against Dengue Virus Infection -Oligoadenylate ...

Distinct Antiviral Roles for Human 2′,5′ -Oligoadenylate Synthetase Family Members against Dengue Virus Infection This information is current as of June 13, 2013.

Ren-Jye Lin, Han-Pang Yu, Bi-Lan Chang, Wei-Chun Tang, Ching-Len Liao and Yi-Ling Lin J Immunol 2009; 183:8035-8043; Prepublished online 18 November 2009; doi: 10.4049/jimmunol.0902728 http://www.jimmunol.org/content/183/12/8035

References

Permissions Email Alerts

Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscriptions Submit copyright permission requests at: http://www.aai.org/ji/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/cgi/alerts/etoc

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 9650 Rockville Pike, Bethesda, MD 20814-3994. Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

Downloaded from http://www.jimmunol.org/ by guest on June 13, 2013

Subscriptions

This article cites 46 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/183/12/8035.full#ref-list-1

The Journal of Immunology

Distinct Antiviral Roles for Human 2ⴕ,5ⴕ-Oligoadenylate Synthetase Family Members against Dengue Virus Infection1 Ren-Jye Lin,* Han-Pang Yu,* Bi-Lan Chang,*† Wei-Chun Tang,*‡, Ching-Len Liao,‡§ and Yi-Ling Lin2*†‡§

D

engue virus (DEN),3 a member of the flavivirus genus of the Flaviviridae family, is an enveloped and mosquitoborne virus that contains a single-stranded, positivesense RNA genome. DEN infection can result in dengue fever (DF), dengue hemorrhagic fever (DHF), and dengue shock syndrome (DSS) in humans. Epidemiological studies show that DEN infection causes an estimated 50 –100 million cases of DF and several hundred thousand cases of DHF/DSS annually around the world (1). Other members of the flavivirus genus, such as West Nile virus (WNV), yellow fever virus, and Japanese encephalitis virus also cause health problems in humans. The 2⬘,5⬘-oligoadenylate synthetase (OAS) is an IFN-induced protein that plays an important role in the antiviral action of IFN. In the presence of dsRNA or ssRNA with secondary structures, OAS can be activated to catalyze the oligomerization of ATP into 2⬘,5⬘-linked oligoadenylate (2-5A), which in turn can bind to and activate the latent RNase L (2, 3). Activated RNase L degrades viral and cellular RNA, predominantly at single-stranded UA and *Institute of Biomedical Sciences, †Genomics Research Center, Academia Sinica; ‡ Graduate Institute of Life Sciences, and §Department of Microbiology and Immunology, National Defense Medical Center, Taipei, Taiwan, Republic of China Received for publication August 18, 2009. Accepted for publication October 16, 2009. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1

This work was supported by grants awarded to Y.-L.L. from the National Science Council (NSC-95-2320-B-001-031-MY3 and NSC 97-3112-B-001-002) and from Academia Sinica, Taiwan.

2

Address correspondence and reprint requests to Dr. Yi-Ling Lin, Institute of Biomedical Sciences, Academia Sinica, Number 128, Section 2, Academia Road, Taipei 115, Taiwan. E-mail address: [email protected]

3

Abbreviations used in this paper: DEN, dengue virus; DF, dengue fever; DHF, dengue hemorrhagic fever; Dox, doxycycline; DSS, dengue shock syndrome; MOI, multiplicity of infection; OAS, 2⬘,5⬘-oligoadenylate synthetase; OASL, OAS-like; RIN, RNA integrity number; rRNA, ribosomal RNA; sh, short hairpin; WNV, West Nile virus. Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0902728

UU dinucleotides (4, 5). Oas1b, one of the eight Oas1 genes in the mouse genome, has been identified as a flavivirus resistance gene (6, 7). Flavivirus-susceptible mouse strains encode a C-terminally truncated OAS1b protein because of a missense mutation in the Oas1b gene and are more vulnerable to WNV infection. Furthermore, genetic knock-in of the Oas1b resistance allele into a susceptible mouse strain confers resistance to the yellow fever virus (8). In vitro data also show that cells expressing wild-type OAS1b but not C-terminally truncated OAS1b efficiently block WNV replication (9, 10). Thus, in vivo and in vitro experiments indicate that mouse Oas1b is an important genetic factor in flavivirus resistance. However, how this OAS1b mutation affects flavivirus sensitivity is not yet fully understood. There is evidence that RNase L may not be involved in this protection, because OAS1b-mediated antiviral effects still occur in RNase L-knockdown mouse cells (10) despite the establishment of a clear antiviral role for RNase L in WNV infection (11, 12). The human OAS gene family is composed of four genes, termed OAS1, OAS2, OAS3, and OAS-like (OASL), located on chromosome 12 (2). By alternative splicing, these genes encode 10 different isoforms, including five OAS1 isoforms (p42, p44, p46, p48, and p52), two OAS2 isoforms (p69 and p71), a single OAS3 (p100), and two OASL isoforms (p30 and p59) (13–17). Human OAS1, OAS2, and OAS3 are composed of one, two, and three OAS domains and form a tetramer, a dimer, and a monomer, respectively (18), whereas human OASL lacks OAS activity (15, 16, 19). These various human OAS proteins appear to be differentially induced in different types of cells and are characterized by different subcellular locations and enzymatic parameters, suggesting that these proteins might have distinct roles (2). Unlike their mouse counterparts, the roles of human OAS genes in flavivirus resistance are largely unknown. Recently, a genetic variation in the human OAS1 gene was associated with an increased risk of WNV disease (20). An A/G single nucleotide polymorphism at the exon 6 splice acceptor site of the OAS1 gene alters OAS1 splicing and is associated with basal OAS activity (13). The frequency of the “A”


The 2ⴕ,5ⴕ-oligoadenylate synthetase (OAS) and its downstream effector RNase L play important roles in host defense against virus infection. Oas1b, one of the eight Oas1 genes in the mouse genome, has been identified as a murine flavivirus-resistance gene. Four genes, OAS1, OAS2, OAS3, and OAS-like (OASL), have been identified in the human OAS gene family, and 10 isoforms, including OAS1 (p42, p44, p46, p48, and p52), OAS2 (p69 and p71), OAS3 (p100), and OASL (p30 and p59) can be generated by alternative splicing. In this study, we determined the role of the human OAS/RNase L pathway in host defense against dengue virus (DEN) infection and assessed the antiviral potential of each isoform in the human OAS family. DEN replication was reduced by overexpression and enhanced by knockdown of RNase L expression, indicating a protective role for RNase L against DEN replication in human cells. The human OAS1 p42, OAS1 p46, and OAS3 p100, but not the other OAS isoforms, blocked DEN replication via an RNase L-dependent mechanism. Furthermore, the anti-DEN activities of these three OAS isoforms correlated with their ability to trigger RNase L activation in DEN-infected cells. Thus, OAS1 p42/p46 and OAS3 p100 are likely to contribute to host defense against DEN infection and play a role in determining the outcomes of DEN disease severity. The Journal of Immunology, 2009, 183: 8035– 8043.

