG30 50 CTTGACTACTGTCTGTGAGGC30

PEPCK Forward Reverse

50 CATATGCTGATCCTGGGCATAAC30 50 CAAACTTCATCCAGGCAATGTC30

PDK4 Forward Reverse

50 GCGATGTGGTAGCAGTAGTC30 50 ATGTGGTGAAGGTGTGAAGG30

NHE3 Forward Reverse

50 AGTGGCTGAAGGTGAAGAG30 50 AATGGCTGAGAGGATGTGG30

Abbreviations: Bmal1, brain and muscle Arnt like protein-1; CK1E, casein kinase 1 epsilon; Clock, circadian locomotor output cycles kaput; Cry, cryptochrome; Dbp, albumin-D-site-binding protein; E4BP4, the basic leucine zipper transcription factor; NHE, Na+/H+ exchanger; PDK4, pyruvate dehydrogenase kinase-4; PEPCK, phosphoenolpyruvate carboxykinase; Per, period; PGC1, peroxisome proliferator-activated receptor-g coactivator-1.

International Journal of Obesity


230 used as a reference; that is, each sample was normalized on the basis of its b-actin content. Relative changes in all target gene expressions were determined by analyzing the multiples of change.

Statistical analysis Values are presented as the mean±s.e.m. Differences in body weight, glucose, cholesterol and insulin levels were evaluated by Student’s t-tests and differences in relative gene expressions were evaluated by two-way analysis of variance21 followed by the Newman–Keuls multiple comparison test for post hoc analysis. A P-value o0.05 was considered significant. All statistical analysis was performed using Graphpad PRISM 4 (GraphPad Software, San Diego, CA, USA).

Results Daily profiles of circadian-clock gene expressions in the liver Expressions of the circadian-clock genes, Per1 (Figure 1a, Po0.001), Per2 (Figure 1b, Po0.001) and Bmal1 (Figure 1c, Po0.001), in the liver showed daily rhythmic patterns. The lowest level of Per1 mRNA was at ZT3 and the highest was at ZT9 (Figure 1a). By using the lowest level of Per1 mRNA at ZT3 as the basal level, the levels at ZT9, ZT15 and ZT21 were found to be increased by around 7-, 3.5-, and 1.5-fold, respectively (Figure 1a). The lowest level of Per2 mRNA was at ZT3 and the highest was at ZT15 (Figure 1b). The relative levels of Per1 mRNA at ZT3, ZT9, ZT 15 and ZT21 were 1, 3, 4.5 and 1, respectively (Figure 1b). Additionally, the lowest level of Bmal1 mRNA was at ZT9 and the highest was at ZT3 (Figure 1c). Using the lowest level of Bmal1 mRNA at ZT9 as the basal level, the relative levels of Bmal1 mRNA at ZT3, ZT9, ZT15 and ZT21 were found to be 8, 1, 1.5 and 5.5, respectively (Figure 1c). Therefore, we decided to kill chronic high-fat diet-treated mice only at ZT3 and ZT9 to measure the expression levels circadian-clock and circadian-clockcontrolled gene in the following study.

Chronic effects of a high-fat diet on body weight, blood glucose and plasma triglycerides and cholesterol A chronic (11-month) high-fat diet in male mice dietinduced obesity (DIO) induced severe obesity and changes in metabolic parameters (Figure 2). The body weight of DIO mice increased by 66% as compared with that of the controls (Figure 2a, Po0.001). Although the levels of blood glucose significantly increased by 30% (Figure 2b, Po0.001), DIO mice did not have any urine glucose, which reached the diabetic criterion (data not shown). There was no difference in the serum levels of insulin at ZT3 and ZT9 in either DIO or control mice, so we pooled the data at ZT3 and ZT9 and presented it in Figure 2c. The levels of serum insulin in DIO mice increased 5.5-fold as compared with the controls (Figure 2c, Po0.01). The levels of plasma triglycerides did International Journal of Obesity

Figure 1 Expression profiles of circadian-clock genes, Per1 (a), Per2 (b) and Bmal1 (c), in the liver of male mice after 10 weeks of regular diet treatment (n ¼ 6 per time point). The vertical line above each bar represents the s.e.m.; ***Po0.001 between groups at each time point. Bmal1, brain and muscle Arnt like protein-1; Per, period.

not change in DIO mice (Figure 2d, P40.05); however, the levels of plasma cholesterol were significantly elevated by 80% by the chronic high-fat diet (Figure 2f, Po0.001). Thus, these DIO mice revealed metabolic syndrome-like events following chronic high-fat diet treatment.


