Antimicrobial Activity of Bacillus amyloliquefaciens ANT1 Toward ...

Probiotics & Antimicro. Prot. (2013) 5:252–258 DOI 10.1007/s12602-013-9143-1

Antimicrobial Activity of Bacillus amyloliquefaciens ANT1 Toward Pathogenic Bacteria and Mold: Effects on Biofilm Formation Rosa Anna Nastro • Anthony Arguelles-Arias • Marc Ongena • Amelia Di Costanzo • Marco Trifuoggi • Marco Guida • Patrick Fickers

Published online: 3 July 2013 Ó Springer Science+Business Media New York 2013

Abstract The intensive use and misuse of antibiotics over the last decades have generated a strong selective pressure for the emergence of multi-resistant strains and nosocomial infections. Biofilm has been demonstrated as a key parameter in spreading infections, especially in hospitals and healthcare units. Therefore, the development of novel anti-biofilm drugs is actually of the upmost importance. Here, the antimicrobial and antibiofilm activities toward pathogenic microorganisms of a set of non-ribosomal synthesized peptides and polyketides isolated from Bacillus amyloliquefaciens ANT1 culture supernatant are presented. Keywords Bacillus amyloliquefaciens NRPS PKS Antibiofilm activity

Rosa Anna Nastro and Anthony Arguelles-Arias contributed equally to this work. R. A. Nastro Department of Sciences for the Environment, University Parthenope of Naples, Centro Direzionale Isola C4, 80143 Naples, Italy e-mail: [email protected] A. Arguelles-Arias Centre d’Ingenierie des Proteines, Bacterial Physiology and Genetics, Alle´e de la chimie, Universite´ de Lie`ge, Bat. B6, 4000 Lie`ge, Belgium M. Ongena Unite´ de Bio-Industrie, Gembloux Agro-Bio Tech, Universite´ de Lie`ge, Passage des De´porte´s, 5030 Gembloux, Belgium A. Di Costanzo Department of Biology, University Federico II of Naples, Complesso Universitario di Monte Sant’Angelo, Via Cinthia 5, 80126 Naples, Italy

123

Introduction With the discovery of multidrug-resistant microorganisms, surveillance programs have been developed at different levels to control the spread of pathogens within hospitals and, at the same time, to collect useful data to develop innovative thwarting strategies to prevent healthcare diseases [21]. However, occurrence of infections in hospital care units increases continuously and represents for the future difficult challenges in treating infection with the conventional drug arsenal [34]. These healthcare-associated diseases are mostly caused by the contamination of hospital devices, surfaces, air and water by pathogenic bacteria [17, 36]. The intensive use and misuse of antibiotics over the last decades have generated a strong selective pressure for the emergence of multi-resistant strains, exemplified by methicillin-resistant Staphylococcus aureus (MRSA) that is insensitive to beta-lactam antibiotics, including penicillins and cephalosporins, or vancomycinM. Trifuoggi Department of Chemical Sciences, University Federico II of Naples, Complesso Universitario di Monte Sant’Angelo, Ed.4, Via Cinthia 5, 80126 Naples, Italy M. Guida (&) Department of Biology, University Federico II of Naples, Complesso Universitario di Monte Sant’Angelo, Ed.7, Via Cinthia 5, 80126 Naples, Italy e-mail: [email protected] P. Fickers (&) Unite´ de Biotechnologies et Bioproce´de´s, Universite´ Libre de Bruxelles, Av F.-D. Roosevelt, 50, CP165/61, 1050 Brussels, Belgium e-mail: [email protected]