8036

ANTI-DENGUE ACTIVITY OF OAS1 p42/p46 AND OAS3

Table I. Construction of the human OAS, OAS-like, and RNase L cDNA clones in this study

Clone Names

GenBank Accession No.

cDNA Lengths (bp)

Expected Protein Sizes (kDa)

Primers

Nucleotide Sequences (5⬘33⬘)

NM_002534.2

1095

41.7

Forward Reverse

ATGATGGATCTCAGAAATACCC TCAAGCTTCATGGAGAGGG

OAS1 p44

AJ629455.1

1149

43.9

Forward Reverse

ATGATGGATCTCAGAAATACCC CTAAGCAACCTGGAAACTATAGGATAA

OAS1 p46

NM_016816.2

1203

46.0

Forward Reverse

ATGATGGATCTCAGAAATACCC TCAGAGGATGGTGCAGGTC

OAS1 p48

NM_001032409.1

1245

47.5

Forward Reverse

ATGATGGATCTCAGAAATACCC TCAGGAGACCTGGGTTCTGTC

OAS1 p52

AY730627.1

1383

52.2

Forward Reverse

ATGATGGATCTCAGAAATACCC TTATCTATGATAGGATAGAGGGCATAGA

OAS2 p69

NM_002535.2

2064

78.8

Forward Reverse

ATGGGAAATGGGGAGTCCC TTAGATGACTTTTACCGGCACTTT

OAS2 p71

NM_016817.2

2160

82.4

Forward Reverse

ATGGGAAATGGGGAGTCCC CTAGAAGTTTCTTTTAGAATTATTATTCAGGA

OAS3 p100

NM_006187.2

3264

121.3

Forward Reverse

GATGGACTTGTACAGCACCCC TCACACAGCAGCCTTCACTG

OASL p59

NM_003733.2

1545

59.2

Forward Reverse

ATGGCACTGATGCAGGAACTG CTAACTGGCTGGAAACAGAGCC

OASL p30

NM_198213.1

768

29.1

Forward Reverse

ATGGCACTGATGCAGGAACTG TCATAGCAACAGTCCTGTTTCAGG

RNase L

NM_021133.2

2226

83.5

Forward Reverse

ATGGAGAGCAGGGATCATAACA TCAGCACCCAGGGCTGG

allele at this single nucleotide polymorphism, which allows splicing to generate OAS1 p48 and p52 but not OAS1 p46, is increased in WNV seroconverters (20). Because WNV infection is less likely to result in seroconversion in individuals with the “G” genotype, which generates OAS1 p46 with higher OAS activity, OAS1 is likely to play an important antiviral role during the early phase of WNV infection. IFN plays an important role in host defense against DEN infection in vitro and in vivo (21, 22). Using a microarray, IFN-related gene induction has been demonstrated in DEN-infected cells and in patients infected with DEN (23, 24). Furthermore, the majority of genes that are strongly up-regulated in the PBMCs of individuals with DF compared with PBMCs of individuals with DHF are IFN-induced genes, suggesting a protective role for the IFN system in DEN infection (25). Despite clinical and experimental evidence, the antiviral mechanisms of IFN on DEN are not clear and the role of the OAS/RNase L system in DEN infection is largely unknown. For this work we conducted a comprehensive study to test the antiviral potential of the 10 known human OAS isoforms of OAS1, OAS2, OAS3, and OASL on DEN replication and to clarify the possible involvement of RNase L in this antiviral effect. Distinct antiviral activity was noted among these 10 OAS members. OAS1 p42, OAS1 p46, and OAS3 p100, but not the other members, exhibited anti-DEN activity, and these antiviral effects were largely lost in cells deprived of RNase L expression. Furthermore, RNase L activity measured by ribosomal RNA (rRNA) integrity using an RNA chip indicated that human OAS1 p42, OAS1 p46, and OAS3 p100 triggered potent activation of RNase L during DEN replication. Thus, different members of the human OAS family contribute differently to host defense against DEN infection, and the significance and implications of this are discussed.

Materials and Methods Viruses, cell lines, chemicals, and Abs The DEN-2 PL046 strain (26) used in this study was propagated in the mosquito cell line C6/36, which was grown in RPMI 1640 medium con-

taining 5% FBS. Baby hamster kidney cells (BHK-21) for plaque assay were grown in RPMI 1640 medium containing 5% FBS. The human lung epithelial carcinoma cell line A549 was maintained in F-12 medium (Invitrogen) supplemented with 10% FBS. The tetracycline-regulated expression human embryonic kidney 293 cell line (Invitrogen) was grown in DMEM (Sigma-Aldrich) containing 10% FBS and 5 ␮g/ml blasticidin (InvivoGen). Roferon-A, a recombinant IFN-␣-2a, was obtained from Roche. Hygromycin was purchased from InvivoGen. Doxycycline (Dox) and puromycin were obtained from Clontech and Sigma, respectively. Mouse monoclonal anti-dsRNA Ab (J2 mAb; English & Scientific Consulting), rabbit monoclonal anti-hemagglutinin (HA) Ab (Upstate Biotechnology), mouse monoclonal anti-HA Ab (Covance), and mouse monoclonal antiRNase L Ab (Novus Biologicals) were used.