231

Figure 2 Effects of DIO on body weight (a), blood glucose (b), serum insulin (c), plasma triglyceride (d) and plasma cholesterol levels (e) in male mice after longterm (11-month) high-fat diet (n ¼ 12) or regular diet (n ¼ 12) treatment. The vertical line above each bar represents the s.e.m.; **Po0.01, ***Po0.001 compared with mice fed regular chow as the controls (open bar). DIO, diet-induced obesity.

Expression of circadian-clock and circadian clock-controlled genes in the liver Most circadian-clock and circadian clock-controlled genes in the liver revealed a difference between ZT3 and ZT9 (Figures 3–5). Lower levels of gene expressions at ZT3 and higher ones at ZT9 were found for Per1 (Figure 3a, Po0.001), Per2 (Figure 3b, Po0.001), Per3 (Figure 3c, Po0.001), Cry1 (Figure 3d, Po0.001), Cry2 (Figure 3e, Po0.001), CK1e (Figure 4a, Po0.001), Dbp (Figure 4b, Po0.001), PGC1a (peroxisome proliferator-activated receptor-g coactivator-1a) (Figure 5a, Po0.05) and PEPCK (phosphoenolpyruvate carboxykinase) (Figure 5c, Po0.001) in the livers of control group mice. In contrast, higher levels of gene expressions at ZT3 and lower ones at ZT9 were found for Bmal1 (Figure 4c, Po0.001), E4BP4 (Figure 4d, Po0.01) and PDK4 (pyruvate dehydrogenase kinase-4) (Figure 5d, Po0.001) in the livers of control group mice. Therefore, these gene expressions showed rhythmicity in the liver, but not Clock (Figure 4e, P40.05) or PGC1b (Figure 5b, P40.05). Interestingly, changes in Per1-2 (Figures 3a and b, Po0.001), Per3 (Figure 3c, Po0.01), Cry1-2 (Figures 3d and e, Po0.001), Dbp (Figure 4b, Po0.001), Bmal1 (Figure 4c, Po0.001), PGC1a (Figure 5a, Po0.001), PEPCK (Figure 5c, Po0.001)

and PDK4 (Figure 5d, Po0.001) mRNAs between ZT3 and ZT9 were also found in the livers of DIO mice. Only differences in CK1e (Figure 4a, P40.05) and E4BP4 (Figure 4d, P40.05) between ZT3 and ZT9 were not evident in the livers of DIO mice. Clock and PGC1b mRNAs in the liver still did not show a difference between ZT3 and ZT9 in the livers in either DIO or control mice (Figures 4e and 5b, P40.05). Although the chronic high-fat diet treatment did not disrupt the expression patterns of circadian-clock and circadian clock-controlled genes, the chronic high-fat diet treatment did affect the expression levels of these genes either at ZT3 or at ZT9 as compared with the regular diet-fed (control) group. The relative levels of Per1-3 mRNAs increased only at ZT9 (Figures 3a–c, Po0.001) and those of Cry1-2 (Figures 3d and e, Po0.001), CK1e (Figure 4a, Po0.001), Bmal1 (Figure 4c, Po0.05 at ZT3 and Po0.001 at ZT9), E4BP4 (Figure 4d, Po0.001), PGC1a (Figure 5a, Po0.001 at ZT3 and Po0.01 at ZT9), PEPCK (Figure 5c, Po0.01 at ZT3 and Po0.05 at ZT9) and PDK4 (Figure 5d, Po0.001) were elevated at both ZT3 and ZT9 in the livers of DIO mice. Furthermore, an increase in Dbp mRNA expression (Figure 4b, Po0.001) in the livers of DIO mice was found only at ZT3 and Clock and PGC1b mRNAs expressions International Journal of Obesity


232

Figure 3 Effects of DIO on the expressions of circadian-clock genes, Per1 (a), Per2 (b), Per3 (c), Cry1 (d) and Cry2 (e), in the livers of male mice after long-term (11-month) high-fat diet (n ¼ 6 per time point) or regular diet (n ¼ 5 per time point) treatment. Mice were killed at ZT3 and ZT9, for which ZT0 was defined as lightson. The vertical line above each bar represents the s.e.m.; **Po0.01, ***Po0.001 compared with mice fed the same diet at ZT3 in each group; ###Po0.001 compared with mice fed regular chow (open bar) at the same time points. Cry, cryptochrome; DIO, diet-induced obesity; Per, period; ZT, zeitgeber time.

still showed no change at either ZT3 or ZT9 in DIO groups as compared with those in the control group (Figures 4e and 5b, P40.05).