Probiotics & Antimicro. Prot. (2013) 5:252–258

resistant enterococci (VRE). Moreover, recent studies shed light on the role of microbial biofilms in dispersal and persistence of microorganisms in the environment, notably in hospitals, surgery rooms and intensive healthcare units [16, 42]. Biofilms consist of densely packed microbial cells embedded in a self-synthesized extracellular polymeric matrix, composed mainly of polysaccharides, that is attached to a surface including biological tissues [30, 37]. It is the predominant lifestyle of microorganisms in most natural, industrial and clinical environments. Biofilms are associated with a high tolerance to exogenous stresses. Moreover, treatments with conventional antibiotics are often ineffective in their ability to eradicate microorganisms residing within the biofilm [15, 30]. The ineffectiveness of currently available antibiotics toward pathogen-associated biofilms points to the need for antimicrobials with alternative modes of action [27]. The recent advances in genome sequencing have highlighted the genus Bacillus as a potential source of antibiotic-like compounds. In particular, for species such as Bacillus amyloliquefaciens, more than 8 % of the genome has been found potentially devoted to the synthesis of polyketides (PKs), non-ribosomal peptides (NRPs), bacteriocins and other unusual antibiotics [6, 8, 11]. NRPs and PKs are synthesized by multimodular enzymatic complexes by elongation of activated monomers of amino and hydroxyl acid building blocks, respectively [22, 38]. Difficidins, macrolactones, bacillaenes surfactins, fengycins and iturins represent some important products of NRPSs and PKSs complexes [6]. Their mechanisms of action are related with the inhibition of peptide synthesis or the disruption of the membrane integrity [11]. The efficacy of some NRPs and PKs against pathogenic fungi, multi-resistant Staphylococci and including MRSA was ascertained [1]. Thus, NRPs and PKs could be regarded as an interesting alternative to conventional antibiotics to combat multidrug-resistant bacteria. However, there remains a gap in our knowledge pertaining to their antimicrobial activity, especially with regards to their interference with biofilm formation. The work presented herein focused on the evaluation of the antimicrobial activity of metabolites from B. amyloliquefaciens ANT1, a surgical room isolate, against pathogenic microorganisms, with special emphasize on their antibiofilm activity. This first characterization of strain ANT1 highlights a possible novel practical application of NRPs and PKs in the prevention of microbial contamination of the hospital environments.

Materials and Methods Strains and Media Strain ANT1 was isolated from a surgical room at the St. Mary of Lourdes Clinic (Naples district, Italy) using

253

surface contact plates (RODAC plate, Oxoid, Rodano, Italy) filled with plate count agar medium (PCA, see below). The different strains used for antimicrobial susceptibility and biofilm inhibition tests were Bacillus cereus ATCC 17778, Pseudomonas aeruginosa ATCC 15442, Aeromonas hydrophila ATCC 7966 and Aspergillus niger ATCC 9642. The different culture medium were as follows: tryptone soy broth (TSB), plate count agar (PCA), Aeromonas selective medium base (ASMB), mannitol egg yolk polymyxin agar (MEYPA), Pseudomonas agar base (PAB), Sabouraud dextrose agar (SDA). All culture media were purchased from Oxoid. Landy medium was as described elsewhere [18]. Phosphate buffered solution (PBS, pH 7.3) contained NaCl 8 g/l, KCl 0.2 g/l, Na2HPO4 1.15 g/l and KH2PO4 0.2 g/l. Strain Identification Strain ANT1 was identified by recA and recN sequence analysis [43]. Extraction and amplification of genomic DNA were performed as described elsewhere [12]. RecA and recN were amplified from genomic DNA using primer pair recAf/recAr (TGAGTGATCGTCAGGCAGCCT/ TTCTTCATAAGAATACCACGAACCGC) and recNf/ recNr (CTTTTGCGATCAGAAGGTGCGTATCCG/GCC ATTATAGAGGAACTGACGATTTC [2], respectively, and sequenced at the GIGA Genomics Facility (University of Lie`ge, Lie`ge, Belgium). Sequences were processed with Vector NTI software (Invitrogen), and similarity search was performed using BLAST algorithm against the GenBank database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Antimicrobial Susceptibility on Solid Media Antimicrobial activity was estimated by a modified agar diffusion assay [13]. Briefly, PCA plates were homogeneously surface inoculated with 100 ll (0.5 McFarland unit) from cell suspensions of the different test pathogens. A 24 h ANT1 colony was then transferred to the center of each plate using a 1-ll microstreaker. Antimicrobial activities were estimated by measuring the diameter (in mm) of the growth inhibition zone after 48 h of incubation at 30 °C. Culture Growth in Microtiter Plates Liquid cultures were performed in microtiter plates (flat bottom, 96 wells, Becton–Dickinson) in TSB medium unless stated otherwise. Plate inoculations were performed from standardized cell suspensions obtained by diluting a 16 h culture equivalent to one McFarland unit. For coculture experiments, 230 ll of culture medium was inoculated with 20 ll of both ANT1 and the sensitive cell

