Acinetobacter baumannii outer membrane ... - Wiley Online Library

Cellular Microbiology (2008) 10(2), 309–319

doi:10.1111/j.1462-5822.2007.01041.x First published online 30 August 2007

Acinetobacter baumannii outer membrane protein A targets the nucleus and induces cytotoxicity Chul Hee Choi,1† Sung Hee Hyun,2† Ji Young Lee,1 Jun Sik Lee,1 Yong Seok Lee,3 Soon Ae Kim,4 Jeong-Pil Chae,5 Seung Min Yoo6 and Je Chul Lee1* 1 Department of Microbiology, Kyungpook National University School of Medicine, Daegu, Korea. 2 Department of Biomedical Laboratory Science, Eulji University, School of Medicine, Daejeon, Korea. 3 Department of Parasitology and Malariology, PICR, College of Medicine and Frontier Inje Research for Science and Technology, Inje University, Busan, Korea. 4 Department of Pharmacology, Eulji University, School of Medicine, Daejeon, Korea. 5 Departments of Anatomy, Kyungpook National University School of Medicine, Daegu, Korea. 6 Microbiology, Eulji University, School of Medicine, Daejeon, Korea. Summary Acinetobacter baumannii is an emerging opportunistic pathogen responsible for healthcare-associated infections. The outer membrane protein A of A. baumannii (AbOmpA) is the most abundant surface protein that has been associated with the apoptosis of epithelial cells through mitochondrial targeting. The nuclear translocation of AbOmpA and the subsequent pathology on host cells were further investigated. AbOmpA directly binds to eukaryotic cells. AbOmpA translocates to the nucleus by a novel monopartite nuclear localization signal (NLS). The introduction of rAbOmpA into the cells or a transient expression of AbOmpA–EGFP causes the nuclear localization of these proteins, while the fusion proteins of AbOmpADNLS–EGFP and AbOmpA with substitutions in residues lysine to alanine in the NLS sequences represent an exclusively cytoplasmic distribution. The nuclear translocation of AbOmpA induces cell death in vitro. Furthermore, the microinjection of rAbOmpA into the nucleus of Xenopus laevis embryos fails to develop normal embryogenesis, thus leading to embryonic death. We propose a novel pathogenic mechanism of A. baumannii regardReceived 3 April, 2007; revised 24 June, 2007; accepted 2 August, 2007. *For correspondence. E-mail [email protected]; Tel. (+82) 53 4204844; Fax (+82) 53 4275664. †These authors contributed equally to this work. © 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd

ing the nuclear targeting of the bacterial structural protein AbOmpA. Introduction The subcellular targeting of bacterial products to the mitochondria is an emerging pathogenic mechanism whereby pathogenic bacteria induce the cytotoxicity of host cells (Matarrese et al., 2007). Mitochondrial targeting and subsequent pathology have been described in some bacterial proteins, such as EspF and Map of enteropathogenic Escherichia coli (Nougayrede and Donnenberg, 2004; Nagai et al., 2005; Papatheodorou et al., 2006) and PorB of Neisseria species (Müller et al., 2000). Furthermore, some bacterial toxins and virulence-associated proteins are translocated to the nucleus: cytolethal distending toxins (Cdts) from several Gram-negative bacteria (Lara-Tejero and Galan, 2000; Nishikubo et al., 2003; McSweeney and Dreyfus, 2004); IpaH9.8 from Shigella species (Toyotome et al., 2001); SspH 1 from Salmonella species (Haraga and Miller, 2003); and YopM proteins from Yersinia species (Benabdillah et al., 2004). Cdts cause eukaryotic cells to be arrested in the G2/M transition phase of the cell cycle, thus resulting ultimately in cell death (Lara-Tejero and Galan, 2000). IpaH9.8, SspH 1 and YopM are injected into the cytosol through the type III secretion system and are translocated into the nucleus. It is likely that the translocation of toxins and virulenceassociated proteins into the nucleus represent an important pathogenic mechanism of bacteria. However, the nuclear targeting of bacterial structural proteins and the subsequent pathology have not been reported yet. The nuclear translocation of cytoplasmic proteins occurs through the nuclear pore complex (NPC). Small proteins with molecular masses of < 40 kDa move through the NPC by passive diffusion, while most macromolecules are transported through the NPC by the karyopherin b family, which shuttle between the nucleus and cytoplasm (Izaurralde and Adam, 1998; Moroianu, 1998; Pemberton et al., 1998). Macromolecular cargoes carry a basic amino acid-rich nuclear localization signal (NLS) that enters the nucleus (Mosammaparast and Pemberton, 2004). The bacterium of the genus Acinetobacter is an important hospital-acquired pathogen associated with a wide spectrum of human diseases, particularly among immunocompromised patients (Seifert et al., 1993;

310 C. H. Choi et al.

A

HEp-2 cells

Cos-7 cells

Macrophages

B

Fig. 1. Surface binding of AbOmpA in eukaryotic cells. A. Cells were incubated with 6 mg ml-1 of rAbOmpA (open histograms) or a control (grey shaded histograms) for 20 min at 4°C, washed with a PBS and incubated with rabbit antiserum against AbOmpA. Cells were stained with Alexa 488-conjugated anti-rabbit IgG, washed and analysed using flow cytometry. B. Macrophages were incubated with different concentrations of rAbOmpA and analysed using flow cytometry. MFIs are shown. Data are mean values ⫾ standard deviations from the results of three individual experiments.

