Antimicrobial resistance patterns and their encoding ...

burns 38 (2012) 1198–1203

Available online at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/burns

Antimicrobial resistance patterns and their encoding genes among Acinetobacter baumannii strains isolated from burned patients Parisa Asadollahi a, Mahdi Akbari b, Setareh Soroush c, Morovat Taherikalani a,d,*, Khairollah Asadollahi e, Kourosh Sayehmiri e, Abbas Maleki a, Mohammad Hossein Maleki a, Parviz Karimi f, Mohammad Emaneini c a

Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran Department of Microbiology, School of Medicine, University of Shahed, Tehran, Iran c Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran d Department of Microbiology, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran e Department of Epidemiology and Biostatistics, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran f Department of Pediatrics, School of Medicine, Ilam University of Medical Sciences, Ilam, Iran b

article info

abstract

Article history:

The purpose of this study was to determine the mechanisms and patterns of antimicrobial

Accepted 15 April 2012

resistance among the isolates obtained from burned patients with wound infections at a

Keywords:

from patients with burn wound infections between August 2009 and July 2010 from a

teaching hospital in Tehran, Iran. A total of 23 Acinetobacter baumannii isolates were collected A. baumannii

hospital in Tehran. The susceptibility of these strains against 11 antimicrobial agents

Burns

was determined by E-test according to the CLSI guidelines. All the resistant strains were

Antimicrobial agents

then subjected to PCR assay for 28 distinct resistance genes. The most active antimicrobial

Resistant genes

agent was colistin with 100% sensitivity followed by gentamicin, amikacin and imipenem with 69.5%, 52.1% and 51.1% sensitivity, respectively. The most frequent resistance genes

Iran

detected were blaOXA-51-like genes (n = 23; 100%) that was intrinsic to A. baumannii isolates, gyrA (n = 23; 100%), carO (n = 23; 100%), tetA (n = 22; 95.5%), tetB (n = 15; 65.2%), intI (n = 13; 56.5%) and PER (n = 12; 52.1%), respectively. In order to make a proper choice of antibiotic for burn patients, it would be beneficial to physicians to identify drug resistance patterns in A. baumannii isolates. # 2012 Elsevier Ltd and ISBI. All rights reserved.

1.

Introduction

Burn wounds usually represent a susceptible site for colonization of opportunistic organisms from either endogenous or exogenous origin. Both facultative and aerobic gram negative

bacilli and aerobic gram-positive cocci can be isolated from burn wound cultures. One of the causative agents that is being isolated with increasing frequency from burn wound infections is Acinetobacter baumannii. This organism is an important opportunistic pathogen responsible for a variety of nosocomial infections, comprising bacteremia, urinary tract infection,

* Corresponding author at: Department of Microbiology, School of Medicine, Ilam University of Medical Sciences, Banganjab, Ilam, Iran. Tel.: +98 841 222 7134. E-mail address: [email protected] (M. Taherikalani). 0305-4179/$36.00 # 2012 Elsevier Ltd and ISBI. All rights reserved. http://dx.doi.org/10.1016/j.burns.2012.04.008