Plasmid construction and lentivirus generation The cDNAs encoding human OAS (p42, p44, p46, p48, p52, p69, p71, and p100), OASL (p59 and p30), and RNase L were amplified from the RNA of IFN-␣-treated A549 cells. Reverse transcription was conducted by the ThermoScript RT-PCR system (Invitrogen) using oligo(dT) as a primer. The full-length cDNA was then amplified by PCR using the specific primers listed in Table I. The cDNA fragments were cloned into the TA vector pCR3.1 (Invitrogen) and subcloned to a HA-tagged pcDNA3 expression vector (pcDNA3/HA) with an in-frame fusion of HA-tag at the N-termini. All of the cDNAs were sequenced, and their sequences were the same as those reported in GenBank (Table I). A pcDNA5/TO vector (Invitrogen) was used for the inducible expression of OAS and RNase L. An R667A mutated RNase L was generated by single-primer mutagenesis as previously described (27), using the primer annealing to nt 2143–2191 of RNase L mRNA, with the mutated sequences underlined (5⬘-TGGGTGATCT GCTAAAGTTCATCGCGAATTTGGGAGAACACATTGATGA-3⬘. The self-inactivating lentiviral vector (pSIN), in which the expression of an inserted gene is under the control of a constitutive spleen focus-forming virus promoter (28), was used in this study for the expression of various OAS proteins. For wild-type RNase L and the R667A mutant of RNase L, the pLenti6.3/V5-TOPO expression vector and TOPO TA cloning kit (Invitrogen) were used. A lentivirus-based, short hairpin (sh) RNA (shRNA) construct (pLKO-shRNase L) targeting the 3⬘-untranslated region of human RNase L (5⬘-CCTCTCATTT GGGCACCTTAA-3⬘; TRCN0000000923) and the negative control (pLKO-shLuc) targeting firefly luciferase were obtained from the National RNAi Core Facility (Taiwan). For lentivirus preparation, human embryonic kidney 293 T cells were cotransfected with a lentivirus expression construct (pSIN or pLenti6.3/V5-TOPO) or pLKO-shRNA and


OAS1 p42


8037

the two helper plasmids, pMD.G and pCMV⌬R8.91, with Lipofectamine 2000 reagent (Invitrogen). Transfected cells were incubated at 37°C for 4 –5 h and then refed with fresh medium. Cell supernatants containing the viral particles were harvested 24 – 60 h after transfection and stored at ⫺80°C. Lentivirus titers were determined with the QuickTiters lentivirus titer kit, an HIV p24-based ELISA (Cell Biolabs).

Establishment of stable cell lines T-REx-293 cells were transfected with pcDNA5/TO encoding HA-tagged wild-type RNase L, a nuclease-dead mutant of RNase L (R667A), OAS p42, or OAS3 p100 and selected with hygromycin (250 ␮g/ml) and blasticidin (5 ␮g/ml) for 8 days. Individual colonies were picked and expanded. To generate human RNase L knockdown cells, the cells were transduced with lentivirus targeting human RNase L for 24 h and selected with puromycin (10 ␮g/ml) for 72 h.

Western immunoblotting Cell lysates were prepared in SDS sample buffer (62.5 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 50 mM DTT, and 0.1% bromophenol blue) containing a cocktail of protease inhibitors (Roche). Similar amounts of proteins were loaded and separated by SDS-PAGE and transferred to a nitrocellulose membrane (Hybond-C Super; Amersham/

GE Healthcare). The nitrocellulose membrane was blocked with 5% skim milk in PBS-T (25 mM Tris, 0.8% NaCl, 2.68 mM KCl (pH 7.4), and 0.1% Tween 20) and subsequently incubated with the primary Ab overnight. The blots were then treated with a HRP-conjugated secondary Ab (Amersham/GE Healthcare) and developed with an ECL system (Amersham/GE Healthcare). For reblotting, the membrane was washed with 1⫻ ReBlot plus strong Ab stripping solution (Chemicon) for 15 min at room temperature. The membrane was then blocked twice with 5% skim milk in PBS-T for 5 min followed by reprobing with the primary Ab.

Immunofluorescent assay A549 cells were transduced with the lentiviral vectors expressing the various HA-tagged OAS proteins for 72 h and then infected with DEN-2 (multiplicity of infection (MOI) ⫽ 20) for 24 h. The cells were fixed with 4% formaldehyde and permeabilized in PBS with 0.5% Triton X-100. DEN protein expression was detected using a mouse anti-DEN-2 NS3 Ab and Alexa Fluor 488 goat anti-mouse Ab (Molecular Probes). The expression of HA-tagged OAS was detected with a rabbit anti-HA Ab, biotin-conjugated secondary anti-rabbit Ab (Jackson ImmunoResearch), and streptavidin-conjugated Cy3 (Jackson ImmunoResearch Laboratories). The nuclei were stained with DAPI (Molecular Probes).


FIGURE 1. The anti-DEN-2 effect of human RNase L. A, A549 cells were transduced with the lentiviral vector expressing the wild-type RNase L or the R667A mutant of RNase L for 72 h, and then cells were infected with DEN-2 (MOI ⫽ 5). Twenty-four hours after infection, cells were fixed and permeabilized for an immunofluorescent assay. HA-tagged RNase L (red)-, dengue viral protein NS3 (green)-, and 4⬘,6-diamidino-2-phenylindole (DAPI; blue)-stained cells were photographed using a fluorescent microscope. Arrows indicate the cells expressing HA-tagged wild-type RNase L or R667A mutant of RNase L. The Greek letter ␣ represents the prefix “anti-.” B, T-REx-293 cells transduced with lentiviruses inducibly expressing control vector (⫺), HA-RNase L, or HA-RNase L R667A mutant were cultured in the absence (⫺) or presence (⫹) of Dox (1 ␮g/ml) for 16 h and then infected with DEN-2 (MOI ⫽ 0.1). At 48 h post infection, the cell lysates were harvested for western blotting with Abs against DEN-2 NS3, HA-tagged RNase L, and actin as indicated. C, A549 cells were transduced with the lentiviral-based shRNA vector targeting RNase L (shRNase L) or negative control luciferase (shLuc). To verify the knockdown effect, cell lysates were harvested for Western blotting with an anti-RNase L Ab. D, Cells with or without RNase L knockdown were infected with DEN-2 (MOI ⫽ 0.1 for 72 h and MOI ⫽ 5 for 48 h) and then the virus titers (PFU/ml) were determined by plaque-forming assays on BHK-21 cells. Results are averages and SD of two independent experiments. The viral titers of indicated groups were compared by two-tailed Student’s t tests.