Bergogne-Bérézin and Towner, 1996). Among the Acinetobacter species from clinical specimens, Acinetobacter baumannii is the most commonly associated with human infections and is of great concern in a clinical setting because of its multiple antibiotic resistance and high mortality among infected patients (Gudiol, 2000; Corbella et al., 2001; Kuo et al., 2004; Wisplinghoff et al., 2004; Abbott, 2005; Chen et al., 2005; Taccone et al., 2006). The pathogenic mechanism of this microorganism, however, has not been well elucidated. The outer membrane protein A of A. baumannii (AbOmpA, previously called Omp38) is a potential virulence factor of A. baumannii. It was previously demonstrated that the purified AbOmpA from A. baumannii ATCC 19606T induced the apoptosis of eukaryotic cells through mitochondrial targeting (Choi et al., 2005). In this study, the potential of AbOmpA to translocate into the nucleus and the consequent cytotoxicity of the host cells were investigated. We show that monopartite NLS traffics AbOmpA to the nuclei of host cells and that AbOmpA

induces cell death in vitro and frog embryonic death in vivo. The results elucidate a novel pathogenic mechanism of A. baumannii with regard to the nuclear targeting of AbOmpA.

Results AbOmpA binds to eukaryotic cells To determine whether AbOmpA binds to host cells, epithelial cells (HEp-2), fibroblasts (Cos-7) and monocytederived macrophages (U937) were incubated with recombinant AbOmpA (rAbOmpA) at 4°C for 20 min. The binding of rAbOmpA to the cell surface was analysed using flow cytometry. The mean fluorescent intensities (MFIs) of the cells treated with rAbOmpA increased compared with the untreated control cells (Fig. 1A). The binding of rAbOmpA to the surface of macrophages was in a dose-dependent manner, but it was partly saturable at 9 mg ml-1 of rAbOmpA (Fig. 1B). These results indicate

© 2007 The Authors Journal compilation © 2007 Blackwell Publishing Ltd, Cellular Microbiology, 10, 309–319

Nuclear targeting of AbOmpA 311

A

B

C

HEp-2 cell

Macrophages

Cos-7 cell

Fig. 2. Subcellular localization of AbOmpA. A. HEp-2 cells were treated with 6 mg ml-1 of rAbOmpA for 24 h and stained with Alexa 488 phalloidin for actin filaments and rabbit antiserum against AbOmpA, followed by secondary Alexa 568-conjugated anti-rabbit antibody. The arrows indicate the nuclear localization of rAbOmpA. B. HEp-2 cells were treated with 6 mg ml-1 of rAbOmpA for 24 h and stained with a MitoTrackerTM for intact mitochondria and rabbit antiserum against AbOmpA, followed by secondary Alexa 488-conjugated anti-rabbit antibody. The arrows and arrowheads indicate the nuclear and mitochondrial localization of rAbOmpA respectively. C. Cells were treated with 6 mg ml-1 of rAbOmpA. The nucleus was stained with DAPI (blue). The rAbOmpA was labelled with rabbit antiserum against AbOmpA, followed by Alexa 568-conjugated anti-rabbit IgG antibody (red). The merged images show the nuclear localization of rAbOmpA. A, ¥200; B and C, ¥400.

that rAbOmpA directly binds to the surface of different types of host cells. AbOmpA targets to the nuclei of eukaryotic cells as well as the mitochondria To determine the subcellular distribution of AbOmpA, HEp-2 cells were treated with rAbOmpA for 24 h and

stained with Alexa 488 phalloidin and rabbit antiserum against AbOmpA, followed by a secondary Alexa 568conjugated anti-rabbit antibody. The rAbOmpA was localized in the cytoplasmic and nuclear compartments (Fig. 2A). The rAbOmpA in the cytoplasmic compartment was colocalized with the mitochondria, as demonstrated by double staining of the cells with a MitoTrackerTM for intact mitochondria and rabbit antiserum against AbOmpA


312 C. H. Choi et al. Table 1. Bacterial strains and plasmids used in this study. A. baumannii strain ATCC 19606T E. coli strain DH5a BL21 (DE3) ECT00 ECT00-1 ECT01 ECT02 ECT03 ECT03-1 ECT04 ECT05-1 ECE01 ECM01 ECM01-1 ECNLS-M1 ECNLS-M2 ECNLS-M3 Plasmid pGEM-T easy pET28a pEGFP-N2 pEGFP-C2 pT1 pT2 pT3 pT3-1 pT4 pT5-1 pE1 pM1 pM1-1 pNLS-M1 pNLS-M2 pNLS-M3

Type strain Competent cells for pEGFP-N2 vector Competent cells for pET28a vector (F– ompT hsdSB(rB–mB–) gal dcm) pEGFP-N2/DH5a pEGFP-C2/DH5a pT1{truncated ompA (AbOmpA1-229) [pEGFP-N2]}/DH5a pT2 {truncated ompA (AbOmpA103-356) [pEGFP-N2]}/DH5a pT3 {ompA (AbOmpA) [pEGFP-N2]}/DH5a pT3-1 {ompA (AbOmpA) [pEGFP-C2]}/DH5a pT4 {truncated ompA (AbOmpADNLS1-319) [pEGFP-N2]}/DH5a pT5-1 {truncated ompA (AbOmpA230-356) [pEGFP-C2]}/DH5a pE1 {ompA (AbOmpA) [pET28a]}/BL21 (DE3) pM1 {ompA (AbOmpA) [pET28a]}/DH5a pM1-1 {ompA (AbOmpA) [pEGFP-N2]}/DH5a pNLS-M1 {ompA (AbOmpA 329QQ330 [pEGFP-N2]}/DH5a pNLS-M2 {ompA (AbOmpA320ATA322 [pEGFP-N2]}/DH5a pNLS-M3 {ompA (AbOmpA320ATAEGRAMNQQ330 [pEGFP-N2]}/DH5a PCR cloning vector His-tagged fusion protein expression vector GFP expression vector GFP expression vector PCR fragment (T-1 and T-4) from A. baumannii/pEGFP-N2 PCR fragment (T-3 and T-7) from A. baumannii/pEGFP-N2 PCR fragment (T-1 and T-7) from A. baumannii/pEGFP-N2 PCR fragment (T-1 and T-7) from A. baumannii/pEGFP-C2 PCR fragment (T-1 and T-6) from A. baumannii/pEGFP-N2 PCR fragment (T-5 and T-7) from A. baumannii/pEGFP-C2 PCR fragment (E-1 and E-8) from A. baumannii/pET28a PCR fragment (C-1 and C-3) from A. baumannii/pET28a PCR fragment (C-1 and C-2) from A. baumannii/pEGFP-N2 PCR fragment (P-1 and P-2) from A. baumannii/pEGFP-N2 PCR fragment (P-3 and P-4) from A. baumannii/pEGFP-N2 PCR fragment (P-3 and P-4) from pNLS-M1/pEGFP-N2