burns 38 (2012) 1198–1203

secondary meningitis, surgical site infection, nosocomial ventilator-associated pneumonia, and dirty wound infections [1–3]. Extensive use of antimicrobial chemotherapy within hospitals has contributed to the emergence and procreation of A. baumannii strains which are resistant to a wide range of antibiotics, including broad spectrum b-lactams, aminoglycosides, and fluoroquinolones. Resistance to b-lactams appears to be primarily caused by b-lactamase production, including the extended spectrum b-lactamases (blaTEM, blaSHV, blaVEB, blaPER), metallo-b-lactamases (blaIMP, blaVIM, blaSIM, blaGIM), and most commonly, oxacillinases (blaOXA51, 23, 24 and 58). Antibiotic target site alterations confer resistance to fluoroquinolones (gyrA, parC, qnr) and aminoglycosides (aph6, aadA1, aadB, aacC1, aacA4), and to a much less extent, to blactams. Efflux pumps (tet, ade) contribute to resistance against b-lactams, tetracyclines, fluoroquinolones, and aminoglycosides. Finally, porin channel deletion (carO) appears to contribute to b-lactam resistance. Because of the multiple antibiotic resistance exhibited by A. baumannii, nosocomial infections caused by this organism are difficult to treat [4–9]. These therapeutic difficulties are associated with the great capacity of these organisms for long term survival in hospital environments which favors their transmission between patients, either via human reservoirs or via inanimate materials [1]. According to the literature review, this work seems to be the most comprehensive study among burn patients in Iran that has focused on the distribution of different resistance genes and the antimicrobial susceptibility of A. baumannii isolates. Considering the previous investigations, carried out by our research team, indicating an increase in antibiotic resistance among A. baumannii strains in Iran and the numerous reports on the antibiotic resistance of A. baumannii strains isolated from burn patients among the infectious-disease specialists in Tehran, a need was seen to carry out a comprehensive survey on the A. baumannii strains obtained from burn infections in a teaching hospital in Tehran.

2.

Materials and methods

2.1.

Bacterial isolates

A total of 23 isolates of A. baumannii were recovered during August 2009 and July 2010 from burn wounds of patients, hospitalized at ICU, in a teaching hospital in Tehran. The isolates were non-repetitive, meaning that each isolate was obtained from a particular patient and each patient was sampled only once. All the isolates were identified as A. baumannii species by biochemical methods and API 20NE system. The PCR of blaOXA-51-like genes was used as a final confirmation as to the presence of A. baumannii species [10].

2.2.

1199

interpreted according to CLSI guidelines [11]. Escherichia coli ATCC 25922 and 35218 and Pseudomonas aeruginosa ATCC 27853 were used as controls.

2.3.

DNA extraction

Genomic DNA was extracted by standard DNA Extraction Kit (Bioner, Republic of Korea) according to the previous reports [12]. A total of 5 mL of DNA extract was used for each reaction.

2.4. PCR amplification of blaOXA-like carbapenemase, metalo-b-lactamase and extended-spectrum-b-lactamase (ESBLs) genes A multiplex PCR were used for detection of blaOXA-51, 23, 24 and 58like carbapenemase genes according to the previous reports [13,14]. The list of blaOXA carbapenemases is shown in Table 1. A. baumannii NCTC 12156, NCTC 13302, NCTC13303 and NCTC 13304 were used as standard positive controls for blaOXA51, 23, 24 and 58-like carbapenemases, respectively. Standard strains for other b-lactamase genes were not available in this study and, therefore, the PCR procedure was repeated twice for negative controls while positive samples were analyzed visually based on amplicon sizes.

2.5. PCR amplification of aminoglycoside modifying enzyme genes and classes I–III integrons The PCR amplification of the genes encoding aminoglycoside modifying enzymes (aacA4, aacC1, aadA1, aadB, aphA6, aacC2, intI, intII and intIII) was carried out by previously described primers (Table 1). The reactions were performed in a final volume of 25 mL containing 10 pmolTaq PCR Master Mix (Qiagen), 0.2 mM of each primer and 5 mL of DNA suspension obtained by DNA extraction kit. The amplification reactions were performed with the following parameters: 94 8C for 2 min followed by 30 cycles of 30 s at 94 8C, 30 s according to the list of Table 1 and 60 s at 72 8C. Standard positive strains for these genes were not available in this study; therefore in addition to checking the size of the amplicons, negative strains were repeated twice for accuracy.

2.6. PCR amplification of tetracycline and quinolone resistance genes The sequences of primers used for detection of tetA, tetB, gyrA, qnr, carO and parC are shown in Table 1. PCR conditions included 30 cycles of amplification under the following conditions: denaturation at 95 8C for 30 s, annealing for 1 min at primer set specific temperatures (Table 1), and extension at 72 8C for 1 min. Cycling was followed by a final extension at 72 8C for 10 min.