123

254

suspensions. For monocultures, 250 ll of culture medium was inoculated with 20 ll of sensitive cell suspensions. Microtiter plates were incubated for 48 h at 30 °C [26]. Biofilm Quantification Biofilm quantification was performed by staining cells with crystal violet as described elsewhere [5]. Briefly, after discarding the culture broth, attached cells were rinsed three times with PBS before being fixed with 250 ll of ethanol 96 % for 15 min. After ethanol removal and plate drying, 250 ll of crystal violet solution (2 %, w/v) was added to each well. Crystal violet was removed after a 20-min staining period, and the wells were rinsed three times with distilled water and dried. The residual crystal violet was dissolved in 250 ll of a 33 % acetic acid solution [23], and the absorbance of this solution was measured at 570 nm using a microplate reader (ELX 800, Biotek). Biomass Quantification For cell quantification, viable cell counts were performed on selective solid media as follows: ASMB for A. hydrophyla, PAB for P. aeruginosa, MEYPA for B. cereus and SDA for A. niger. For planktonic bacteria, 100 ll of culture broth from a 48 h culture was plated on selective medium after adequate dilutions. For viable cell enumeration in the biofilm, culture broth was first eliminated and the biofilm was rinsed twice with PBS. Attached cells were then recovered by swabbing with a sterile cotton-tipped swab (VWR-PBI International) rinsed with 2 ml of PBS and released from the biofilm by vigorous vortex mixing for 5 min at full speed as described elsewhere [20, 41]. The resulting cell suspension was then plated on adequate selective medium after appropriate dilutions. Cell counts were performed after 48 h of incubation at 37 °C for bacteria and 25 °C for A. niger. Results were expressed in CFU/ml for the planktonic phase and in CFU/cm2 for the biofilm. A reduction of 1,000-fold (log reduction magnitude of 3) or more in viable cell counts was considered as a significant antimicrobial effect [9]. In order to assess the effective correlation between plate counts and crystal violet staining, a Pearson correlation coefficient was calculated for both mono- and co-cultures using standard methods. Effect of ANT1 Supernatant Against A. hydrophila In order to assess the biological activity of ANT1 metabolites released into cell cultures, an A. hydrophila biofilm was grown in microtiter plates for 24 h at 30 °C. Biofilms were washed three times with PBS, and then, 250 ll of filter sterilized (Millipore Durapore, 0.22 lm pore size)

123


supernatant from a 72 h ANT1 culture was introduced into the wells. As a negative control, 250 ll of fresh TSB was used in place of the supernatant. Biomass quantifications were determined as previously described for both planktonic and biofilm cells after 4 and 24 h. Identification of the Biologically Active Compounds For production of the biologically active compounds, strain ANT1 was grown in Landy medium at 37 °C for 72 h. Metabolites were extracted from the culture supernatant by solid phase extraction using Chromafix C18ec cartridge (Macherey–Nagel, Duren, Germany). After binding and subsequent washing steps with Milli-Q water (5 bed volume), metabolites were eluted with methanol (2 bed volume), dried under vacuum and resuspended in 100 ll of methanol. The resulting samples were analyzed by reversephase high-pressure liquid chromatography (Waters Alliance 2695/diode array detector) coupled with single quad mass spectrometer (Waters SQD mass analyzer) on an X-Terra MS 150 9 2.1 mm, 3.5 lm column (Waters). Lipopeptides were eluted as described by Toure and collaborators [39], whereas polyketides were eluted as described elsewhere [2]. The identity of each metabolite was obtained on the basis of the mass of molecular ions detected in the SQD by setting electrospray ionization (both positive and negative mode) conditions in the MS as source temperature, 150 °C; desolvation temperature, 325 °C; nitrogen flow, 550 l/min; and cone voltage 80 V.

Results Strain Identification ANT1 strain identification was performed by recA and recN sequence analysis as previously described [2]. BLAST analysis showed that recN and recA sequences from strain ANT1 had 99 and 100 % identity, respectively, with the sequence of B. amyloliquefaciens DSM7, while scores of 88 and 99 % were obtained for Bacillus subtilis (data not shown). Therefore, these results suggest that strain ANT1 belongs to the B. amyloliquefaciens species. Antimicrobial Susceptibility Test Agar diffusion tests for antimicrobial susceptibility clearly demonstrated that B. amyloliquefaciens ANT1 was able to inhibit the growth of both the Gram-negative and Grampositive bacterial strains, as well as the pathogenic fungus used in this study. As shown in Table 1, A. niger and A. hydrophila were found to be the most sensitive microorganisms tested. Although P. aeruginosa and B. cereus


255 12

Strain

Zone of inhibition (diameter in mm)

10

B. cereus ATCC 17778

13

P. aeruginosa ATCC 15442

11

A. hydrophila ATCC 7966

23

A. niger ATCC9642

38

Log CFU / cm 2

Table 1 Activity spectrum of B. amyloliquefaciens ANT1

8 6 4 2

ATCC American type culture collection (http://www.lgcstandardsatcc.org/)

also displayed sensitivity to B. amyloliquefaciens ANT1, it was to a lesser extent.