Expression of circadian-clock and circadian clock-controlled genes in kidneys Changes in the expression of most circadian-clock and circadian clock-controlled genes between ZT3 and ZT9 in the kidneys of the control group (Figures 6 and 7) were similar to those in the livers (Figures 3–5). Lower levels at ZT3 and higher ones at ZT9 were found for Per1-3 (Figures 6a–c, Po0.001), Cry1-2 (Figures 6d and e, Po0.001), CK1e (Figure 7a, Po0.001), Dbp (Figure 7b, Po0.001), Clock International Journal of Obesity

(Figure 7e, Po0.001) and Na þ /H þ exchanger (NHE3) (Figure 7f, Po0.001) mRNA expressions in the kidneys of control group mice. On the other hand, higher levels at ZT3 and lower ones at ZT9 were found for Bmal1 (Figure 7c, Po0.001) and E4BP4 (Figure 7d, Po0.001) in the kidneys of control group mice. Differences in these gene expressions between ZT3 and ZT9 were also preserved following chronic high-fat diet treatment. Per1 (Figure 6a, Po0.01), Per2-3 (Figures 6b and c, Po0.001), Cry1-2 (Figures 6d and e, Po0.001), Dbp (Figure 7b, Po0.001), E4BP4 (Figure 7d, Po0.001) and Clock (Figure 7e, Po0.01) mRNA expressions in kidneys showed lower levels at ZT3 and higher ones at ZT9 in DIO mice. Additionally, higher levels at ZT3 and lower ones at ZT9 in kidneys of DIO mice were found only for


233

Figure 4 Effects of DIO on the expression levels of circadian-clock and circadian clock-controlled genes, CK1e (a), Dbp (b), Bmal1 (c), E4BP4 (d) and Clock (e), in the livers of male mice after long-term (11-month) high-fat diet (n ¼ 6 per time point) or regular diet (n ¼ 5 per time point) treatment. Mice were killed at ZT3 and ZT9, for which ZT0 was defined as the lights-on period. The vertical line above each bar represents the s.e.m.; **Po0.01, ***Po0.001 compared with mice fed the same diet at ZT3 in each group; #Po0.05, ###Po0.001 compared with mice fed regular chow (open bar) at the same time points. Bmal1, brain and muscle Arnt like protein-1; CK1e, casein kinase-1e; Clock, circadian locomotor output cycles kaput; Dbp, albumin-D-site-binding protein; DIO, diet-induced obesity; E4BP4, basic leucine zipper transcription factor; ZT, zeitgeber time.

Bmal1 (Figure 7c, Po0.05). The CK1e mRNA expression in the kidneys (Figure 7a, P40.05) did not show a difference between ZT3 and ZT9 in DIO mice. Chronic high-fat diet treatment elevated the levels of Per2-3 (Figures 6b and c, Po0.001), Cry2 (Figure 6d, Po0.001), Dbp (Figure 7b, Po0.001 at ZT3 and Po0.01 at ZT9), E4BP4 (Figure 7d, Po0.001), Clock (Figure 7e, Po0.001 at ZT3 and Po0.05 at ZT9) and NHE3 (Figure 7f, Po0.001) mRNA expressions in the kidneys at both ZT3 and ZT9. The Per1 mRNA expressions in the kidneys of DIO mice increased only at ZT3 but not at ZT9 (Figure 6a, Po0.001). The expression of CK1e mRNAs increased at ZT3 (Figure 7a, Po0.001), but decreased at ZT9 (Figure 7a, Po0.001), and that of Bmal1 mRNAs was

attenuated at both ZT3 and ZT9 (Figure 7c, Po0.001) in the kidneys of DIO mice. Interestingly, levels of Cry1 mRNA expressions were not influenced by chronic high-fat diet treatment at either ZT3 or ZT9 (Figure 6d, P40.05).

Discussion Recently, several studies with either humans or animals demonstrated that circadian-clock genes are closely related to obesity, metabolic syndrome and diabetes.20,21,26,31–33 Circadian-clock genes are associated with the pathophysiology International Journal of Obesity


234

Figure 5 Effects of DIO on the expression levels of circadian clock-controlled genes, PGC1a (a), PGC1b (b), PEPCK (c) and PDK4 (d), in the livers of male mice after long-term (11-month) high-fat diet (n ¼ 6 per time point) or regular diet (n ¼ 5 per time point) treatment. Mice were killed at ZT3 and ZT9, for which ZT0 was defined as the lights-on period. The vertical line above each bar represents the s.e.m.; *Po0.05, **Po0.01, ***Po0.001 compared with mice fed the same diet at ZT3 in each group; #Po0.05, ##Po0.01, ###Po0.001 compared with mice fed regular chow (open bar) at the same time points. DIO, diet-induced obesity; PDK4, pyruvate dehydrogenase kinase-4; PEPCK, phosphoenolpyruvate carboxykinase; PGC1, peroxisome proliferator-activated receptor-g coactivator-1; ZT, zeitgeber time.