Antimicrobial susceptibility

Susceptibility of the isolates to 11 antimicrobial agents including piperacillin, ampicillin-sulbactam, ciprofloxacin, amikacin, imipenem, cefotaxime, cefepime, ceftriaxone, tetracycline, gentamicin and colistin was determined by E-test on Mueller–Hinton agar plates and the results were

2.7. Repetitive extragenic palindromic-PCR (REP-PCR) analysis The primer pair REP1, 50 -IIIGCGCCGICATCAGGC-30 and REP2, 50 ACGTCTTATCAGGCCTAC-30 were used to amplify putative REPlike elements in the genomic bacterial chromosomes according

1200

burns 38 (2012) 1198–1203

Table 1 – The primer sequences used. Target genes blaOXA-51-like blaOXA-23-like blaOXA-24-like blaOXA-58-like ISABA-1 blaTEM blaSHV blaVEB blaPER blaGIM blaIMP blaVIM blaADC tetA tetB gyrA Qnr carO parC aacA4 aacC1 aadA1 aadB aphA6 aacC2 intI intII intIII

Forward

Reverse

Annealing (8C)

Amplicon size (bp)

TAATGCTTTGATCGGCCTTG GATCGGATTGGAGAACCAGA GGTTAGTTGGCCCCCTTAAA AAGTATTGGGGCTTGTGCTG ATGCAGCGCTTCTTTGCAGG GCACGAGTGGGTTACATCGA ATGCGTTATATTCGCCTGTG ATGAAAATCGTAAAAAGGATATT ATGAATGTCATTATAAAAG ATATTACTTGTAGCGTTGCCAGC GTTTATGTTCATACWTCG TTTGGTCGCATATCGCAACG ATGCGATTTAAAAAAATTTCTTGT GCGCGATCTGGTTCACTCG TACGTGAATTTATTGCTTCGG AAATCTGCCCGTGTCGTTGGT AGAGGATTTCTCACGCCAGG ATGAAAGTATTACGTGTTTTAGTG AAACCTGTTCAGCGCCGCATT ATGACTGAGCATGACCTTGCG ATGGGCATCATTCGCACATGTAGG ATGAGGGAAGCGGTGATCG ATGGACACAACGCAGGTCGC ATGGAATTGCCCAATATTATTC ATGCATACGCGGAAGGCAATAAC GACGATGCGTGGAGACC ACGATGCCTGCTTTTTGTACGGCTGC TCAGCCGGGCGACAAGTGCAAGGCCA

TGGATTGCACTTCATCTTGG ATTTCTGACCGCATTTCCAT AGTTGAGCGAAAAGGGGATT CCCCTCTGCGCTCTACATAC AATGATTGGTGACAATGAAG GGTCCTCCGATCGTTGTCAG TGCTTTGTTATTCGGGCCAA TTATTTATTCAAATAGTAATTCC TTGGGCTTAGGGCAG TTAATCAGCCGACGCTTCAG GGTTTAAYAAAACAACCAC CCATTCAGCCAGATCGGCAT TGGAATACGTTTATTGGTTAACATGA AGTCGACAGYRGCGCCGGC ATACAGCATCCAAAGCGCAC GCCATACCTACGGCGATACC TGCCAGGCACAGATCTTGAC TTACCAGTAGAAGTTTACACC AAAGTTGTCTTGCCATTCACT TTAGGCATCACTGCGTGTTCG TTAGGTGGCGGTACTTGGGTC TTATTTGCCGACTACCTTGGTG TTAGGCCGCATATCGCGACC TCAATTCAATTCATCAAGTTTTA CTAACCGGAAGGCTCGCAAG CTTGCTGCTTGGATGCC CCGTCTATCCTGCTTGCACGATGCA ATGAACAGGTATAACAGAAAT

53 53 53 53 55 65 60 47 44 61 45 66 50 53 53 63 52 50 58 65 64 62 68 55 65 50 51 52

353 501 246 599 393 310 753 780 927 729 432 500 1081 164 206 285 661 285 276 487 421 624 495 736 719 300 962 1041

to the previous reports [15,16]. Amplification reaction was carried out by thermal cycler (Eppendorf, Germany) with an initial denaturation at 94 8C for 10 min, followed by 30 cycles of denaturation at 94 8C for 1 min, annealing at 45 8C for 1 min, and extension at 72 8C for 1 min, followed by final extension at 72 8C for 16 min.