8038

ANTI-DENGUE ACTIVITY OF OAS1 p42/p46 AND OAS3 aldehyde for 30 min followed by permeabilization with 0.5% Triton X-100 for 10 min. Subsequently, human OAS proteins were stained with a rabbit monoclonal anti-HA Ab and probed with a biotin-conjugated secondary anti-rabbit Ab and streptavidin-conjugated Cy3. Viral dsRNA was detected using a mouse anti-dsRNA Ab and Alexa Fluor 488 goat anti-mouse Ab. Images were taken with an LSM 510 META confocal system (Carl Zeiss) using a PlanApochromat ⫻100 oil-immersion objective lens.

Assay of RNase L activity A549 cells transduced with the indicated lentivirus (MOI ⫽ 2) for 72 h were infected with DEN-2 (MOI ⫽ 5) for 24 h. Total cellular RNA was extracted by using an RNeasy total RNA kit (Qiagen) and quantified by measuring UV absorbance at 260 nm. Cellular RNA (250 ng) was separated with an RNA 6000 Nano Chip and analyzed with a 2100 Bioanalyzer (Agilent Technologies) to determine the integrity of 28S and 18S rRNA. FIGURE 2. Protein expression patterns of human OAS isoforms. 293 cells were transfected with pcDNA3 plasmids encoding various N-terminally HA-tagged OAS1 (p42, p44, p46, p48, and p52), OAS2 (p69 and p71), OAS3 (p100), and OASL (p59 and p30) proteins for 24 h, and cell lysates were then harvested for Western blotting with an anti-HA Ab.

A549 cells were seeded on coverslips in 12-well plates for 16 h and were then transduced with a lentiviral vector expressing the indicated HA-tagged OAS. Seventy-two hours after transduction, cells were infected with DEN-2 (MOI ⫽ 20) for 6 h. The cells were rinsed twice with PBS and fixed with 4% form-

RNase L plays an antiviral role against DEN-2 infection in human cells To assess the role of the human OAS/RNase L system in DEN-2 replication, we used a lentivirus expression system to overexpress RNase L in human A549 cells. Overexpression of wild-type RNase L, but not of a nuclease-dead mutant of RNase L (R667A) (29), rendered the cells resistant to DEN-2 infection (Fig. 1A). Similarly, by an inducible system in human embryonic kidney T-REx-293 cells, overexpression of wild-type RNase L, but not of a control vector or a nuclease-dead mutant of RNase L (R667A), reduced

FIGURE 3. Antiviral assays of human OAS family members against DEN-2 infection. A549 cells were transduced with lentiviral vectors expressing the HA-tagged OAS1 isoforms (p42, p44, p46, p48, and p52) (A–E), OAS2 isoforms (p69 and p71) (F and G), OAS3 (p100) (H), and OASL isoforms (OASL p59 and OASL p30) (I and J). Seventy-two hours after transduction, cells were infected with DEN-2 (MOI ⫽ 20) for 24 h. Cells were then fixed and permeabilized for an immunofluorescent assay. HA-tagged OAS (red)-, dengue viral protein NS3 (green)-, and 4⬘,6-diamidino-2-phenylindole (DAPI; blue)-stained cells were photographed by using a fluorescent microscope. The Greek letter ␣ represents the prefix “anti-.”


Confocal imaging

Results


8039

DEN-2 NS3 protein expression as measured by Western blotting (Fig. 1B). Furthermore, A549 cells deprived of RNase L expression by transduction with a lentivirus-based shRNA targeting human RNase L (shRNase L) (Fig. 1C) resulted in higher levels of DEN-2 production as seen by 14- and 39-fold increases in viral production for low and high MOI of infection, respectively (Fig. 1D). These results demonstrate that RNase L is involved in controlling DEN-2 replication in human cells. Anti-DEN-2 activity of human OAS family members To identify the antiviral potential of human OAS gene family members, we cloned and constructed plasmids that individually expressed the N-terminally HA-tagged OAS1 isoforms (p42, p44, p46, p48, and p52), OAS2 isoforms (p69 and p71), OAS3 (p100), and OASL isoforms (p30 and p59) (Table I). These constructs expressed the proteins of the expected molecular sizes as detected by Western blotting with anti-HA Ab (Fig. 2). A549 cells transduced with lentiviruses expressing the individual OAS proteins were then infected with DEN-2, and immunofluorescent assays were conducted to determine the antiviral potential of each human OAS family member. The DEN-2 viral protein NS3 was not detected in cells expressing human OAS1 p42 (Fig. 3A), OAS1 p46 (Fig. 3C), or OAS3 p100 (Fig. 3H), whereas DEN-2 NS3 was readily detected in cells expressing the other members of human OAS and OASL isoforms. These data indicate that OAS1 p42, OAS1 p46, and OAS3 p100 possess antiviral activity against DEN-2 infection. We then used an inducible system to overexpress OAS1 p42 and OAS3 p100 in T-REx-293, a human embryonic kidney 293 cell line stably expressing the tetracycline repressor pro-

tein, with or without RNase L knockdown to assess whether the antiviral mechanism was mediated by RNase L. The levels of OAS1 p42 and OAS3 p100 induction by Dox and RNase L knockdown were verified by Western blotting (Fig. 4, A and C). The cells were then infected with DEN-2 at high and low MOIs (MOI ⫽ 5 and 0.1), and viral titrations were conducted by plaque assays. Like the results for A549 cells (Fig. 1C), higher viral production was noted in T-REx-293 cells with RNase L knockdown compared with the parental T-REx293 cells at high or low MOIs of DEN-2 infection and regardless of Dox treatment (Fig. 4, B and D). Furthermore, the induction of human OAS1 p42 resulted in 4.3- and 14-fold decreases in viral yield at high and low MOIs, respectively (Fig. 4B). Similarly, 7- and 11-fold viral reductions were noted in cells inducibly expressing OAS3 p100 at high and low MOIs of DEN-2 infection, respectively (Fig. 4D). Furthermore, the anti-DEN-2 activity of p42 and p100 depended on RNase L, because the antiviral effect was lost in cells deprived of RNase L expression (Fig. 4, B and D). Western blot detection of viral NS3, a nonstructural protein expressed in virus-replicating cells (Fig. 4, A and C), corroborated the results of infectious viral titration (Fig. 4, B and D). Thus, our results indicate that human OAS1 p42/p46 and OAS3 p100 block DEN-2 replication through an RNase L-mediated mechanism. Subcellular localization of OAS and viral RNA in DEN-2-infected cells As different OAS isoforms have been reported to be associated with different subcellular fractions (30 –32), we tested whether the different anti-DEN-2 activities triggered by these OAS members (Fig. 3) could be attributed to the colocalization of OAS proteins