(Fig. 2B). In addition, the unexpected nuclear localization of rAbOmpA was detected in the merged confocal images. To determine whether the nuclear targeting of rAbOmpA is a consistent phenomenon in different types of host cells, such as epithelial cells, fibroblasts and macrophages, cells were treated with rAbOmpA and then stained with 4′,6-diamidino-2-phenyllindole dihydrochloride (DAPI) and rabbit antiserum against AbOmpA, followed by a secondary Alexa 568-conjugated anti-rabbit antibody. The rAbOmpA was localized in the nuclei of epithelial cells, fibroblasts and macrophages (Fig. 2C). These results suggest that rAbOmpA targets the nucleus of host cells as well as mitochondria. Nuclear translocation of AbOmpA is dependent on the NLS In most cases, the exclusive nuclear localization of cytoplasmic proteins suggests the presence of a specific NLS, which is characterized by arginine- and/or lysine-rich sequences. We determined the presence of a putative NLS by visual inspection of the deduced amino acid sequences of AbOmpA. A putative monopartite NLS region (KTKEG RAMNRR) was identified between residues 320 and

330 (GenBank accession number AY485227). To determine the functionality of the putative NLS, full-length AbOmpA1-356, truncated AbOmpA and AbOmpADNLS1-319 were cloned into the pEGFP-N vector in the frame N-terminus of EGFP (Table 1). These constructs were transiently transfected into Cos-7 cells, and these cells were examined using fluorescent microscopy in order to assess the distribution of the resulting fusion proteins (Fig. 3A). Cells transfected with the pEGFP-N vector alone and the pEGFP–AbOmpA1-356 construct displayed green fluorescence in the cytoplasmic and nuclear compartments. Cells expressing truncated AbOmpA103-356, which contain NLS regions, exclusively exhibited nuclear fluorescence, while the fusion proteins of truncated AbOmpA1-229 and AbOmpADNLS1-319 were localized in the cytoplasm. These results indicate that the nuclear targeting of AbOmpA is dependent on the NLS. To determine the direct contribution of NLS sequences to the nuclear translocation of AbOmpA, site-directed mutagenesis was performed in which two adjacent arginine residues were replaced with glutamine residues (NLS-M1, KTKEGRAMNQQ) and lysine residues were replaced with alanine residues (NLS-M2, ATAEGRAMNRR). A double mutant was constructed that contained positively


Nuclear targeting of AbOmpA 313 A EGFP

AbOmpA(1-356)

AbOmpAΔNLS

AbOmpA(1-229)

AbOmpA (103-356)

B NLS-M1

NLS-M2

NLS-M3

Fig. 3. Nuclear translocation of AbOmpA fused to EGFP in Cos-7 cells. Subcellular localization was determined using fluorescence microscopy. All transfected cells displayed green fluorescence. A. Cells were transiently transfected with AbOmpA, small fragments of AbOmpA and AbOmpADNLS fused to EGFP at the N-terminus and incubated for 24 h. B. Cells were transfected with AbOmpANLS-M1 (KTKEGRAMNQQ), AbOmpANLS-M2 (ATAEGRAMNRR) or AbOmpANLS-M3 constructs (ATAEGRAMNQQ) and incubated for 24 h. A and B, ¥200.

charged amino acid changes in the NLS sequences (NLS-M3, ATAEGRAMNQQ). The fusion proteins of NLS-M1 that fused to EGFP were distributed in the nuclei of eukaryotic cells, while the fusion proteins of NLS-M2 and NLS-M3 were exclusively localized in the cytoplasm (Fig. 3B). These results suggest that the two lysine residues are essential for the nuclear translocation of AbOmpA. The identical NLS sequences are found among the A. baumannii–A. calcoaceticus complex To assess the possibility of the nuclear translocation of major outer membranes among the Acinetobacter species, the deduced amino acids of OmpA or OmpA-like proteins in the Acinetobacter species were aligned with AbOmpA. A. baumannii, Acinetobacter genomic species 3 and 13TU carried identical NLS sequences to the major outer membrane proteins, but A. baylyi, A. radioresistens and unknown Acinetobacter species (Ofori-Darko et al., 2000) carried NLS sequences with a substitution in K320S or K320N. These results suggest that OmpA or OmpA-like proteins of the A. baumannii–A. calcoaceticus complex (Acb complex) can enter the nucleus of host cells. Nuclear AbOmpA induces cell death in vitro It has been shown that the purified AbOmpA from A. baumannii ATCC19606T induced cell death through the