0 P. aeruginosa

A. hydrophila

A. niger

B. cereus

Fig. 2 Densities (CFU per cm2) of viable cells contained in biofilms of selected pathogen test strains during mono-culture (black bars) or co-culture (gray bars) with B. amyloliquefaciens ANT1. Data represent means of three independent experiments

Biofilm Quantification and Viable Cell Count Preliminary experiments demonstrated, by means of crystal violet staining, that all pathogen test strains used here were able to form biofilm in vitro in microtiter plates (data not shown). In order to further characterize the biological activity of B. amyloliquefaciens ANT1, quantification of cells in both planktonic and biofilm phases was performed on each pathogen test strains by colony enumerations on appropriate selective agar. For viable cell counts from biofilm, we first assessed that our experimental protocol was accurate compared to crystal violet staining. Cell counts on selective medium, expressed in CFU/cm2, were found correlated to the value obtained by the staining method. Indeed, Pearson correlation coefficients of 0.99 and 0.74 were obtained for mono- and co-culture, respectively (data not shown). As shown in Fig 1, cell growth of A. hydrophila was greatly reduced when co-cultured with B. amyloliquefaciens ANT1. Indeed, specific cell counts reduced in the presence of B. amyloliquefaciens ANT1 as cell numbers for the pathogen were approximately 6 log CFU/ml lower in co-culture versus mono-culture. By contrast, for

12

Log CFU / ml

10 8 6 4 2 0 P. aeruginosa

A. hydrophila

A. niger

B. cereus

Fig. 1 Densities (CFU per ml) of planktonic phase cells in tryptic soy broth for selected pathogen test strains during mono-culture (black bars) or co-culture (gray bars) with B. amyloliquefaciens ANT1. Data represent means of three independent experiments

P. aeruginosa, A. niger and B. cereus, a weaker effect was observed (log reduction of 2, 2.1 and 2, respectively). Co-culture with B. amyloliquefaciens ANT1 also affected the biofilm formation for the pathogen test strains. Specific cell counts for A. hydrophila and A. niger in the co-cultured biofilms were significantly reduced (P \ 0.05) by 4.6 and 3.2 log CFU/cm2, respectively, as compared to their mono-cultured counterparts. In contrast, co-culture with ANT1 had little or no effect on biofilm formation for P. aeruginosa and B. cereus (Fig. 2). Effect of ANT1 Supernatant Against A. hydrophila Planktonic cell growth and biofilm formation by pathogen test strains were affected at different levels when co-cultured with B. amyloliquefaciens ANT1. In order to provide some experimental evidence of the antimicrobial nature of metabolites produced by the B. amyloliquefaciens strain, further experiments were conducted using cell-free supernatant from ANT1 as the growth medium for A. hydrophila, the test pathogen that previously displayed the greatest sensitivities in co-cultures. As shown in Fig. 3, there was a significant reduction (P \ 0.05) in viable cell counts for both planktonic and biofilm phases when subjected to the treatment with ANT1 supernatant. When treated with ANT1, cell numbers for A. hydrophila biofilms were decreased from 8 log CFU/ cm2 to values equal to 5.3 and 4.8 log CFU/cm2 after 4 and 24 h, respectively. The dispersal of cells from the biofilm into bulk media resulted in the planktonic growth; however, these cells showed even greater sensitivity to ANT1 supernatant as reductions of 7.9 and 7.3 log units were observed for the same sample periods, respectively. Analysis of Antimicrobial Compounds Produced by B. amyloliquefaciens ANT1 ANT1 culture supernatant collected after 72 h of growth in Landy medium was concentrated by solid phase extraction

123

256

Probiotics & Antimicro. Prot. (2013) 5:252–258 12

Table 2 Metabolite production of B. amyloliquefaciens ANT1 detected by HPLC-ESI mass spectrometry

Cell density

10 8 6

Metabolite

Observed mass peak

Assignment

Surfactin

1016.8 [M?Na]?

C12-surfactin

4 2

Fengycin

0 0h

4h+ANT1 supernatant

24 h+ANT1 supernatant

24h+TSB

Fig. 3 Densities of viable cells of A. hydrophila in planktonic phase (black bars, value expressed in CFU per ml) or contained in biofilm (gray bars, expressed in CFU per cm2) following incubation in cellfree B. amyloliquefaciens ANT1 supernatant for 4 h or 24 h. Data represent means of four independent experiments