FIGURE 4. Overexpression of human OAS1 p42 and OAS3 p100 by an inducible system exhibited an RNase L-dependent anti-DEN-2 effect. Parental T-REx-293 cells and those transduced with lentiviruses inducibly expressing OAS1 p42 (A and B) or OAS3 p100 (C and D) with or without RNase L knockdown were cultured in the absence (⫺) or presence (⫹) of Dox (1 ␮g/ml) for 16 h. The cells were then infected with DEN-2 (MOI ⫽ 5) for 24 h before cell lysates were harvested for Western blotting with the indicated Abs (A and C). The culture supernatants of DEN-2 infection (MOI ⫽ 5 for 24 h and MOI ⫽ 0.1 for 48 h) were collected and virus titers were determined by plaque-forming assays on BHK-21 cells (B and D). Results are averages and SD of two independent experiments. The titers of the indicated groups were compared by two-tailed Student’s t tests.

8040


with viral RNA. A549 cells transduced with the indicated HAtagged human OAS lentiviral expression vectors were infected with DEN-2 for 6 h, at which time point viral RNA was readily detected by an anti-dsRNA Ab (Fig. 5A). The cellular distributions of OAS proteins and viral RNA detected by anti-HA and antidsRNA Abs were observed under a confocal microscope. The OAS proteins were mainly localized in the cytoplasm (Fig. 5B), as previously reported (18, 33), and perinuclear localization was also noted for OAS2 p71 (Fig. 5Bg). All of the OAS members colocalized with dsRNA except for OAS2 p69, for which the merged yellow signals were less prominent (Fig. 5Bf). Thus, the discrepancy between anti-DEN-2 activities for the various OAS members cannot simply be explained by different cellular compartmentalization of the OAS family members and viral dsRNA. RNase L activity in DEN-2-infected cells overexpressing human OAS isoforms It is known that 2-5A synthesized by activated OAS binds to and activates RNase L, which then degrades viral and cellular RNA. We next determined RNase L activity triggered by the various OAS members by detecting the characteristic rRNA cleavage us-

ing RNA chips, as previously described (12). A549 cells transduced with lentiviruses expressing the indicated human OAS proteins were infected with DEN-2 for 24 h, and cellular RNA was separated on RNA chips. Cleavage products of 28S and 18S rRNAs were apparent in cells expressing human OAS1 p42/p46 and OAS3 p100 (Fig. 6, lanes 6, 10, and 20). To a lesser extent, rRNA cleavage products were also detected in cells expressing OAS1 p44/p48 and OAS2 p69 (Fig. 6, lanes 8, 12, and 16). The RNA integrity number (RIN), developed to estimate RNA integrity (34), was also determined using the Agilent 2100 Expert software (Agilent Technologies). Interestingly, three of the OAS isoforms with anti-DEN-2 activity, OAS1 p42/p46 and OAS3 p100, had the lowest RIN values among the tested samples, 9.2, 9.3, and 8.6, respectively (Fig. 6). Therefore, these results indicate that human OAS1 p42/p46 and OAS3 p100 trigger higher RNase L activity in DEN-2-infected cells, resulting in stronger antiviral activity. The OAS3-mediated rRNA cleavage depends on RNase L Because OAS3 preferentially synthesizes 2-5A dimers, which have a lower binding affinity and do not activate RNase L (18, 32, 35, 36), we further assessed whether RNase L is indeed involved in the


FIGURE 5. The subcellular localization of OAS isoforms and viral RNA. A, A549 cells were mock infected or infected with DEN-2 (MOI ⫽ 20) for 2, 4, and 6 h as indicated above each image. Viral RNA was stained with an anti-dsRNA Ab (green), and the nuclei were stained with DAPI (blue). B, A549 cells transduced with HA-tagged OAS1 (p42, p44, p46, p48, and p52) (a– e), OAS2 (p69 and p71) (f and g), and OAS3 (p100) (h) were infected with DEN-2 (MOI ⫽ 20) for 6 h. Cells were fixed and permeabilized for confocal microscopy. Viral RNA was detected using a mouse anti-dsRNA Ab and Alexa Fluor 488 goat anti-mouse Ab (green). Human OAS proteins were detected with a rabbit anti-HA Ab, a biotin-conjugated secondary anti-rabbit Ab, and streptavidin-conjugated Cy3 (red). Nuclei were stained by 4⬘,6-diamidino-2-phenylindole (DAPI; blue). The Greek letter ␣ represents the prefix “anti-.”


8041

FIGURE 6. RNase L activity determined by 28S and 18S rRNA cleavage in DEN-2-infected A549 cells overexpressing human OAS isoforms. A549 cells transduced with lentiviral vectors (MOI ⫽ 2) expressing the indicated HA-tagged OAS isoforms or enhanced GFP (eGFP) control for 72 h were mock infected or infected with DEN-2 (MOI ⫽ 5) for 24 h. The cellular RNA extracts were separated on RNA 6000 Nano Chips and the bands of 28S and 18S rRNA and their cleavage products were analyzed with an Agilent Bioanalyzer 2100. The RIN was determined by Agilent 2100 Expert software.

Discussion DEN causes human diseases ranging from mild acute DF to severe DHF and DSS. The severity and outcome of DEN infection is determined by complex factors such as amplitude of DEN replication, expression of cytokines, activation and proliferation of immune cells, host genetic factors, etc (23, 37). Patients with DHF/ DSS tend to have higher viremia titers than patients with DF; hence, DEN levels appear to correlate with the severity of DEN diseases (38, 39). Thus, virus clearance in the early stages of in-

fection may play an important role in diminishing the progression of severe DEN-related diseases. In mice, the Oas1b gene has been identified as a flavivirus resistance gene (6 –10); however, the role of human OAS family members in flavivirus infection has not yet been clarified. In this study, we found that three of the 10 human OAS family members, OAS1 p42/p46 and OAS3 p100, mediate a potent anti-DEN-2 activity through an RNase L-dependent mechanism and may contribute to host defense against DEN infection. It is well known that the OAS/RNase L system, an IFN-induced antiviral pathway, plays a critical role in innate immunity, controlling the outcome of virus production. RNase L may mediate antiviral actions by cleavage of viral RNA, by eliminating virusinfected cells through apoptosis, and by enhancing IFN-␤ production through the MDA5/RIG-I/IPS-1 cascade (40 – 42). The role of RNase L in controlling WNV replication has been demonstrated, with higher WNV production occurring in cells deprived of RNase L activity by using a dominant negative mutant or genetic knockdown (11, 12). The role of RNase L in DEN infection is more obscure, and the antiviral effect of IFN in murine embryonic