mitochondrial targeting of epithelial cells (Choi et al., 2005). To determine whether the nuclear translocation of AbOmpA also directly affects the viability of cells, Cos-7 cells were transiently transfected with the pEGFP– AbOmpA230-356 construct and incubated for 48 h. The pEGFP-C2 vector was used to enhance the expression of green fluorescence in the fusion proteins of AbOmpA. The fusion proteins of pEGFP–AbOmpA230-356 were exclusively distributed in the nuclei. The propidium iodide (PI) intensities of the cells expressing green fluorescence were analysed using flow cytometry. The viability of the Cos-7 cells transfected with the pEGFP-C vector and pEGFP–AbOmpA230-356 was significantly different (P < 0.01) at 75.6% and 40.7% respectively. These results suggest that the nuclear translocation of truncated AbOmpA is directly associated with cell death. To determine whether rAbOmpA induces apoptosis or necrosis, macrophages were treated with 6 mg ml-1 of rAbOmpA for 24 h. Although HEp-2 cells and Cos-7 cells treated with 6 mg ml-1 of rAbOmpA did not show any morphological changes of cell death, the same concentration of rAbOmpA induced cell death in macrophages (Fig. 2A and 2C). This result suggests that macrophages have low threshold concentrations of rAbOmpA for cell death as compared with HEp-2 and Cos-7 cells. Both the cytoplasmic and nuclear localization of rAbOmpA were observed in the macrophages treated with rAbOmpA. The apoptotic cell populations increased as early as 4 h after incubation and peaked at 24 h, but the


314 C. H. Choi et al. the blastomeres microinjected with the buffer alone failed to develop normally (Fig. 5B). These results suggest that nuclear AbOmpA directly induces cytotoxicity in vivo. Discussion

Fig. 4. Apoptotic cell death induced by AbOmpA. Macrophages were treated with 6 mg ml-1 of rAbOmpA for 24 h and stained with Annexin V and Propidium iodide. The apoptotic cell (upper right and lower right compartments) and necrotic cell (upper left compartment) populations were analysed using flow cytometry.

necrotic cell populations did not increase (Fig. 4). The apoptotic and necrotic populations were 29.5% and 2.2% at 24 h respectively. This result suggests that the subcellular targeting of rAbOmpA induces the apoptosis, but not necrosis of macrophages. Microinjected rAbOmpA inhibits normal development of Xenopus laevis embryos To determine whether nuclear AbOmpA induces cytotoxicity in vivo, two-cell embryos of X. laevis were microinjected into the nucleus of the blastomeres with rAbOmpA (25 ng) or a dialysis buffer for protein purification. The microinjection of oocytes with rAbOmpA caused gross morphological changes that had a lighter colour and a mottling of the pigment (Fig. 5A). A section of embryos microinjected with a dialysis buffer showed normal development, such as the formation of cavities and the lining of cells, while the embryos microinjected with rAbOmpA failed to develop and eventually suffered embryonic death. All blastomeres microinjected with rAbOmpA degenerated within 24 h after the injection, while 9.2% of

The possibility of the nuclear translocation of bacterial structural proteins has been shown by the prediction of NLS sequences in E. coli genomes (Cokol et al., 2000), but there is no information regarding the nuclear targeting and the subsequent pathology of bacterial structural proteins. Herein, we report that the most abundant outer membrane protein in A. baumannii, AbOmpA, translocates to the nucleus via a monopartite NLS. The identification of NLS sequences makes them attractive candidates for the nuclear targeting of AbOmpA. The introduction of rAbOmpA into or the expression of AbOmpA–EGFP fusion proteins within eukaryotic cells can cause the nuclear localization of these proteins. We used target mutagenesis to demonstrate that two positively charged lysine residues in the NLS sequences are responsible for the nuclear targeting of AbOmpA. NLS sequences are only conserved in the Acb complex, which is genetically closely related and includes the most prevalent acinetobacters in a clinical setting, but A. baylii and A. radioresistens from the environment and unknown Acinetobacter species from clinical specimens (Ofori-Darko et al., 2000) do not carry identical NLS sequences that can be found in the Acb complex. The conservation of NLS sequences in a major outer membrane protein is an important genetic feature that distinguishes the Acb complex from other Acinetobacter species. For the first time, these results demonstrate the molecular basis for the nuclear targeting of bacterial structural proteins among bacterial pathogens. The outer membrane of Gram-negative bacteria is a unique structure. Outer membrane proteins play a physiological role in the penetration of small solutes as porin, as receptors for bacteriophages and in the maintenance of the integrity of the outer membrane. Furthermore, outer membrane proteins are important pathogen-associated molecular patterns (PAMPs) in Gram-negative bacteria, and their roles are increasingly recognized in bacterial pathogenesis and immune responses in hosts (Beveridge, 1999; Jeannin et al., 2002; Asakawa et al., 2003; Chalifour et al., 2004; Shao et al., 2005). AbOmpA is the most abundant outer membrane protein in A. baumannii strains (Jyothisri et al., 1999), and it plays an important role in the pathogenesis of A. baumannii through mitochondrial targeting (Choi et al., 2005). In the current study, we focused on the nuclear translocation of AbOmpA and its relevance to cytotoxicity, although AbOmpA simultaneously targets the mitochondria and the nucleus of eukaryotic cells. Cells transfected with the pEGFP–AbOmpA230-356 construct that carries NLS


Nuclear targeting of AbOmpA 315 A

X 40

X 200

AbOmpA

Buffer

B

Fig. 5. Degeneration of X. laevis embryos by rAbOmpA. A. Fifty nanolitres of rAbOmpA (25 ng) or a dialysis buffer was microinjected into the nuclei of the blastomeres in two-cell embryos. The stereomicroscopic images of the degenerated embryos 24 h after the microinjection of rAbOmpA (left panel). Degenerated embryos microinjected with rAbOmpA at 24 h were fixed, paraffin-embedded, sectioned and stained with haematoxylin and eosin. Magnification ¥40 (middle panel) and ¥200 (right panel). B. The number of degenerated embryos that had a lighter colour and the mottling of the pigment were calculated using stereomicroscopy. In each experiment, 100 embryos were microinjected with rAbOmpA (䉬 n = 60) or buffer alone (䊉, n = 40). Data represent mean values ⫾ standard deviation of two separate experiments.

sequences showed an exclusive nuclear distribution of green fluorescence and underwent cell death with a higher frequency than cells transfected with the pEGFP-C2 vector. This suggests the direct cytotoxicity of nuclear AbOmpA in vitro. Furthermore, frog embryos microinjected with rAbOmpA in the nucleus degenerated to normal embryogenesis. These results suggest that nuclear AbOmpA is apparently associated with cytotoxic-

ity, which is a novel pathogenic mechanism of bacterial structural proteins. The pathological mechanisms of nuclear-targeting bacterial proteins, such as CdtB of some Gram-negative bacteria (Lara-Tejero and Galan, 2000; Nishikubo et al., 2003; McSweeney and Dreyfus, 2004), and VirD2 and VirE2 of Agrobacterium tumefaciens (Shurvinton et al., 1992; Citovsky et al., 1997), have been characterized.