2.8.

Statistical analysis

Because of the limited number of samples, the Fisher’s Exact Test was employed to assess correlation between different antibiotic resistance and the relevant encoding genes. In order to estimate the p-value and its confidence interval, the Monte Carlo method was used. The data were analyzed using the R-software version 2.1.

3.

References [14] [14] [14] [14] [39] [39] [39] [39] [39] [39] [39] [39] [39] [32] [32] [32] [32] [32] [32] [39] [39] [39] [39] [39] [39] [32] [32] [32]

Results

The most active antimicrobial agent against A. baumannii isolates was colistin with 100% sensitivity followed by gentamicin, amikacin, imipenem, ampicillin-sulbactam and tetracycline with 69.5%, 52.1% and 51.1%, 43.4% and 21.7% sensitivity, respectively. The MICs of all antimicrobial agents are shown in Table 2. All the isolates harbored blaOXA-51-like carbapenemase gene. The most common resistance genes were gyrA, carO, tetA, tetB, intI, blaPER and blaTEM with the frequency of 100%, 100%, 95.6%, 65.2%, 56.5%, 52.1%, 43.4%, respectively. Other resistance genes included blaOXA-23-like (21.7%), blaOXA-24-like (17.3%), aph6 (17.3%), aadA1 (17.3%), aadC1 (17.3%), intII (13.2%) and aadB (4.3%). Coexistence of different

Table 2 – The MIC results of 23 A. baumannii isolates, obtained from burn patients in a teaching hospital in Tehran, Iran. Antibiotics

Range of MIC (mg/mL)

MIC50 (mg/mL)

MIC90 (mg/mL)

n (%) Sensitive

Colistin Piperacillin Ampicillin-sulbactam Cefepime Ceftriaxone Cefotaxime Amikacin Gentamicin Tetracycline Ciprofloxacin Imipenem

0.125–1 0.125–256 0.125–256 0.125–512 0.125–512 0.125–512 0.004–8 0.004–32 0.004–32 0.125–256 0.004–32

0.125 16 16 32 32 32 1 1 4 16 1

0.125 32 32 128 128 128 2 2 8 32 2

23 0 10 0 0 0 12 16 5 0 12

(100) (43.4)

(52.1) (69.5) (21.7) (52.7)

Intermediate 0 0 6 0 1 0 3 33 10 0 4

(26.08) (4.3) (13.04) (13.04) (43.47) (17.39)

Resistant 0 23 7 23 22 23 8 4 8 23 7

(100) (34.78) (100) (95.7) (100) (34.78) (17.39) (34.78) (100) (30.43)

1201

burns 38 (2012) 1198–1203

Table 3 – Correlation between resistance and intermediate resistance to beta-lactam antibiotics and their encoding genes. Resistance genes

blaOXA-23-like blaOXA-24-like blaTEM blaSHV blaPER blaTEM + blaPER blaOXA-23 + blaTEM blaOXA-23 + blaPER blaOXA-24 + blaTEM blaOXA-24 + blaPER blaTEM + blaSHV + blaPER blaOXA23 + blaOXA24 + blaPER + blaTEM

Antibiotic resistance phenotypes Piperacillin (n = 23)

Ampicillin-sulbactam (n = 13)

Cefepime (n = 23)

Ceftriaxone (n = 23)

Cefotaxime (n = 23)

Imipenem (n = 11)