FIGURE 7. Human OAS3 triggered RNase L-dependent rRNA cleavage in DEN-2-infected A549 cells. A, Protein expression of A549 cells transduced with lentivirus expressing enhanced GFP (eGFP) control, OAS3, or OAS3 plus shRNase L for 72 h was verified by Western blotting with the indicated Abs. B, The indicated cells were mock infected or infected with DEN-2 (MOI ⫽ 5) for 12 and 24 h. Total cellular RNA was extracted and separated on RNA 6000 Nano Chips for analysis of 28S and 18S rRNA cleavage by an Agilent Bioanalyzer 2100.


rRNA cleavage triggered by OAS3 p100. We overexpressed OAS3 p100 in A549 cells with or without RNase L knockdown (Fig. 7A) and tested for rRNA cleavage patterns in these cells after DEN-2 infection. As shown in Fig. 7B, the rRNA cleavage induced by DEN-2 infection in these OAS3-expressing cells (lanes 7 and 11) was no longer seen in cells devoid of RNase L expression (lanes 8 and 12). Thus, our results indicate that OAS3 p100 activates RNase L and mediates an antiviral effect in DEN-2-infected human cells.

8042

would be interesting to determine whether these three OAS isoforms also contribute to host defense against other flaviviruses and whether they are candidate human genetic factors for determining human susceptibility to and severity of DEN-related diseases.

Acknowledgments We thank the National RNAi Core Facility, Taiwan (supported by the National Research Program for Genomic Medicine Grants of National Science Council) for shRNA constructs.

Disclosures The authors have no financial conflict of interest.

References 1. Gubler, D. J. 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, social and economic problem in the 21st century. Trends Microbiol. 10: 100 –103. 2. Hovanessian, A. G. 2007. On the discovery of interferon-inducible, doublestranded RNA activated enzymes: the 2⬘-5⬘oligoadenylate synthetases and the protein kinase PKR. Cytokine Growth Factor Rev. 18: 351–361. 3. Samuel, C. E. 2001. Antiviral actions of interferons. Clin. Microbiol. Rev. 14: 778 – 809. 4. Floyd-Smith, G., E. Slattery, and P. Lengyel. 1981. Interferon action: RNA cleavage pattern of a (2⬘-5⬘)oligoadenylate– dependent endonuclease. Science 212: 1030 –1032. 5. Wreschner, D. H., J. W. McCauley, J. J. Skehel, and I. M. Kerr. 1981. Interferon action–sequence specificity of the ppp(A2⬘p)nA-dependent ribonuclease. Nature 289: 414 – 417. 6. Mashimo, T., M. Lucas, D. Simon-Chazottes, M. P. Frenkiel, X. Montagutelli, P. E. Ceccaldi, V. Deubel, J. L. Guenet, and P. Despres. 2002. A nonsense mutation in the gene encoding 2⬘-5⬘-oligoadenylate synthetase/L1 isoform is associated with West Nile virus susceptibility in laboratory mice. Proc. Natl. Acad. Sci. USA 99: 11311–11316. 7. Perelygin, A. A., S. V. Scherbik, I. B. Zhulin, B. M. Stockman, Y. Li, and M. A. Brinton. 2002. Positional cloning of the murine flavivirus resistance gene. Proc. Natl. Acad. Sci. USA 99: 9322–9327. 8. Scherbik, S. V., K. Kluetzman, A. A. Perelygin, and M. A. Brinton. 2007. Knock-in of the Oas1b(r) allele into a flavivirus-induced disease susceptible mouse generates the resistant phenotype. Virology 368: 232–237. 9. Lucas, M., T. Mashimo, M. P. Frenkiel, D. Simon-Chazottes, X. Montagutelli, P. E. Ceccaldi, J. L. Guenet, and P. Despres. 2003. Infection of mouse neurones by West Nile virus is modulated by the interferon-inducible 2⬘-5⬘ oligoadenylate synthetase 1b protein. Immunol. Cell Biol. 81: 230 –236. 10. Kajaste-Rudnitski, A., T. Mashimo, M. P. Frenkiel, J. L. Guenet, M. Lucas, and P. Despres. 2006. The 2⬘,5⬘-oligoadenylate synthetase 1b is a potent inhibitor of West Nile virus replication inside infected cells. J. Biol. Chem. 281: 4624 – 4637. 11. Samuel, M. A., K. Whitby, B. C. Keller, A. Marri, W. Barchet, B. R. Williams, R. H. Silverman, M. Gale, Jr., and M. S. Diamond. 2006. PKR and RNase L contribute to protection against lethal West Nile Virus infection by controlling early viral spread in the periphery and replication in neurons. J. Virol. 80: 7009 –7019. 12. Scherbik, S. V., J. M. Paranjape, B. M. Stockman, R. H. Silverman, and M. A. Brinton. 2006. RNase L plays a role in the antiviral response to West Nile virus. J. Virol. 80: 2987–2999. 13. Bonnevie-Nielsen, V., L. L. Field, S. Lu, D. J. Zheng, M. Li, P. M. Martensen, T. B. Nielsen, H. Beck-Nielsen, Y. L. Lau, and F. Pociot. 2005. Variation in antiviral 2⬘,5⬘-oligoadenylate synthetase (2⬘5⬘AS) enzyme activity is controlled by a single-nucleotide polymorphism at a splice-acceptor site in the OAS1 gene. Am. J. Hum. Genet. 76: 623– 633. 14. Mashimo, T., P. Glaser, M. Lucas, D. Simon-Chazottes, P. E. Ceccaldi, X. Montagutelli, P. Despres, and J. L. Guenet. 2003. Structural and functional genomics and evolutionary relationships in the cluster of genes encoding murine 2⬘,5⬘-oligoadenylate synthetases. Genomics 82: 537–552. 15. Hartmann, R., H. S. Olsen, S. Widder, R. Jorgensen, and J. Justesen. 1998. p59OASL, a 2⬘-5⬘ oligoadenylate synthetase like protein: a novel human gene related to the 2⬘-5⬘ oligoadenylate synthetase family. Nucleic Acids Res. 26: 4121– 4128. 16. Rebouillat, D., I. Marie, and A. G. Hovanessian. 1998. Molecular cloning and characterization of two related and interferon-induced 56-kDa and 30-kDa proteins highly similar to 2⬘-5⬘ oligoadenylate synthetase. Eur J. Biochem. 257: 319 –330. 17. Hovnanian, A., D. Rebouillat, E. R. Levy, M. G. Mattei, and A. G. Hovanessian. 1999. The human 2⬘,5⬘-oligoadenylate synthetase-like gene (OASL) encoding the interferon-induced 56-kDa protein maps to chromosome 12q24.2 in the proximity of the 2⬘,5⬘-OAS locus. Genomics 56: 362–363. 18. Rebouillat, D., A. Hovnanian, I. Marie, and A. G. Hovanessian. 1999. The 100kDa 2⬘,5⬘-oligoadenylate synthetase catalyzing preferentially the synthesis of dimeric pppA2⬘p5⬘A molecules is composed of three homologous domains. J. Biol. Chem. 274: 1557–1565. 19. Andersen, J. B., D. J. Strandbygard, R. Hartmann, and J. Justesen. 2004. Interaction between the 2⬘-5⬘ oligoadenylate synthetase-like protein p59 OASL and the transcriptional repressor methyl CpG-binding protein 1. Eur J. Biochem. 271: 628 – 636.