and analyzed by HPLC–ESI–MS. As shown in Table 2, six groups of mass peaks were detected. On the basis of data obtained from previous experiments [2], three groups were found to correspond to cyclic lipopeptides. Signals at m/z from 1016.8 to 1058.8, from 1450.1 to 1534.0 and from 1043.7 to 1071.7 were identified as surfactins, fengycins and iturin A homologues, respectively. In the fengycin cluster, some peaks with the highest m/z correspond to the substitution of Ala by a Val residue in the various homologues identified. However, specific peaks with calculated masses corresponding to the different homologues of mycosubtilin and bacillomycin D, the two other members of the iturin group, could not be detected. The three remaining groups of mass peaks were found to correspond to polyketides. Signals at m/z 425.4, 485.5 and 511.2 were assigned to the molecular ions of macrolactin A, 7-o-succinyl macrolactin A and 7-o-malonyl macrolactin A, respectively. Signals at m/z 544.4, 559.4 and 563.5 were assigned to difficidin, oxydifficidin and bacillaene A, respectively, based on data from the literature [7, 35]. The characteristic peaks of the other secondary metabolites possibly co-produced by Bacillus spp., i.e., bacilysin, its chlorinated derivative chlorotetain, the siderophore bacillibactin and the antimicrobial zwittermicin were not detected.

Discussion Biofilm formation has been recognized as a key parameter in nosocomial infections. Medical device-related infections are one of the most striking examples of biofilm-dependent infections. Although any inserted medical device can be colonized by host microflora, the widespread use of intravenous catheters has made them particularly prone to biofilm development and subsequent source of infections [3]. For instance, in European hospitals, 56 % of

123

Iturin A

Macrolactin

Difficidin Bacillaene

1030.8 [M?Na]?

C13-surfactin

1044.8 [M?Na] ?

C14-surfactin

1058.8 [M?Na]?

C15-surfactin

1450.1 [M?H]?

Ala-6 C15-fengycin

1464.1 [M?H]?

Ala-6 C16-fengycin

1478.1 [M?H]? 1492.1 [M?H]?

Ala-6 C17-fengycin Val-6 C16-fengycin

1520.0 [M?H]?

Val-6 C18-fengycin

1534.0 [M?H]?

Val-6 C19-fengycin

1043.7 [M?NH]?

C14-iturin A

1057.7 [M?H]?

C15-iturin A

1071.7 [M?H]?

C16-iturin A

425.4 [M?Na]?

Macrolactin A

485.5 [M?Na]?

7-o-succinyl macrolactin A

511.2 [M?Na]?

7-o-malonyl macrolactin A

544.4 [M?H]?

Difficidin

559.4 [M-H]-

Oxydifficidin

563.5 [M?H]?

Bacillaene A

bloodstream infections are catheter-associated [4]. Biofilms exhibit tolerance to biocides, chemotherapeutic agents and host-immune defenses. Consequently, biofilm-associated infections are extremely difficult to treat and often lead to chronic diseases or recurrent infections [3]. Therefore, improvement of preventative strategies, including the development of novel antibiofilm drugs, is of the upmost importance. Among NRP antibiotics, the cyclic lipopeptide daptomycin is the prototype molecule that was approved by the Food and Drug Administration in 2003 for the treatment of skin infections caused by Gram-positive pathogens, including methicillin-resistant S. aureus, and in 2006 for the treatment of bacteremia [32]. However, the development of daptomycin resistance in Enterococcus faecium and S. aureus underscores the demand for daptomycin derivatives or novel-related drugs. In our study, B. amyloliquefaciens ANT1 was found to produce several lipopeptide antibiotics including surfactin, iturin A and fengycin B. These cyclic lipopeptides are composed of seven (surfactin and iturin A) or 10 a-amino acids (fengycins) linked to a b-amino (iturins) or a b-hydroxy (surfactins and fengycins) fatty acid which may vary from C-13 to C-16 for surfactins, from C-14 to C-17 for iturins and from C-14 to C-18 for fengycins. These compounds have well-recognized applications due notably to their antibacterial, antifungal, antiviral, antitumor and antimycoplasma activities [11, 19, 28].