5 (21.7%) 4 (17.3%) 10 (43.4%) 1 (4.3%) 12 (52.1%) 5 (21.7%) 2 (8.6%) 4 (17.3%) 2 (8.6%) 2 (8.6%) 1 (4.3%) 1 (4.3%)

2 1 6 1 7 3 1 1 0 1 1 0

5 (21.7%) 4 (17.3%) 10 (43.4%) 1 (4.3%) 12 (52.1%) 5 (21.7%) 2 (8.6%) 4 (17.3%) 2 (8.6%) 2 (8.6%) 1 (4.3%) 1 (4.3%)

5 (21.7%) 4 (17.3%) 10 (43.4%) 1 (4.3%) 12 (52.1%) 5 (21.7%) 2 (8.6%) 4 (17.3%) 2 (8.6%) 2 (8.6%) 1 (4.3%) 1 (4.3%)

5 (21.7%) 4 (17.3%) 10 (43.4%) 1 (4.3%) 12 (52.1%) 5 (21.7%) 2 (8.6%) 4 (17.3%) 2 (8.6%) 2 (8.6%) 1 (4.3%) 1 (4.3%)

5 4 7 1 7 2 1 3 2 1 1 1

(15.3%) (7.6%) (46.1) (7.6%) (53.8) (23.1) (7.6%) (7.6%) (7.6%) (7.6%)

resistance genes was seen among all the resistant isolates. All the isolates which were resistant against beta-lactam agents harbored at least two resistance genes (Table 2). More than 50% of the isolates resistant against amikacin and gentamicin, harbored aminoglycoside modifying enzyme genes or coexisted them (Table 4). All the tetracycline resistant isolates contained carO, tetA and tetB genes ( p  0.05) and all ciprofloxacin resistant isolates harbored gyrA. Correlation between b-lactam resistance and the encoding genes is shown in Table 3. The REP-PCR typing of all the 23 isolates showed an identical pattern.

4.

Discussion

The predominant causative organisms of burn wound infections in any burn unit change over time as the prevalent gram-positive infection is overgrown by gram-negative opportunists, mostly P. aeruginosa and A. baumannii [17,18]. The ability of A. baumannii to survive in both very dry and wet conditions, their affinity for plastic and metal materials, and their unobtrusive growth lead to failure in hygiene prophylaxis. The increase in the isolation of A. baumannii strains from biological materials of burn patients, which was observed over recent years, along with the very rapid

(45.4%) (36.3%) (63.6%) (9%) (63.6%) (18.1%) (9%) (27.2%) (18.1%) (9%) (9%) (9%)

development of antimicrobial resistant of the organism, led us to carry out the current study [19]. Antimicrobial resistance in A. baumannii has become a worldwide problem. The causes of resistance vary but they are often linked to the resistance genes and are transferred between bacterial species. These genes are acquired rapidly and contribute to the development of antimicrobial resistance [20]. Resistance rate to most antimicrobial agents, including carbapenems as first line drug agents against MDR A. baumannii isolates, are increasing in the world and in our country [3,12,13,16,21–24]. The results of this study, as agreed by other studies, showed that the resistance rate to beta-lactam antibiotics, ciprofloxacin and tetracycline was more than 50%. According to the results, resistance against imipenem was 47.8% which was also in agreement with other studies. This fact indicates that carbapenem resistances among A. baumannii isolates are increasing alarmingly [21,25–29]. The results of this study showed that resistance to beta-lactam antibiotic was largely due to existence of carbapenemase, ESBLs and metallo-beta-lactamase genes [10,30–32]. Like other studies, most beta-lactam resistant A. baumannii isolates harbored different blaOXA-like, blaPER and blaTEM [31,33,34]. Correlation between the existence of bla genes and phenotypic resistance against beta-lactam antibiotics in A. baumannii isolates was a finding that was confirmed by other

Table 4 – Correlation between resistance and intermediate resistance to aminoglycosides, tetracycline and ciprofloxacin and their encoding genes. Resistant genes

Antibiotic resistance phenotypes Gentamicin (n = 7)