of metabolic syndrome due to impairment of adipogenesis by a deficiency in Bmal1.34 Deletion of Bmal1 also induces arrhythmicity, early onset of age-related pathologies, including myopathy and arthropathy, and altered hepatic carbohydrate metabolism;20,35,36 Clock-mutant mice are hyperphagic and obese, and similarly develop metabolic syndrome.21 Therefore, Clock, Bmal1 and other circadianclock genes are involved in maintaining the homeostasis of metabolic processes and physiological functions. Moreover, expression of circadian-clock genes and circadian clockcontrolled genes are influenced by body mass and nutrient conditions used in animal and human studies. For example, circadian-clock gene expressions were attenuated in obese KK and diabetic KK-Ay mice.31 The expression levels of circadian-clock genes, such as Per2, Bmal1 and Cry1, in adipose tissues were related to human metabolic syndrome, and close associations were also reported between the Clock polymorphisms and obesity, and metabolic syndrome.32,33 Although increasing numbers of studies found that circadian-clock and circadian clock-controlled genes are involved in regulating energy metabolism in peripheral organs, including liver, adipose tissues and skeletal muscles, the cause and effect of circadian-clock genes in obesity and metabolic syndrome are still unclear. International Journal of Obesity

Using the circadian-clock-gene-mutant and -knockout mice, previous studies only provided evidence that regular and rhythmic expressions of circadian-clock genes are important in maintaining energy homeostasis.20,21,26 Even using spontaneously obese animals as a model still cannot rule out whether abnormal expressions of circadian-clock genes are the fundamental root. The study of chronic highfat diet-induced obesity in animals is much closer to the reallife situation in human society; however, previous different studies had differing findings and conclusions. Yanagihara et al.23 reported that expression levels of circadian-clock genes were minimally influenced by 8 weeks of high-fat diet feeding in female C57BL/6 mice. In contrast, Kohsaka and Bass and their co-workers26 found that the expression levels of circadian-clock and circadian clock-controlled genes showed dramatic changes after 6 weeks of high-fat diet feeding in male C57BL/6 mice. That study26 was continued and reinforced their previous report on Clock-mutant mice.21 A possible explanation for the different results of Yanagihara et al.23 and Kohsaka et al.26 is the gender difference, because we also found that female mice need more time to become obese from high-fat diet treatment.26,37 The present study showed that a high-fat diet altered the expression levels of circadian-clock genes and circadian clock-controlled genes,


235

Figure 6 Effects of DIO on the expressions of circadian-clock genes, Per1 (a), Per2 (b), Per3 (c), Cry1 (d) and Cry2 (e), in the kidneys of male mice after long-term (11-month) high-fat diet (n ¼ 6 per time point) or regular diet (n ¼ 5 per time point) treatment. Mice were killed at ZT3 and ZT9, for which ZT0 was defined as the lights-on period. The vertical line above each bar represents the s.e.m.; **Po0.01, ***Po0.001 compared with mice fed the same diet at ZT3 in each group; ###Po0.001 compared with mice fed regular chow (open bar) at the same time points. Cry, cryptochrome; DIO, diet-induced obesity; Per, period; ZT, zeitgeber time.

and high-fat diet induced greater food consumption and higher locomotor activity during the lights-on period in obese mice as compared with the controls (data not shown); these data were similar to those of a previous study.26 Although the data in our present study were had closer resemblance to those in Kohsaka et al.’s study,26 some interesting findings in this study differed from theirs. First, we found that the expression levels of Per1-3 in the liver were greatly elevated at ZT9 (Figures 3a–c), but no change was found in Kohsaka et al.’s study.26 On the other hand, Kohsaka et al.26 found that the expression levels of Bmal1 and Clock in the liver were attenuated, but the expression level of Bmal1 in the liver was also greatly elevated at ZT3

and ZT9 (Figure 4c), whereas Clock expression showed no change (Figure 4e) in the present study. In fact, Zvonic et al.22 also found that Clock expression did not follow a consistent circadian pattern in the livers of intact mice. Third, we provide more data on changes in the expressions of circadian-clock and circadian clock-controlled gene in the livers and kidneys by chronic high-fat diet feeding in this study. One of the possibilities between the present study and that of Kohsaka et al.26 is the duration of high-fat diet feeding, because the expression levels of circadian-clock genes in the liver did not change following high-fat diet treatment for 4 weeks in our pilot study (data not shown). This implies that alterations in the expressions levels of International Journal of Obesity