316 C. H. Choi et al. Table 2. Primers used in this study. Primer

Sequences (5′→3′)

Restriction enzyme

T-1 T-3 T-4 T-5 T-6 T-7 E-1 E-8 C-1 C-2 C-3 P-1 P-2 P-3 P-4

ACAAGCTTCATGAAATTGAGTCGTATTG ACAAGCTTCATGAACTTCTATGTTACTTCTGATT GGAATTCTTATTCCATGTTAAGGTCTTC ACAAGCTTCATGCTTCGTGTGTTCTTTGAT GGAATTCTTAGTTGTCAGCAATCGGT GGAATTCTTATTGAGCTGCTGCA ACAGGATCCATGAAATTGAGTCGTATT ACAAGCTTTTATTGAGCTGCTGCA AAAAGGATCCATGAAATTGAGTCGTATT AAAACTCGAGGAATTCCATGAAATTGAGTCGTATT CCCCGTCGACAAGCTTTTGAGCTGCTGCAGGAGCTGC GGTCGTGCTATGAACCAACAAGTATTCGCGACAATCACT AGTGATTGTCGCGAATACAACAACGTTCATAGCACGACC CAACCGATTGCTGACAACGCAACTGCAGAAGGTCGTGCTATGAAC GTTCATAGCACGACC TTCTGCAGTTGCGTTGTCAGCAATCGGTTG

HindIII HindIII EcoRI HindIII EcoRI EcoRI BamHI HindIII BamHI EcoRI HindIII

Unlike other nuclear-targeting bacterial proteins, AbOmpA possesses multiple subcellular targeting which can be directed to the nucleus and mitochondria. The mitochondrial targeting of AbOmpA induced the apoptosis of eukaryotic cells through the activation of caspases cascades and the translocation of apoptosis-inducing factors to the nuclei (Choi et al., 2005). In the current study, we demonstrated that the nuclear targeting of AbOmpA induced cell death in vitro and in vivo. These results suggest that both the mitochondrial and nuclear targeting of AbOmpA is responsible for the cell death of eukaryotic cells. Further details regarding the regulation of the subcellular targeting of AbOmpA should be determined, because AbOmpA alters the physiological functions of the mitochondria and the nuclei. OmpA-like proteins or a major outer membrane protein among the Enterobacteriaceae family are involved in interaction with host cells. For example, OmpA of E. coli K1 is responsible for adherence to human brain microvascular endothelial cells (Shin et al., 2005); OmpA of enterohemorrhagic E. coli mediates intestinal epithelial cell binding (Torres and Kaper, 2003); and OmpA of Klebsiella pneumoniae binds to and activates human macrophages, dendritic cells and epithelial cells (Jeannin et al., 2000; Pichavant et al., 2003). In the present study, we showed that AbOmpA directly bound to the surfaces of cells, suggesting that it plays an important role in the interaction of A. baumannii with host cells. In the previous study, we demonstrated that A. baumannii interacted with human bronchial epithelial cells through fimbriae, but they were also entrapped by cellular protrusions (Lee et al., 2006). However, bacterial molecules that are involved with cell adherence and invasion remain unclear. The role of AbOmpA in the interaction of A. baumannii with host cells should be further studied, because cell adherence and invasion are essential steps for the colonization and infection of A. baumannii.

In summary, we have demonstrated AbOmpA binding, the subcellular targeting and the subsequent cytotoxicity. AbOmpA induces the apoptosis of host cells through mitochondrial and nuclear targeting. We propose a novel pathogenic mechanism of bacterial structural protein AbOmpA with regard to nuclear targeting. The NLS sequences are responsible for the nuclear targeting of AbOmpA, and they are conserved in the major outer membrane proteins of the Acb complex. Multiple subcellular targeting of AbOmpA to the cell membrane, mitochondria and nuclei, may provide additional strategies which will allow A. baumannii to survive in hosts. Experimental procedures Bacterial strains, plasmids and DNA manipulations The bacterial strains and plasmids used in this study are listed in Table 1. A. baumannii was grown on MacConkey agar plates or in a Luria–Bertani (LB) broth at 37°C. E. coli DH5a and BL21 (DE3) were grown on a LB agar plate or in an LB broth at 37°C. When necessary, ampicillin (100 mg ml-1) and kanamycin (25 mg ml-1) were added to the medium. Routine DNA manipulations were performed as described previously (Sambrook et al., 1989), or performed as recommended by the manufacturers of the reagents. DNA sequencing was performed by the dideoxy chain termination method using an ABI Prism 3100 Analyzer (Applied Biosystems). Polymerase chain reaction (PCR) reagents were purchased from Promega, and a PCR was performed using a GeneAmp PCR system 9600 (Perkin-Elmer). The primers used in this study are listed in Table 2.