Amikacin (n = 11) (18.1%) (9%) (9%) (27.2%)

Tetracycline (n = 18)

aph6 + aadA1 + aadC1 aph6 + aadA1 + aadC1 + IntI aph6 + aadB + aadA1 + aadC1 + IntI + IntII IntI

2 (28.5%) 0 1 (14.2%) 2 (28.5%)

2 1 1 3

– – – –

tetA tetB carO tetA + carO tetA + tetB + carO

– – – – –

– – – – –

17 14 18 3 14

gyrA

–

–

–

Ciprofloxacin (n = 23) – – – –

(94.4%) (77.7%) (100%) (16.6%) (77.7%)

– – – – – 23 (100%)

1202

burns 38 (2012) 1198–1203

studies [21,32,35]. The data analysis in this study, showed a significant correlation between betalactam resistance and the existence of different encoding genes (Table 3). Previous studies showed a significant increase in tetracycline and ciprofloxacin resistance in Iran and the results of this study confirmed previous reports [13,21,36]. Gentamicin has a good effect on MDR A. baumannii isolates. For yet unknown reasons, resistance to aminoglycoside antibiotics among Iranian A. baumannii was lower than that for b-lactam antibiotics. Similar to other studies, nearly 70% of aminoglycoside resistant isolates harbored at least one aminoglycoside modifying enzyme gene [12]. In accordance with other studies, the most effective antimicrobial agent against MDR A. baumannii isolates was colistin [10]. In spite of the reports supporting A. baumannii resistance against colistin [37,38], it seems that this agent could have a great influence on this bacterium. This agent also has a serious side effect on the host body, but will be used as the drug of choice when no other effective treatments are available. The results of this study showed an increase in the rate of multidrug resistance among A. baumannii isolates obtained from burn patients in a teaching hospital in Tehran. The identification of different resistance genes in this study, confirmed a wide geographical distribution of such genes among A. baumannii isolates. The existence of multidrug resistance phenotype among A. baumannii isolates in burn patients implies that care should be taken while detecting multidrug resistant A. baumannii isolates, controlling their associated infections and selecting for a proper drug treatment against their infections. The annual assessments on the increase or decrease of antibiotic resistance among the clinical isolates could provide the physicians with new therapeutic choices and even, in many cases, could offer valuable information to the Committee of Antibiotic Resistance Control of a particular hospital in Iran, so that treatment with ineffective antibiotics could be stopped and replaced by efficient drugs. This fact could, in turn, lead to a decrease in the circulation of bacterial resistant clones in hospital environments, particularly in Intensive Care Units and burn wards. Considering the fact that resistance among A. baumannii strains is continuously rising, the final decision on the treatment of nosocomial infections caused by A. baumannii strains is dependent upon the type of resistance observed, using antibiogram tests, in each geographic region. Even though the main therapeutic agents against such infections in Iran are imipenem, ampicillin-sulbactam and some aminoglycosides such as gentamicin treatments in many cases are still unsuccessful and the necessity to carry out antibiogram tests, for the treatment of infections caused by this organism, is strongly felt.

Conflict of interest None.

Acknowledgement This work was supported by Ilam University of Medical Sciences.