236

Figure 7 Effects of DIO on the expression levels of circadian-clock and circadian clock-controlled genes, CK1e (a), Dbp (b), Bmal1 (c), E4BP4 (d), Clock (e) and NHE3 (f) in the kidneys of male mice after long-term (11-month) high-fat diet (n ¼ 6 per time point) or regular diet (n ¼ 5 per time point) treatment. Mice were killed at ZT3 and ZT9, for which ZT0 was defined as the lights-on period. The vertical line above each bar represents the s.e.m.; *Po0.05, **Po0.01, ***Po0.001 compared with mice fed the same diet at ZT3 in each group; #Po0.05, ##Po0.01, ###Po0.001 compared with mice fed regular chow (open bar) at the same time points. Bmal1, brain and muscle Arnt like protein-1; CK1e, casein kinase-1e; Clock, circadian locomotor output cycles kaput; Dbp, albumin-D-site-binding protein; DIO, diet-induced obesity; E4BP4, basic leucine zipper transcription factor; NHE, Na þ /H þ exchanger; ZT, zeitgeber time.

circadian-clock and circadian clock-controlled genes in the liver due to high-fat diet treatment are time-related. A lower duration of high-fat diet consumption produced smaller levels of circadian-clock gene expressions in a previous study,26 whereas longer duration produced higher levels in the present study. Therefore, chronic consumption of a highfat diet causes more dramatic and extensive changes in the expressions of circadian-clock gene as compared with shortterm consumption in the previous study.26 Actually the condition of chronic high-fat diet consumption is more similar to the real world in both developing and developed countries. Another possible factor is the aging effect due to International Journal of Obesity

the experimental groups in this study being 1-year old, which is defined as middle age. Several studies showed that circadian rhythms change with normal aging, including a shift in phase and decreases in amplitude38–40 and circadianclock gene expression levels.41–44 Interestingly, this phaseshifting effect of aging in circadian-clock gene and circadian clock-controlled gene expressions in cardiomyocytes and kidneys was similar to the effect reported in type-2 diabetics.40,45,46 Therefore, we assume that aging is able to exacerbate changes in the expressions of circadian-clock gene by long-term high-fat diet consumption and further worsen the abnormalities, which lead to development of


237 various syndromes and diseases, including metabolic syndrome and type-2 diabetes. The detailed mechanisms underlying these observations regarding the effects of aging require extensive further investigation and are beyond the scope of the present study. Our present results confirmed several observations that chronic high nutrients, which are commonly associated with obesity, diabetes and metabolic syndrome, affect the expressions of circadian-clock genes and circadian clock-controlled genes in the livers and kidneys. However, these gene expressions influenced by the high-fat diet showed subtle differences. It is possible that different local physiological and biochemical factors within different tissues may have different levels or conditions, which are involved in regulating circadian-clock genes and circadian clock-controlled genes. Rutter et al.27,28 suggested that the cellular redox state can potentially act as a nutrient sensor and links cell metabolism with the transcriptional activity of circadianclock genes, such as Clock and its homolog. The liver is responsible for the key elements of intermediary metabolism, such as regulating the metabolism of carbohydrates, lipids and proteins.47 The mice in this study with high-fat, diet-induced obesity had higher food consumption during the lights-on period (data not shown), and the expressions of a gluconeogenesis-related gene (PEPCK) and a lipolysis (PDK4) gene were raised during that period (Figure 5). These increases in PEPCK and PDK4 gene expressions with higher levels of blood glucose and serum insulin (Figure 2) exacerbated the processes of insulin resistance and diabetes. Although we did not use a glucose-tolerance or euglycemic insulin-clamp test to verify whether mice with chronic (11-month) high-fat diet-induced obesity were insulinresistant or glucose-intolerant, the higher levels of blood glucose and serum insulin exhibited in these mice (Figures 2b and c) should indicate insulin resistance or glucose intolerance according to the previous literature in which male C57BL/6 mice were fed a high-fat diet for only 4 or 8 weeks.48,49 Interestingly, these increases in the liver may have been due to elevation of Bmal1 and Crys expression, and elevation of CK1e expression did not abrogate or attenuate this augmentation. Further study is needed to confirm this contention. The kidneys mainly play an important role in maintaining body fluid and water homeostasis, as well as glucose production.50–53 Obesity may potentiate the development and progression of secondary focal segmental glomerulosclerosis.54,55 Recently, circadian-clock genes were shown to act on E-box elements present in the promoter region of the NHE3 and to play a direct role in regulating NHE3 gene expression in the kidneys.56,57 Levels of NHE3 gene expression were lower at ZT4 and higher at ZT8BZT12, a pattern similar to that of Per2, and this was also confirmed in this study. Since NHE3 plays an important role in the basic homeostasis of an organism through regulating Na þ , water and pH balance, fine-control of NHE3 activity by an internal clock or circadian-clock genes should allow an