Cell culture HEp-2 cells from human laryngeal epithelial cells, U937 cells from human monocytes and Cos-7 cells from African green monkey kidney cells were used. HEp-2 cells and Cos-7 cells were grown in Dulbecco’s modified Eagle’s medium (Gibco BRL) supplemented with 10% fetal bovine serum (FBS; HyClone), 2 mM L-glutamine, 1000 U ml-1 penicillin G, and 50 mg ml-1 strep-


Nuclear targeting of AbOmpA 317 tomycin at 37°C in 5% CO2. Macrophages were cultured in RPMI 1640 (Gibco BRL) supplemented with 10% FBS and 2 mM L-glutamine at 37°C in 5% CO2. U937 cells were allowed to differentiate into macrophages for 4 days, and they matured by adding 500 ng ml-1 of phorbol 12-myristate 13-acetate (Sigma) overnight. Cells were seeded in 35 mm dishes or 24-well tissue culture plates to transfect plasmids or to treat rAbOmpA proteins.

Construction and expression of AbOmpA–EGFP fusion proteins The full-length or truncated ompA gene of A. baumannii was amplified using specific primers (Table 2). The chromosomal DNA was isolated from A. baumannii ATCC 19606T and used as a PCR template. The PCR products were ligated into a pGEM-T easy vector for PCR cloning (Promega) and then transformed into E. coli DH5a (Promega). Plasmids containing the abompA inserts were subjected to a DNA sequence analysis to verify the fidelity of the PCR. Plasmid DNA, from a clone that harbours the correct sequence of the abompA gene, was digested with restriction enzymes. The liberated abompA gene fragments were ligated into the pEGFP-N2 or pEGFP-C2 (Clontech) that had been already digested with the same enzymes. The plasmid DNA was used to transform E. coli DH5a. Plasmids were analysed by restriction digestion analysis and DNA sequencing. Cos-7 cells that were seeded at a density of 5 ¥ 105 per dish were transiently transfected the following day with 1–2 mg ml-1 of plasmid DNA using FuGene 6 (Roche). The transfection mixture was removed after 6 h of incubation, and fresh media were added to the cells. After incubation with various time points, samples were fixed with 4% paraformaldehyde and examined using fluorescence microscopy (Carl Zeiss).

Purification of rAbOmpA proteins The full-length ompA gene was amplified using the primer pairs C-1 and C-3. PCR products that were digested with BamHI and HindIII were ligated into the pET28a expression vector (Novagen). E. coli BL21 (DE3)/pET28a harbouring the ompA gene grew in an LB medium at 37°C, and recombinant proteins were overexpressed with 1 mM IPTG at 25°C for 4 h. After sonication of the bacterial cells, the pellets containing the inclusion bodies were discarded, and the supernatant containing the soluble form of AbOmpA was collected by centrifugation. The protein samples were loaded onto a 5 ml HiTrapTM FF column (Amersham Biosciences) that was equilibrated with a binding buffer (20 mM sodium phosphate, 500 mM NaCl and 5 mM imidazole). His-tagged AbOmpA was eluted by an elution buffer (20 mM sodium phosphate, 500 mM NaCl and 500 mM imidazole). The samples were massively dialysed against the elution buffer without imidazole, and then they were dialysed with a phosphate-buffered saline (PBS, pH 7.4) to reduce the salt concentrations. The rAbOmpA was incubated with an endotoxin removal resin (Sigma) overnight and concentrated by Centricon (2000 MW cut-off; Millipore). The purified rAbOmpA was tested for endotoxin activity using the Limulus amoebocyte lysate assay (Sigma).

amplified using the primer pairs C-1 and C-3 and cloned into a pET28a vector plasmid. The ompA insert was re-cloned into a pEGFP-N2 vector using the primer pairs C-1 and C-2. The NLS-M1 mutagenic oligonucleotide was AAAACTAAAGAAGGTC GTGCTATGAACCAACAA. The underlined bases changed from CGTCGT encoding RR to CAACAA encoding QQ by a PCR using the primers P-1 and P-2. The NLS-M2 oligonucleotide was GCAACTGCAGAAGGTCGTGCTATGAACCGTCGT. The underlined bases changed from AAAACTAAA encoding KTK to GCAACTGCA encoding ATA by a PCR using the primers P-3 and P-4. The NLS-M3 oligonucleotide was GCAACTGCAG AAG GTCGTGCTATGAACCAACAA. The amino acids of the NLS sequences were changed from KTKEGRAMNRR to ATAEGRAMNQQ. Clones were sequenced to confirm the correct mutation.

Cell binding of rAbOmpA Cells 2 ¥ 105 were incubated at 4°C for 20 min in the buffer (RPMI medium-0.1% BSA) with 6 mg ml-1 of rAbOmpA, followed by a polyclonal anti-rabbit AbOmpA antibody. The cells were then washed with a PBS and stained with Alexa 488 anti-rabbit IgG antibody (Molecular Probes). A flow cytometry analysis was performed using a FACSCalibur (Becton Dickinson).

Fluorescent and confocal microscopy Cells were seeded at a density of 5 ¥ 104 in glass coverslips the day before the assay. After treatment of 6 mg ml-1 of rAbOmpA for 24 h, the cells were washed with a PBS, fixed in 4% paraformaldehyde and permeabilized for 10 min with a PBS containing 0.25% Triton X-100. AbOmpA was labelled with a polyclonal anti-rabbit AbOmpA antibody, followed by Alexa 488- or 568conjugated goat anti-rabbit IgG antibody (Molecular Probes). The nuclei were stained with DAPI (Molecular Probes). Cellular actin and mitochondria were stained with Alexa 488 phalloidin (Molecular Probes) and MitotrackerTM (Molecular Probes) respectively. The samples were observed using a Nikon fluorescent microscope or a Carl Zeiss confocal microscope.