references

[1] Zarrilli R, Crispino M, Bagattini M, Barretta E, Di Popolo A, Triassi M, et al. Molecular epidemiology of sequential outbreaks of Acinetobacter baumannii in an intensive care unit shows the emergence of carbapenem resistance. J Clin Microbiol 2004;42:946–53. [2] Towner KJ, Levi K, Vlassiadi M. Genetic diversity of carbapenem-resistant isolates of Acinetobacter baumannii in Europe. Clin Microbiol Infect 2008;14:161–7. [3] Taherikalani M, Etemadi G, Geliani KN, Fatollahzadeh B, Soroush S, Feizabadi MM. Emergence of multi and pan-drug resistance Acinetobacter baumannii carrying blaOXA-typecarbapenemase genes among burn patients in Tehran. Iran Saudi Med J 2008;29:623–4. [4] Yum JH, Yi K, Lee H, Yong D, Lee K, Kim JM, et al. Molecular characterization of metallo-beta-lactamase-producing Acinetobacter baumannii and Acinetobacter genomospecies 3 from Korea: identification of two new integrons carrying the bla(VIM-2) gene cassettes. J Antimicrob Chemother 2002;49:837–40. [5] Wang H, Guo P, Sun H, Yang Q, Chen M, Xu Y, et al. Molecular epidemiology of clinical isolates of carbapenemresistant Acinetobacter spp. from Chinese hospitals. Antimicrob Agents Chemother 2007;51:4022–8. [6] Vila J, Ruiz J, Goni P, Jimenez de Anta T. Quinoloneresistance mutations in the topoisomerase IV parC gene of Acinetobacter baumannii. J Antimicrob Chemother 1997;39:757–62. [7] Turton JF, Kaufmann ME, Glover J, Coelho JM, Warner M, Pike R, et al. Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J Clin Microbiol 2005;43:3074–82. [8] Seward RJ, Lambert T, Towner KJ. Molecular epidemiology of aminoglycoside resistance in Acinetobacter spp.. J Med Microbiol 1998;47:455–62. [9] Naas T, Bogaerts P, Bauraing C, Degheldre Y, Glupczynski Y, Nordmann P. Emergence of PER and VEB extendedspectrum beta-lactamases in Acinetobacter baumannii in Belgium. J Antimicrob Chemother 2006;58:178–82. [10] Taherikalani M, Fatolahzadeh B, Emaneini M, Soroush S, Feizabadi MM. Distribution of different carbapenem resistant clones of Acinetobacter baumannii in Tehran hospitals. New Microbiol 2009;32:265–71. [11] Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: 20th informational supplement. Wayne, PA: CLSI; 2010, CLSI document M100-S120. [12] Akbari M, Niakan M, Taherikalani M, Feizabadi MM, Azadi NA, Soroush S, et al. Rapid identification of Iranian Acinetobacter baumannii strains by single PCR assay using BLA oxa-51-like carbapenemase and evaluation of the antimicrobial resistance profiles of the isolates. Acta Microbiol Immunol Hung 2010;57:87–94. [13] Feizabadi MM, Fathollahzadeh B, Taherikalani M, Rasoolinejad M, Sadeghifard N, Aligholi M, et al. Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitals. Jpn J Infect Dis 2008;61:274–8. [14] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp.. Int J Antimicrob Agents 2006;27:351–3. [15] Bou G, Cervero G, Dominguez MA, Quereda C, MartinezBeltran J. PCR-based DNA fingerprinting (REP-PCR, AP-PCR) and pulsed-field gel electrophoresis characterization of a nosocomial outbreak caused by imipenem- and