fibroblasts is thought to be independent of RNase L (43). As DEN-2 replication was reduced by RNase L overexpression (Fig. 1, A and B) and enhanced by RNase L knockdown in human A549 and T-REx-293 cells (Fig. 1, D and Fig. 4), we provide evidence showing that RNase L plays a protective role in host defense against DEN-2 infection in human cells. The three forms of OAS are characterized by different subcellular locations and enzyme parameters (44, 45). OAS1 and OAS2 synthesize higher oligomers of 2-5A, whereas OAS3 tends to synthesize 2-5A dimers, which do not activate RNase L (18, 32, 35, 36). The notion that OAS3 may not act through RNase L is supported by a recent report that human OAS3 exhibits antiviral activity against alphaviruses, such as the Chikungunya virus, the Sindbis virus, and the Semliki Forest virus, through an RNase L-independent pathway (46). Our results demonstrate that OAS3 is able to trigger RNase L activation characterized by rRNA cleavage (Figs. 6 and 7) and that RNase L is required for the anti-DEN-2 activity of OAS3 (Fig. 4). Although OAS3 preferentially synthesizes 2-5A dimeric molecules, a small proportion of its products are 2-5A oligomers (18, 32). Moreover, the requirement of dsRNA concentration for optimal OAS3 activation is ⬃100 times lower than that for human OAS1 and OAS2 (30, 45), suggesting that OAS3 might be more sensitive in sensing virus RNA. Thus, we speculate that human OAS3 is activated in the early stages of DEN-2 infection by low concentrations of viral RNA to synthesize 2-5A, including the majority of 2-5A dimeric molecules and a minority of higher oligomers of 2-5A, which then activate latent RNase L to control DEN-2 replication. A recent clinical study showing that patients with DSS have lower levels of OAS3 expression (23) supports our notion that human OAS3 might control DEN replication and influence the severity and outcome of DEN diseases. The human OAS1 gene contains eight exons and through alternative splicing it gives rise to five isoforms, all of which include exons 1–5 but differ in their C-terminal sequences (13, 14). It is known that a “G” sequence at the exon 6 splice-acceptor site allows splicing to generate OAS1 p46; whereas an “A” sequence at this position drives splicing to occur further downstream to generate p48 and p52. Furthermore, the “A” allele has a higher gene frequency in individuals with low basal OAS activity than in individuals with high OAS activity (13). Interestingly, this “A” allele has recently been identified as a risk factor for initial infection with WNV (20). Our results showing that OAS1 p46 but not OAS1 p48/p52 exhibited anti-DEN-2 activity (Fig. 3) suggest that this “A” allele might also be a risk factor for DEN and warrants future study to verify its role in determining the outcome of DEN infection. Because WNV replicated to higher levels in lymphoid tissues from donors with the “A” allele, it is likely that WNV is also more sensitive to the antiviral action of p46 and not to that of p48/p52. This OAS1 isoform-specific antiviral activity might explain why an individual with the “A” allele, who does not generate p46, is more susceptible to WNV seroconversion (20). In addition to OAS1 p46, OAS1 p42 is another potent anti-DEN molecule that we identified (Figs. 3 and 4), and its contribution to host defense against DEN-2 infection deserves further study. It would also be interesting to study why these OAS1 isoforms possess such different antiviral activities, because they all contain an OAS domain and only differ in their C termini. Overall, we demonstrate the importance of the 2⬘-5⬘ OAS/ RNase L system in controlling DEN replication in human cells and provide insights into the antiviral capacity of various members of the OAS family against DEN replication. The antiviral effects of human OAS1 p42, OAS1 p46, and OAS3 p100 correlate with their abilities to trigger RNase L activation in DEN-2-infected cells. It