In addition to these peptides, polyketides are the other dominant family of secondary metabolites having relevant bioactivities [11]. Macrolactin, difficidin and bacillaene were detected by LC–MS analysis in the culture supernatant of B. amyloliquefaciens ANT1. Macrolactins are macrolides containing three separate diene structure elements in a 24-membered lactone ring [14]. They are considered as potent antiviral, cytotoxic agents with antibacterial activity. Macrolactin A is able to inhibit murine melanoma cells in vitro as well as the replication of herpes simplex viruses, and squalene synthase activity with, thus having possible applications in the prevention of cardiovascular disease by lowering cholesterol levels [10]. Moreover, it also protects T lymphoblast cells against human immunodeficiency virus replication [14]. It has been shown that the macrolactin derivative 7-o-malonyl macrolactin interferes with one or more stages of cell division for a number of multidrug-resistant Gram-positive bacteria such as MRSA and VRE [33]. The hydroxyl group at C-15 was suggested to play an important role in the antibacterial activity of this compound [25]. Difficidin is an unsaturated 22-membered macrocyclic polyene lactone phosphate ester [40] with broad-spectrum antibacterial activity against aerobic and anaerobic bacteria. It was found effective in the treatment of lethal bacteremia caused by Klebsiella pneumoniae in mice [44]. By using radiolabelled amino acid, Zweerink and Edison [45] demonstrated that diffcicin was able to abolish protein synthesis in vivo and in vitro. Similar to difficidin, bacillaene interferes with prokaryotic protein synthesis probably by inhibiting the initiation step [29]. This compound is constituted by an open-chain enamine acid with an extended polyene system. It was found active against human pathogens such as Serratia marcescens (often associated with catheter-associated bacteremia), Klebsiella pneumonia and Proteus vulgaris as well as Gram-positive bacteria such as S. aureus [29]. While the antimicrobial activities of the aforementioned compounds on planktonic bacteria are well documented, information pertaining to their activity against microbial biofilms is scarce. Mireles and collaborators [24] demonstrated that surfactin is able to inhibit Salmonella enterica biofilm adhesion on pre-coated urinary catheters. They also reported a similar effect for Escherichia coli, while this pre-treatment was completely ineffective against P. aeruginosa. This anti-adhesion behavior of surfactin was also reported for S. aureus for pre-coated plastic devices [31]. These authors also reported that fengycin also inhibited bacterial biofilm formation, probably by interfering with cell membrane structure. In our study, we further investigated this antibiofilm activity. As a first step, we demonstrated that the different secondary metabolites produced by B. amyloliquefaciens ANT1 were able to inhibit the

257

growth of the human pathogens used in this study. Indeed, the antimicrobial cocktail produced was found active against the representative Gram-negative and Gram-positive bacteria, as well as the fungus (A. niger) tested here. While the spectrum of the antimicrobial activities could be ascribed to the production of distinct antimicrobial compounds, whether they act individually or in combination to disturb biofilm formation remains to be characterized in more detail. Experiments are in progress to further characterize such possible synergism. However, this first report highlights B. amyloliquefaciens ANT1 as a candidate bacterium for control of pathogenic biofilm-formers in hospital environment. Acknowledgments The authors gratefully thank R. Gesuele, L. Lista and A. Zanfardino for their kind help and advice. A. ArguellesArias is recipient of a FRIA fellowship (Belgium). Conflict of interest of interest.

The authors declare that they have no conflict

References 1. Arguelles-Arias A, Craig M, Fickers P (2011) Gram-positive antibiotic biosynthetic cluster: a review. Science against microbial pathogen: communicating current research and technological advances. World Scientific Publ, New Jersey, pp 977–986 2. Arguelles-Arias A, Ongena M, Halimi B, Lara Y, Brans A, Joris B, Fickers P (2009) Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microb Cell Fact 8:63 3. Brooks JL, Jefferson K (2012) Staphylococcal biofilms: quest for the magic bullet. Adv Appl Microbiol 81:63–87 4. Bryers J (2008) Medical biofilms. Biotechnol Bioeng 100:1–18 5. Burmolle M, Webb JS, Rao D, Hansen LH, Sorensen SJ, Kjelleberg S (2006) Enhanced biofilm formation and increased resistance to antimicrobial agents and bacterial invasion are caused by synergistic interactions in multispecies biofilms. Appl Environ Microbiol 72:3916–3923 6. Chen XH, Koumoutsi A, Scholz R, Borriss R (2009) More than anticipated—production of antibiotics and other secondary metabolites by Bacillus amyloliquefaciens FZB42. J Mol Microbiol Biotechnol 16:14–24 7. Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O, Junge H, Voigt B, Jungblut PR, Vater J, Sussmuth R, Liesegang H, Strittmatter A, Gottschalk G, Borriss R (2007) Comparative analysis of the complete genome sequence of the plant growthpromoting bacterium Bacillus amyloliquefaciens FZB42. Nat Biotechnol 25:1007–1014 8. Chen XH, Koumoutsi A, Scholz R, Schneider K, Vater J, Sussmuth R, Piel J, Borriss R (2009) Genome analysis of Bacillus amyloliquefaciens FZB42 reveals its potential for biocontrol of plant pathogens. J Biotechnol 140:27–37 9. Cushnie T, Lamb A (2005) Antimicrobial activity of flavonoids. Int J Antimicrob Agents 26:343–356 10. Do R, Kiss R, Gaudet D, Engert J (2009) Squalene synthase: a critical enzyme in the cholesterol biosynthesis pathway. Clin Genet 75:19–29