organism to adapt to both acute and chronic changes in the environment.56 The internal clock system is thought to provide selective advantage for organisms to ‘predict’ or ‘anticipate’ regular environmental changes, and allows organs to prepare for eventual optimization of the appropriate response in advance.58 Therefore, the present study found that gene expressions of Per2, Per3, Cry2 and NHE3 were highly elevated at both ZT3 and ZT9. This implies that NHE3 gene expression was also elevated and strongly regulated water homeostasis in chronically high-fat diettreated mice. The limitation of this study is the few time points used to investigate detailed changes in circadian-clock gene and circadian clock-controlled gene expressions at every 3 or 4 h as in previous studies.23,26 The reasons for only choosing two time points were the high costs for chronic (11-month) highfat diet treatment, and because the greatest differences in the expression levels of most circadian-clock genes and circadian clock-controlled genes during the entire day were shown at ZT3 and ZT9 (Figure 1). Using ZT3 and ZT9 as killing times was able to minimize animal use, but still generated sufficient data to examine changes in the expressions of these genes. This might have influenced the strength of our data, but still does not obscure the novelty of our findings. In conclusion, this study confirmed previous investigations by demonstrating that expression levels of circadianclock and circadian clock-controlled genes are influenced by obesity and metabolic syndrome after chronic high-fat diet treatment. Chronic high-fat diet treatment augmented the expression levels of most circadian-clock genes and circadian clock-controlled genes in the livers and kidneys, but only disrupted the patterns of some of them.

Conflict of interest The authors declare no conflict of interest.

Acknowledgements We thank Mr DP Chamberlin for editorial assistance with the paper. This study was supported in part by the National Science Council of Taiwan (NSC95-2320-B-320-006-MY2 to KRS and NSC97-2314-B-277-001-MY3 to SCY), Tzu Chi Foundation (TCIRP95006-01 to KRS) and National Health Research Institutes, Taiwan (NHRI-EX96-9605NI to LLH and NHRI-BP-093-PP-11 to CTC).

References 1 Anderson LH, Martinson BC, Crain AL, Pronk NP, Whitebird RR, O’Connor PJ et al. Health care charges associated with physical inactivity, overweight, and obesity. Prev Chronic Dis 2005; 2: A09. 2 Laaksonen DE, Niskanen L, Lakka HM, Lakka TA, Uusitupa M. Epidemiology and treatment of the metabolic syndrome. Ann Med 2004; 36: 332–346.