Quantification of cell viability Cos-7 cells were transiently transfected with either a pEGFP-C2 plasmid or a pEGFP–AbOmpA230-356 construct and incubated for 48 h. The adherent and detached cells were collected, washed twice in a PBS and resuspended in a buffer containing 10 mM Hepes (pH 7.4), 140 mM NaCl and 2.5 mM CaCl2. PI (BD Biosciences) was added to the cells that were then incubated for 15 min in the dark. The PI intensity of the cells expressing green fluorescence was assessed using flow cytometry. To determine whether rAbOmpA-treated macrophages underwent apoptosis or necrosis, an Annexin V-FITC apoptosis detection kit (BD Biosciences) was used according to the manufacturer’s instructions.

Manipulation of X. laevis eggs Site-directed mutagenesis Oligonucleotide-directed mutagenesis was performed using a site-directed mutagenesis kit (Stratagene). The ompA gene was

Fertilized X. laevis eggs were obtained from an adult male and female that were injected with human chorionic gonadotropin (Sigma). The vitelline membranes were removed by immersing


318 C. H. Choi et al. the embryos in a thioglycolic acid solution, and the embryos were transferred into 60 mm plastic Petri dishes filled with saline. The developmental stages of the embryos were identified according to the normal developmental table of Nieuwkoop and Faber (1967). For nuclear injections of rAbOmpA, the animal pole of the embryos was positioned upright. By using an electric microinjector (Drummond), 25 ng (a total of 50 nL) of rAbOmpA was injected into nuclei that were easily visible against the dark background of the animal hemisphere. As a control, 50 nL of a dialysis buffer that were used for protein purification was injected. The nuclear injection was preliminarily verified by a 10% Nile Blue vital dye solution (Wako). After microinjection, the embryos were transferred into individual wells of the 96-well plates containing saline and then cultured at 18–26°C. The degenerated or dead embryos were recorded by using stereoscopy (Nikon). The degenerated embryos were fixed in 3% (v/v) formaldehyde, paraffin-embedded, sectioned and stained with haematoxylin and eosin.

Acknowledgements We thank Mae Ja Park (Department of Anatomy, Kyungpook National University School of Medicine) for her technical assistance with the manipulation of the frog embryos. This study was supported by a Grant from the Korea Science and Engineering Foundation, Republic of Korea (Project No. R05-2003-00010067-0).

References Abbott, A. (2005) Medics braced for fresh superbug. Nature 436: 758. Asakawa, R., Komatsuzawa, H., Kawai, T., Yamada, S., Goncalves, R.B., Izumi, S., et al. (2003) Outer membrane protein 100, a versatile virulence factor of Actinobacillus actinomycetemcomitans. Mol Microbiol 50: 1125–1139. Benabdillah, R., Mota, L.J., Lutzelschwab, S., Demoinet, E., and Cornelis, G.R. (2004) Identification of a nuclear targeting signal in YopM from Yersinia spp. Microb Pathog 36: 247–261. Bergogne-Bérézin, E., and Towner, K.J. (1996) Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin Microbiol Rev 9: 148– 165. Beveridge, T.J. (1999) Structures of Gram-negative cell walls and their derived membrane vesicles. J Bacteriol 181: 4725–4733. Chalifour, A., Jeannin, P., Gauchat, J.F., Blaecke, A., Malissard, M., N’Guyen, T., et al. (2004) Direct bacterial protein PAMP recognition by human NK cells involves TLRs and triggers alpha-defensin production. Blood 104: 1778–1783. Chen, H.P., Chen, T.L., Lai, C.H., Fung, C.P., Wong, W.W., Yu, K.W., and Liu, C.Y. (2005) Predictors of mortality in Acinetobacter baumannii bacteremia. J Microbiol Immunol Infect 38: 127–136. Choi, C.H., Lee, E.Y., Lee, Y.C., Park, T.I., Kim, H.J., Hyun, S.H., et al. (2005) Outer membrane protein 38 of Acinetobacter baumannii localizes to the mitochondria and induces apoptosis of epithelial cells. Cell Microbiol 7: 1127–1138.

Citovsky, V., Guralnick, B., Simon, M.N., and Wall, J.S. (1997) The molecular structure of agrobacterium VirE2single stranded DNA complexes involved in nuclear import. J Mol Biol 271: 718–727. Cokol, M., Nair, R., and Rost, B. (2000) Finding nuclear localization signals. EMBO Rep 1: 411–415. Corbella, X., Montero, A., Pujol, M., Dominguez, M.A., Ayats, J., Argerich, M.J., et al. (2001) Escherichia coli CdtB mediates cytolethal distending toxin cell cycle arrest. Infect Immun 69: 3418–3422. Gudiol, F. (2000) Emergence and rapid spread of carbapenem resistance during a large and sustained hospital outbreak of multiresistant Acinetobacter baumannii. J Clin Microbiol 38: 4086–4095. Haraga, A., and Miller, S.I. (2003) A Salmonella enterica serovar Typhimurium translocated leucine-rich repeat effector protein inhibits NF-kB-dependent gene expression. Infect Immun 71: 4052–4058. Izaurralde, E., and Adam, S. (1998) Transport of macromolecules between the nucleus and the cytoplasm. RNA 4: 351–367. Jeannin, P., Renno, T., Goetsch, L., Miconnet, I., Aubry, J.P., Delneste, Y., et al. (2000) OmpA targets dendritic cells, induces their maturation and delivers antigen into the MHC class I presentation pathway. Nat Immunol 1: 502–509. Jeannin, P., Magistrelli, G., Goetsch, L., Haeuw, J.F., Thieblemont, N., Bonnefoy, J.Y., and Delneste, Y. (2002) Outer membrane protein A (OmpA): a new pathogen-associated molecular pattern that interacts with antigen presenting cells-impact on vaccine strategies. Vaccine 20 (Suppl. 4): A23–A27. Jyothisri, K., Deepak, V., and Rajeswari, M.R. (1999) Purification and characterization of a major 40 kDa outer membrane protein of Acinetobacter baumannii. FEBS Lett 443: 57–60. Kuo, L.C., and Teng, L.J., Yu, C.J., Ho, S.W., and Hsueh, P.R. (2004) Dissemination of a clone of unusual phenotype of pan-drug-resistant Acinetobacter baumannii at a university hospital in Taiwan. J Clin Microbiol 42: 1759–1763. Lara-Tejero, M., and Galan, J.E. (2000) A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 290: 354–357. Lee, J.C., Koerten, H., van den Broek, P., Beekhuizen, H., Wolterbeek, R., van den Barselaar, M., et al. (2006) Adherence of Acinetobacter baumannii strains to human bronchial epithelial cells. Res Microbiol 157: 360–366. Matarrese, P., Falzano, L., Fabbri, A., Gambardella, L., Frank, C., Geny, B., et al. (2007) Clostridium difficile toxin B causes apoptosis in epithelial cells by thrilling mitochondria: involvement of ATP-sensitive mitochondrial potassium channels. J Biol Chem 282: 9029–9041. McSweeney, L.A., and Dreyfus, L.A. (2004) Nuclear localization of the Escherichia coli cytolethal distending toxin CdtB subunit. Cell Microbiol 6: 447–458. Moroianu, J. (1998) Distinct nuclear import and export pathways mediated by members of the karyopherin b family. J Cell Biochem 70: 231–239. Mosammaparast, N., and Pemberton, L.F. (2004) Karyopherins: from nuclear-transport mediators to nuclearfunction regulators. Trends Cell Biol 14: 547–556. Müller, A., Gunther, D., Brinkmann, V., Hurwitz, R., Meyer,