34. Schroeder, A., O. Mueller, S. Stocker, R. Salowsky, M. Leiber, M. Gassmann, S. Lightfoot, W. Menzel, M. Granzow, and T. Ragg. 2006. The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol. Biol. 7: 3. 35. Dong, B., and R. H. Silverman. 1995. 2-5A-dependent RNase molecules dimerize during activation by 2-5A. J. Biol. Chem. 270: 4133– 4137. 36. Dong, B., L. Xu, A. Zhou, B. A. Hassel, X. Lee, P. F. Torrence, and R. H. Silverman. 1994. Intrinsic molecular activities of the interferon-induced 2-5A-dependent RNase. J. Biol. Chem. 269: 14153–14158. 37. Coffey, L. L., E. Mertens, A. C. Brehin, M. D. Fernandez-Garcia, A. Amara, P. Despres, and A. Sakuntabhai. 2009. Human genetic determinants of dengue virus susceptibility. Microbes Infect. 11: 143–156. 38. Libraty, D. H., T. P. Endy, H. S. Houng, S. Green, S. Kalayanarooj, S. Suntayakorn, W. Chansiriwongs, D. W. Vaughn, A. Nisalak, F. A. Ennis, and A. L. Rothman. 2002. Differing influences of virus burden and immune activation on disease severity in secondary dengue-3 virus infections. J. Infect. Dis. 185: 1213–1221. 39. Vaughn, D. W., S. Green, S. Kalayanarooj, B. L. Innis, S. Nimmannitya, S. Suntayakorn, T. P. Endy, B. Raengsakulrach, A. L. Rothman, F. A. Ennis, and A. Nisalak. 2000. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. J. Infect. Dis. 181: 2–9. 40. Li, X. L., J. A. Blackford, and B. A. Hassel. 1998. RNase L mediates the antiviral effect of interferon through a selective reduction in viral RNA during encephalomyocarditis virus infection. J. Virol. 72: 2752–2759. 41. Li, G., Y. Xiang, K. Sabapathy, and R. H. Silverman. 2004. An apoptotic signaling pathway in the interferon antiviral response mediated by RNase L and c-Jun NH2-terminal kinase. J. Biol. Chem. 279: 1123–1131. 42. Malathi, K., B. Dong, M. Gale, Jr., and R. H. Silverman. 2007. Small self-RNA generated by RNase L amplifies antiviral innate immunity. Nature 448: 816 – 819. 43. Diamond, M. S., and E. Harris. 2001. Interferon inhibits dengue virus infection by preventing translation of viral RNA through a PKR-independent mechanism. Virology 289: 297–311. 44. Hovanessian, A. G., and J. Justesen. 2007. The human 2⬘-5⬘oligoadenylate synthetase family: unique interferon-inducible enzymes catalyzing 2⬘-5⬘ instead of 3⬘-5⬘ phosphodiester bond formation. Biochimie 89: 779 –788. 45. Rebouillat, D., and A. G. Hovanessian. 1999. The human 2⬘,5⬘-oligoadenylate synthetase family: interferon-induced proteins with unique enzymatic properties. J. Interferon Cytokine Res. 19: 295–308. 46. Brehin, A. C., I. Casademont, M. P. Frenkiel, C. Julier, A. Sakuntabhai, and P. Despres. 2009. The large form of human 2⬘,5⬘-oligoadenylate synthetase (OAS3) exerts antiviral effect against Chikungunya virus. Virology 384: 216 –222.


20. Lim, J. K., A. Lisco, D. H. McDermott, L. Huynh, J. M. Ward, B. Johnson, H. Johnson, J. Pape, G. A. Foster, D. Krysztof, et al. 2009. Genetic variation in OAS1 is a risk factor for initial infection with West Nile virus in man. PLoS Pathog. 5: e1000321. 21. Diamond, M. S., T. G. Roberts, D. Edgil, B. Lu, J. Ernst, and E. Harris. 2000. Modulation of dengue virus infection in human cells by ␣, ␤, and ␥ interferons. J. Virol. 74: 4957– 4966. 22. Johnson, A. J., and J. T. Roehrig. 1999. New mouse model for dengue virus vaccine testing. J. Virol. 73: 783–786. 23. Simmons, C. P., S. Popper, C. Dolocek, T. N. Chau, M. Griffiths, N. T. Dung, T. H. Long, D. M. Hoang, N. V. Chau, T. T. Thao le, et al. 2007. Patterns of host genome-wide gene transcript abundance in the peripheral blood of patients with acute dengue hemorrhagic fever. J. Infect. Dis. 195: 1097–1107. 24. Fink, J., F. Gu, L. Ling, T. Tolfvenstam, F. Olfat, K. C. Chin, P. Aw, J. George, V. A. Kuznetsov, M. Schreiber, et al. 2007. Host gene expression profiling of dengue virus infection in cell lines and patients. PLoS Negl. Trop. Dis. 1: e86. 25. Ubol, S., P. Masrinoul, J. Chaijaruwanich, S. Kalayanarooj, T. Charoensirisuthikul, and J. Kasisith. 2008. Differences in global gene expression in peripheral blood mononuclear cells indicate a significant role of the innate responses in progression of dengue fever but not dengue hemorrhagic fever. J. Infect. Dis. 197: 1459 –1467. 26. Lin, Y. L., C. L. Liao, L. K. Chen, C. T. Yeh, C. I. Liu, S. H. Ma, Y. Y. Huang, Y. L. Huang, C. L. Kao, and C. C. King. 1998. Study of Dengue virus infection in SCID mice engrafted with human K562 cells. J. Virol. 72: 9729 –9737. 27. Makarova, O., E. Kamberov, and B. Margolis. 2000. Generation of deletion and point mutations with one primer in a single cloning step. BioTechniques 29: 970 –972. 28. Godfrey, A., J. Anderson, A. Papanastasiou, Y. Takeuchi, and C. Boshoff. 2005. Inhibiting primary effusion lymphoma by lentiviral vectors encoding short hairpin RNA. Blood 105: 2510 –2518. 29. Dong, B., M. Niwa, P. Walter, and R. H. Silverman. 2001. Basis for regulated RNA cleavage by functional analysis of RNase L and Ire1p. RNA 7: 361–373. 30. Chebath, J., P. Benech, A. Hovanessian, J. Galabru, and M. Revel. 1987. Four different forms of interferon-induced 2⬘,5⬘-oligo(A) synthetase identified by immunoblotting in human cells. J. Biol. Chem. 262: 3852–3857. 31. Hovanessian, A. G., J. Svab, I. Marie, N. Robert, S. Chamaret, and A. G. Laurent. 1988. Characterization of 69- and 100-kDa forms of 2-5A-synthetase from interferon-treated human cells. J. Biol. Chem. 263: 4945– 4949. 32. Marie, I., J. Blanco, D. Rebouillat, and A. G. Hovanessian. 1997. 69-kDa and 100-kDa isoforms of interferon-induced (2⬘-5⬘)oligoadenylate synthetase exhibit differential catalytic parameters. Eur J. Biochem. 248: 558 –566. 33. Marie, I., J. Svab, N. Robert, J. Galabru, and A. G. Hovanessian. 1990. Differential expression and distinct structure of 69- and 100-kDa forms of 2-5A synthetase in human cells treated with interferon. J. Biol. Chem. 265: 18601–18607.

8043