238 3 Association AD. Standards of medical care in diabetesF2006. Diabetes Care 2006; 29 (Suppl 1): S4–S42. 4 Reaven GM. Role of insulin resistance in the pathophysiology of non-insulin dependent diabetes mellitus. Diabetes Metab Rev 1993; 9 (Suppl 1): 5S–12S. 5 Reaven GM, Chen YD. Role of insulin in regulation of lipoprotein metabolism in diabetes. Diabetes Metab Rev 1988; 4: 639–652. 6 Spurlock ME, Gabler NK. The development of porcine models of obesity and the metabolic syndrome. J Nutr 2008; 138: 397–402. 7 Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, King DP et al. Role of the CLOCK protein in the mammalian circadian mechanism. Science 1998; 280: 1564–1569. 8 Dunlap JC. Molecular bases for circadian clocks. Cell 1999; 96: 271–290. 9 Eide EJ, Kang H, Crapo S, Gallego M, Virshup DM. Casein kinase I in the mammalian circadian clock. Methods Enzymol 2005; 393: 408–418. 10 Eide EJ, Woolf MF, Kang H, Woolf P, Hurst W, Camacho F et al. Control of mammalian circadian rhythm by CKIepsilon-regulated proteasome-mediated PER2 degradation. Mol Cell Biol 2005; 25: 2795–2807. 11 Whitmore D, Cermakian N, Crosio C, Foulkes NS, Pando MP, Travnickova Z et al. A clockwork organ. Biol Chem 2000; 381: 793–800. 12 Preitner N, Damiola F, Lopez-Molina L, Zakany J, Duboule D, Albrecht U et al. The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 2002; 110: 251–260. 13 Sato TK, Panda S, Miraglia LJ, Reyes TM, Rudic RD, McNamara P et al. A functional genomics strategy reveals Rora as a component of the mammalian circadian clock. Neuron 2004; 43: 527–537. 14 Ueda HR, Hayashi S, Chen W, Sano M, Machida M, Shigeyoshi Y et al. System-level identification of transcriptional circuits underlying mammalian circadian clocks. Nat Genet 2005; 37: 187–192. 15 Lowrey PL, Takahashi JS. Mammalian circadian biology: elucidating genome-wide levels of temporal organization. Annu Rev Genomics Hum Genet 2004; 5: 407–441. 16 Reppert SM, Weaver DR. Coordination of circadian timing in mammals. Nature 2002; 418: 935–941. 17 Ripperger JA, Schibler U. Circadian regulation of gene expression in animals. Curr Opin Cell Biol 2001; 13: 357–362. 18 Shieh KR. Distribution of the rhythm-related genes rPERIOD1, rPERIOD2, and rCLOCK, in the rat brain. Neuroscience 2003; 118: 831–843. 19 Shieh KR, Yang SC, Lu XY, Akil H, Watson SJ. Diurnal rhythmic expression of the rhythm-related genes, rPeriod1, rPeriod2, and rClock, in the rat brain. J Biomed Sci 2005; 12: 209–217. 20 Rudic RD, McNamara P, Curtis AM, Boston RC, Panda S, Hogenesch JB et al. BMAL1 and CLOCK, two essential components of the circadian clock, are involved in glucose homeostasis. PLoS Biol 2004; 2: e377. 21 Turek FW, Joshu C, Kohsaka A, Lin E, Ivanova G, McDearmon E et al. Obesity and metabolic syndrome in circadian Clock mutant mice. Science 2005; 308: 1043–1045. 22 Zvonic S, Ptitsyn AA, Conrad SA, Scott LK, Floyd ZE, Kilroy G et al. Characterization of peripheral circadian clocks in adipose tissues. Diabetes 2006; 55: 962–970. 23 Yanagihara H, Ando H, Hayashi Y, Obi Y, Fujimura A. High-fat feeding exerts minimal effects on rhythmic mRNA expression of clock genes in mouse peripheral tissues. Chronobiol Int 2006; 23: 905–914. 24 Satoh Y, Kawai H, Kudo N, Kawashima Y, Mitsumoto A. Time-restricted feeding entrains daily rhythms of energy metabolism in mice. Am J Physiol Regul Integr Comp Physiol 2006; 290: R1276–R1283. 25 Bray MS, Young ME. Diurnal variations in myocardial metabolism. Cardiovasc Res 2008; 79: 228–237.