123

258 11. Fickers P (2012) Antibiotic compounds from Bacillus: why are they so amazing? Am J Biochem Biotechnol 8:40–46 12. Fickers P, Leclere V, Guez JS, Bechet M, Coucheney F, Joris B, Jacques P (2008) Temperature dependence of mycosubtilin homologue production in Bacillus subtilis ATCC6633. Res Microbiol 159:449–457 13. Guida M, Nastro RA, Inglese M, Trifuoggi M, Scherillo S, Gesuele R, Di Onofrio V, Liguori G (2011) The hospital environment as a source of new antimicrobial substances: antimicrobial activity of Bacillus amyloliquefaciens strain HNA3 isolated in a surgery room. Science and technology against microbial pathogens. World Scientific Publishing, New jersey, pp 421–424 14. Gustafson K, Roman M, Fenical W (1989) The macrolactin, a novel class of antiviral and cytotoxic macrolides from a deep-sea marine bacterium. J Am Chem Sci 111:7519–7524 15. Hall-Stoodley L, Stoodley P (2002) Developmental regulation of microbial biofilms. Curr Opin Biotechnol 13:228–233 16. Hoiby N, Ciofu O, Johansen HK, Song ZJ, Moser C, Jensen PO, Molin S, Givskov M, Tolker-Nielsen T, Bjarnsholt T (2011) The clinical impact of bacterial biofilms. Int J Oral Sci 3:55–65 17. Khodavaisy S, Nabili M, Davari B, Vahedi M (2011) Evaluation of bacterial and fungal contamination in the health care workers’ hands and rings in the intensive care unit. J Prev Med Hyg 52:215–218 18. Landy M, Warren H, Roseman S, Golio L (1948) Bacillomycin; an antibiotic from Bacillus subtilis active against pathogenic fungi. Soc Exp Biol Med 67:539–541 19. Maget-Dana R, Peypoux F (1994) Iturins, a special class of poreforming lipopeptides: biological and physicochemical properties. Toxicology 87:151–174 20. Marouani-Gadri N, Augier G, Carpentier B (2009) Characterisation of bacterial strain isolated from a beef-processing plant following cleaning and disinfection: influence of isolated strains on biofilm formation by Sakaı¨ EDL933 and E. coli O157:H7. Int J Food Microbiol 133:62–67 21. Masterton R (2008) The importance and future of antimicrobial surveillance studies. Clinical infectious diseases. Inf Dis Sci Am 47(Suppl 1):S21–S31 22. Meier JL, Burkart MD (2009) The chemical biology of modular biosynthetic enzymes. Chem Sci Rev 38:2012–2045 23. Merrit JH, Kadouri DE, O’Toole G (2011) Growing and analysing static biofilm. Curr Protoc Microbiol 22:1B.1.1–1B.1.18 24. Mireles J, Toguchi A, Harshey R (2001) Salmonella enterica serovar Typhimurium swarming mutants with altered biofilmforming abilities: surfactin inhibits biofilm formation. J Bacteriol 183:5848–5854 25. Nagao T, Adachi K, Sakai M, Nishijima M, Sano H (2001) Novel macrolactins as antibiotic lactones from a marine bacterium. J Antibiot 54:333–339 26. Nastro RA, Di Costanzo A, Gesuele R, Trifuoggi M, Inglese M, Guida M (2011) Influence of temperature on the production of antibiotic molecules in Bacillus amyloliquefaciens strain HNA3. Science against microbial pathogens: communicating current research and technological advance. World Scientific Publishing, New Jersey, pp 1307–1310 27. Nordmann P, Naas T, Fortineau N, Poirel L (2007) Superbugs in the coming new decade; multidrug resistance and prospects for treatment of Staphylococcus aureus, Enterococcus spp. and Pseudomonas aeruginosa in 2010. Curr Opin Microbiol 10:436–440 28. Ongena M, Jacques P (2008) Bacillus lipopeptides: versatile weapons for plant disease biocontrol. Trends Microbiol 16:115–125 29. Patel PS, Huang S, Fisher S, Pirnik D, Aklonis C, Dean L, Meyers E, Fernandes P, Mayerl F (1995) Bacillaene, a novel inhibitor of procaryotic protein synthesis produced by Bacillus subtilis: production, taxonomy, isolation, physico-chemical characterization and biological activity. J Antibiot 48:997–1003