Nuclear targeting of AbOmpA 319 T.F., and Rudel, T. (2000) Targeting of the pro-apoptotic VDAC-like porin (PorB) of Neisseria gonorrhoeae to mitochondria of infected cells. EMBO J 19: 5332–5343. Nagai, T., Abe, A., and Sasakawa, C. (2005) Targeting of enteropathogenic Escherichia coli EspF to host mitochondria is essential for bacterial pathogenesis: critical role of the 16th leucine residue in EspF. J Biol Chem 280: 2998–3011. Nieuwkoop, P.D., and Faber, J. (1967) Normal Table of Xenopus laevis, 2nd edn. Amsterdam: North-Holland. Nishikubo, S., Ohara, M., Ueno, Y., Ikura, M., Kurihara, H., Komatsuzawa, H., et al. (2003) An N-terminal segment of the active component of the bacterial genotoxin cytolethal distending toxin B (CDTB) directs CDTB into the nucleus. J Biol Chem 278: 50671–50681. Nougayrede, J.P., and Donnenberg, M.S. (2004) Enteropathogenic Escherichia coli EspF is targeted to mitochondria and is required to initiate the mitochondrial death pathway. Cell Microbiol 6: 1097–1111. Ofori-Darko, E., Zavros, Y., Rieder, G., Tarle, S.A., van Antwerp, M., and Merchant, J.L. (2000) An OmpA-like protein from Acinetobacter spp. stimulates gastrin and interleukin-8 promoters. Infect Immun 68: 3657–3666. Papatheodorou, P., Domanska, G., Oxle, M., Mathieu, J., Selchow, O., Kenny, B., and Rassow, J. (2006) The enteropathogenic Escherichia coli (EPEC) map effector is imported into the mitochondrial matrix by the TOM/Hsp70 system and alters organelle morphology. Cell Microbiol 8: 677–689. Pemberton, L.F., Blobel, G., and Rosenblum, J.S. (1998) Transport routes through the nuclear pore complex. Curr Opinion Cell Biol 10: 392–399. Pichavant, M., Delneste, Y., Jeannin, P., Fourneau, C., Brichet, A., Tonnel, A., and Gosset, P. (2003) Outer membrane protein A from Klebsiella pneumoniae activates bronchial epithelial cells: Implication in neutrophils recruitment. J Immunol 171: 6697–6705.

Sambrook, J., Fritsch, E., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Press. Seifert, H., Baginsky, R., Schulze, A., and Pulverer, G. (1993) The distribution of Acinetobacter species in clinical culture materials. Zentralbl Bakteriol 279: 544–552. Shao, S.H., Wang, H., Chai, S.G., and Liu, L.M. (2005) Research progress on Helicobacter pylori outer membrane protein. World J Gastroenterol 11: 3011–3013. Shin, S., Lu, G., Cai, M., and Kim, K.-S. (2005) Escherichia coli outer membrane protein A adheres to human brain microvascular endothelial cells. Biochem Biophys Res Commun 330: 1199–1204. Shurvinton, C.E., Hodges, L., and Ream, W. (1992) A nuclear localization signal and the C-terminal omega sequence in the Agrobacterium tumefaciens VirD2 endonuclease are important for tumor formation. Proc Natl Acad Sci USA 89: 11837–11841. Taccone, F.S., Rodriguez-Villalobos, H., De Backer, D., De Moor, V., Deviere, J., Vincent, J.L., and Jacobs, F. (2006) Successful treatment of septic shock due to pan-resistant Acinetobacter baumannii using combined antimicrobial therapy including tigecycline. Eur J Clin Microbiol Infect Dis 25: 257–260. Torres, A.G., and Kaper, J.B. (2003) Multiple elements controlling adherence of enterohemorrhagic Escherichia coli O157: H7 to HeLa cells. Infect Immun 71: 4985–4995. Toyotome, T., Suzuki, T., Kuwae, A., Nonaka, T., Fukuda, H., Imajoh-Ohmi, S., et al. (2001) Shigella protein IpaH (9.8) is secreted from bacteria within mammalian cells and transported to the nucleus. J Biol Chem 276: 32071–32079. Wisplinghoff, H., Bischoff, T., Tallent, S.M., Seifert, H., Wenzel, R.P., and Edmond, M.B. (2004) Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis 39: 309–317.