26 Kohsaka A, Laposky AD, Ramsey KM, Estrada C, Joshu C, Kobayashi Y et al. High-fat diet disrupts behavioral and molecular circadian rhythms in mice. Cell Metab 2007; 6: 414–421. 27 Rutter J, Reick M, McKnight SL. Metabolism and the control of circadian rhythms. Annu Rev Biochem 2002; 71: 307–331. 28 Rutter J, Reick M, Wu LC, McKnight SL. Regulation of clock and NPAS2 DNA binding by the redox state of NAD cofactors. Science 2001; 293: 510–514. 29 Lin JD, Liu C, Li S. Integration of energy metabolism and the mammalian clock. Cell Cycle 2008; 7: 453–457. 30 Liu C, Li S, Liu T, Borjigin J, Lin JD. Transcriptional coactivator PGC-1alpha integrates the mammalian clock and energy metabolism. Nature 2007; 447: 477–481. 31 Ando H, Yanagihara H, Hayashi Y, Obi Y, Tsuruoka S, Takamura T et al. Rhythmic messenger ribonucleic acid expression of clock genes and adipocytokines in mouse visceral adipose tissue. Endocrinology 2005; 146: 5631–5636. 32 Gomez-Abellan P, Hernandez-Morante JJ, Lujan JA, Madrid JA, Garaulet M. Clock genes are implicated in the human metabolic syndrome. Int J Obes (Lond) 2008; 32: 121–128. 33 Scott EM, Carter AM, Grant PJ. Association between polymorphisms in the Clock gene, obesity and the metabolic syndrome in man. Int J Obes (Lond) 2008; 32: 658–662. 34 Shimba S, Ishii N, Ohta Y, Ohno T, Watabe Y, Hayashi M et al. Brain and muscle Arnt-like protein-1 (BMAL1), a component of the molecular clock, regulates adipogenesis. Proc Natl Acad Sci USA 2005; 102: 12071–12076. 35 Bunger MK, Walisser JA, Sullivan R, Manley PA, Moran SM, Kalscheur VL et al. Progressive arthropathy in mice with a targeted disruption of the Mop3/Bmal-1 locus. Genesis 2005; 41: 122–132. 36 Kondratov RV, Kondratova AA, Gorbacheva VY, Vykhovanets OV, Antoch MP. Early aging and age-related pathologies in mice deficient in BMAL1, the core component of the circadian clock. Genes Dev 2006; 20: 1868–1873. 37 Hwang LL, Wang CH, Li TL, Chang SD, Lin LC, Chen CP et al. Sex differences in high-fat diet-induced obesity, metabolic alterations and learning and synaptic plasticity deficits in mice. Obesity 2009; In Press. DOI:10.1038/oby.2009.273. 38 Hofman MA, Swaab DF. Living by the clock: the circadian pacemaker in older people. Ageing Res Rev 2006; 5: 33–51. 39 Scarbrough K, Losee-Olson S, Wallen EP, Turek FW. Aging and photoperiod affect entrainment and quantitative aspects of locomotor behavior in Syrian hamsters. Am J Physiol 1997; 272: R1219–R1225. 40 Yamazaki S, Straume M, Tei H, Sakaki Y, Menaker M, Block GD. Effects of aging on central and peripheral mammalian clocks. Proc Natl Acad Sci USA 2002; 99: 10801–10806. 41 Asai M, Yoshinobu Y, Kaneko S, Mori A, Nikaido T, Moriya T et al. Circadian profile of Per gene mRNA expression in the suprachiasmatic nucleus, paraventricular nucleus, and pineal body of aged rats. J Neurosci Res 2001; 66: 1133–1139. 42 Claustrat F, Fournier I, Geelen G, Brun J, Corman B, Claustrat B. [Aging and circadian clock gene expression in peripheral tissues in rats]. Pathol Biol (Paris) 2005; 53: 257–260. 43 Kolker DE, Fukuyama H, Huang DS, Takahashi JS, Horton TH, Turek FW. Aging alters circadian and light-induced expression of clock genes in golden hamsters. J Biol Rhythms 2003; 18: 159–169. 44 Weinert D. Age-dependent changes of the circadian system. Chronobiol Int 2000; 17: 261–283. 45 Stavinoha MA, Rayspellicy JW, Hart-Sailors ML, Mersmann HJ, Bray MS, Young ME. Diurnal variations in the responsiveness of cardiac and skeletal muscle to fatty acids. Am J Physiol Endocrinol Metab 2004; 287: E878–E887. 46 Young ME, Wilson CR, Razeghi P, Guthrie PH, Taegtmeyer H. Alterations of the circadian clock in the heart by streptozotocininduced diabetes. J Mol Cell Cardiol 2002; 34: 223–231. 47 De Feo P, Lucidi P. Liver protein synthesis in physiology and in disease states. Curr Opin Clin Nutr Metab Care 2002; 5: 47–50.


239 48 Raubenheimer PJ, Nyirenda MJ, Walker BR. A choline-deficient diet exacerbates fatty liver but attenuates insulin resistance and glucose intolerance in mice fed a high-fat diet. Diabetes 2006; 55: 2015–2020. 49 Rossmeisl M, Rim JS, Koza RA, Kozak LP. Variation in type 2 diabetes-related traits in mouse strains susceptible to dietinduced obesity. Diabetes 2003; 52: 1958–1966. 50 Cersosimo E, Garlick P, Ferretti J. Renal glucose production during insulin-induced hypoglycemia in humans. Diabetes 1999; 48: 261–266. 51 Cersosimo E, Garlick P, Ferretti J. Renal substrate metabolism and gluconeogenesis during hypoglycemia in humans. Diabetes 2000; 49: 1186–1193. 52 Ekberg K, Landau BR, Wajngot A, Chandramouli V, Efendic S, Brunengraber H et al. Contributions by kidney and liver to glucose production in the postabsorptive state and after 60 h of fasting. Diabetes 1999; 48: 292–298.

53 Meyer C, Dostou JM, Welle SL, Gerich JE. Role of human liver, kidney, and skeletal muscle in postprandial glucose homeostasis. Am J Physiol Endocrinol Metab 2002; 282: E419–E427. 54 Hall JE. The kidney, hypertension, and obesity. Hypertension 2003; 41: 625–633. 55 Kramer H. Obesity and chronic kidney disease. Contrib Nephrol 2006; 151: 1–18. 56 Saifur Rohman M, Emoto N, Nonaka H, Okura R, Nishimura M, Yagita K et al. Circadian clock genes directly regulate expression of the Na(+)/H(+) exchanger NHE3 in the kidney. Kidney Int 2005; 67: 1410–1419. 57 Nishinaga H, Komatsu R, Doi M, Fustin JM, Yamada H, Okura R et al. Circadian expression of the Na+/H+ exchanger NHE3 in the mouse renal medulla. Biomed Res 2009; 30: 87–93. 58 Young ME, Razeghi P, Taegtmeyer H. Clock genes in the heart: characterization and attenuation with hypertrophy. Circ Res 2001; 88: 1142–1150.