123

Probiotics & Antimicro. Prot. (2013) 5:252–258 30. Rendueles O, Kaplan JB, Ghigo JM (2013) Antibiofilm polysaccharides. Environ Microbiol 15:334–346 31. Rivardo F, Turner RJ, Allegrone G, Ceri H, Martinotti MG (2009) Anti-adhesion activity of two biosurfactants produced by Bacillus spp. prevents biofilm formation of human bacterial pathogens. Appl Microbiol Biotechnol 83:541–553 32. Robbel L, Marahiel MA (2010) Daptomycin, a bacterial lipopeptide synthesized by a non ribosomal machinery. J Biol Chem 285:27501–27508 33. Romero-Tabarez M, Jansen R, Sylla M, Lu¨nsdorf H, Ha¨ussler S, Santosa DA, Timmis KN, Molinari G (2006) 7-O-malonyl macrolactin A, a new macrolactin antibiotic from Bacillus subtilis active against methicillin-resistant Staphylococcus aureus, vancomycinresistant enterococci, and a small-colony variant of Burkholderia cepacia. Antimicrob Agents Chemother 50:1701–1709 34. Rosenthal VD, Bijie H, Maki DG, Mehta Y, Apisarnthanarak A, Medeiros EA, Leblebicioglu H, Fisher D, Alvarez-Moreno C, Khader IA, Del Rocio Gonzalez Martinez M, Cuellar LE, NavoaNg JA, Abouqal R, Guanche Garcell H, Mitrev Z, Pirez Garcia MC, Hamdi A, Duenas L, Cancel E, Gurskis V, Rasslan O, Ahmed A, Kanj SS, Ugalde OC, Mapp T, Raka L, Yuet Meng C, Thu le TA, Ghazal S, Gikas A, Narvaez LP, Mejia N, Hadjieva N, Gamar Elanbya MO, Guzman Siritt ME, Jayatilleke K (2012) International Nosocomial Infection Control Consortium (INICC) report, data summary of 36 countries, for 2004–2009. Am J Infect Control 40:396–407 35. Schneider K, Chen XH, Vater J, Franke P, Nicholson G, Borriss R, Sussmuth RD (2007) Macrolactin is the polyketide biosynthesis product of the pks2 cluster of Bacillus amyloliquefaciens FZB42. J Nat Products 70:1417–1423 36. Sergent AP, Slekovec C, Pauchot J, Jeunet L, Bertrand X, Hocquet D, Pazart L, Talon D (2012) Bacterial contamination of the hospital environment during wound dressing change. OTSR 98:441–445 37. Stoodley P, Sauer K, Davies DG, Costerton JW (2002) Biofilms as complex differentiated communities. Ann Rev Microbiol 56:187–209 38. Strieker M, Tanovic A, Marahiel M (2010) Non ribosomal peptide synthetase: structure and dynamics. Curr Opin Struct Biol 20:234–240 39. Toure Y, Ongena M, Jacques P, Guiro A, Thonart P (2004) Role of lipopeptides produced by Bacillus subtilis GA1 in the reduction of grey mould disease caused by Botrytis cinerea on apple. J Appl Microbiol 96:1151–1160 40. Wilson KE, Flor JE, Schwartz RE, Joshua H, Smith JL, Pelak BA, Liesch JM, Hensens OD (1987) Difficidin and oxydifficidin: novel broad spectrum antibacterial antibiotics produced by Bacillus subtilis. II Isolation and physico-chemical characterization. J Antibiot 40:1682–1691 41. Xu H, Zou Y, Lee HY, Ahn J (2010) Effect of NaCl on the biofilm formation by foodborne pathogens. J Food Sci 75:580–585 42. Yang L, Liu Y, Markussen T, Hoiby N, Tolker-Nielsen T, Molin S (2011) Pattern differentiation in co-culture biofilms formed by Staphylococcus aureus and Pseudomonas aeruginosa. FEMS Imm Med Microbiol 62:339–347 43. Zeigler DR (2003) Gene sequences useful for predicting relatedness of whole genomes in bacteria. Int J Syst Environ Microbiol 53:1893–1900 44. Zimmerman SB, Schwartz CD, Monaghan RL, Pelak BA, Weissberger B, Gilfillan EC, Mochales S, Hernandez S, Currie SA, Tejera E (1987) Difficidin and oxydifficidin: novel broad spectrum antibacterial antibiotics produced by Bacillus subtilis. I. Production, taxonomy and antibacterial activity. J Antibiot 40:1677–1681 45. Zweerink M, Edison A (1987) Difficidin and oxydifficidin: novel broad spectrum antibacterial antibiotics produced by Bacillus subtilis. III. Mode of action of difficidin. J Antibiot 40:1692–1697