burns 38 (2012) 1198–1203

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

meropenem-resistant Acinetobacter baumannii. Clin Microbiol Infect 2000;6:635–43. Taherikalani M, Maleki A, Sadeghifard N, Mohammadzadeh D, Soroush S, Asadollahi P, et al. Dissemination of class 1, 2 and 3 integrons among different multidrug resistant isolates of Acinetobacter baumannii in Tehran hospitals, Iran. Pol J Microbiol 2011;60:169–74. Chim H, Tan BH, Song C. Five-year review of infections in a burn intensive care unit: high incidence of Acinetobacter baumannii in a tropical climate. Burns 2007;33:1008–14. Keen EF, Robinson BJ, Hospenthal DR, Aldous WK, Wolf SE, Chung KK, et al. Prevalence of multidrug-resistant organisms recovered at a military burn center. Burns 2010;36:819–25. Sengupta S, Kumar P, Ciraj AM, Shivananda PG. Acinetobacter baumannii – an emerging nosocomial pathogen in the burns unit Manipal, India. Burns 2001;27:140–4. Naiemi NA, Duim B, Savelkoul PH, Spanjaard L, de Jonge E, Bart A, et al. Widespread transfer of resistance genes between bacterial species in an intensive care unit: implications for hospital epidemiology. J Clin Microbiol 2005;43:4862–4. Soroush S, Haghi-Ashtiani MT, Taheri-Kalani M, Emaneini M, Aligholi M, Sadeghifard N, et al. Antimicrobial resistance of nosocomial strain of Acinetobacter baumannii in Children’s Medical Center of Tehran: a 6-year prospective study. Acta Med Iran 2010;48:178–84. Mugnier PD, Poirel L, Naas T, Nordmann P. Worldwide dissemination of the blaOXA-23 carbapenemase gene of Acinetobacter baumannii. Emerg Infect Dis 2010;16:35–40. Dent LL, Marshall DR, Pratap S, Hulette RB. Multidrug resistant Acinetobacter baumannii: a descriptive study in a city hospital. BMC Infect Dis 2010;10:196. Carneiro M, Barbosa PI, Vespero EC, Tanita MT, Carrilho CM, Perugini M, et al. Carbapenem-resistant OXA-23producing Acinetobacter baumannii isolates causing ventilator-associated pneumonia. Am J Infect Control 2010;38:667–9. Takahashi A, Yomoda S, Kobayashi I, Okubo T, Tsunoda M, Iyobe S. Detection of carbapenemase-producing Acinetobacter baumannii in a hospital. J Clin Microbiol 2000;38:526–9. Tien HC, Battad A, Bryce EA, Fuller J, Mulvey M, Bernard K, et al. Multi-drug resistant Acinetobacter infections in critically injured Canadian forces soldiers. BMC Infect Dis 2007;7:95. Schimith Bier KE, Luiz SO, Scheffer MC, Gales AC, Paganini MC, do Nascimento AJ, et al. Temporal evolution of carbapenem-resistant Acinetobacter baumannii in Curitiba, southern Brazil. Am J Infect Control 2010;38:308–14. Zarrilli R, Giannouli M, Tomasone F, Triassi M, Tsakris A. Carbapenem resistance in Acinetobacter baumannii: the molecular epidemic features of an emerging problem in health care facilities. J Infect Dev Ctries 2009;3:335–41.

1203

[29] Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother 2009;65:233–8. [30] Lin YC, Sheng WH, Chen YC, Chang SC, Hsia KC, Li SY. Differences in carbapenem resistance genes among Acinetobacter baumannii, Acinetobacter genospecies 3 and Acinetobacter genospecies 13TU in Taiwan. Int J Antimicrob Agents 2010;35:439–43. [31] Uma Karthika R, Srinivasa Rao R, Sahoo S, Shashikala P, Kanungo R, Jayachandran S, et al. Phenotypic and genotypic assays for detecting the prevalence of metallobeta-lactamases in clinical isolates of Acinetobacter baumannii from a South Indian tertiary care hospital. J Med Microbiol 2009;58:430–5. [32] Srinivasan VB, Rajamohan G, Pancholi P, Stevenson K, Tadesse D, Patchanee P, et al. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA. Ann Clin Microbiol Antimicrob 2009;8:21. [33] Papa A, Koulourida V, Souliou E. Molecular epidemiology of carbapenem-resistant Acinetobacter baumannii in a newly established Greek hospital. Microb Drug Resist 2009;15:257–60. [34] Lee K, Kim MN, Choi TY, Cho SE, Lee S, Whang DH, et al. Wide dissemination of OXA-type carbapenemases in clinical Acinetobacter spp. isolates from South Korea. Int J Antimicrob Agents 2009;33:520–4. [35] Yan ZQ, Shen DX, Cao JR, Chen R, Wei X, Liu LP, et al. Susceptibility patterns and molecular epidemiology of multidrug-resistant Acinetobacter baumannii strains from three military hospitals in China. Int J Antimicrob Agents 2009;35:269–73. [36] Marti S, Fernandez-Cuenca F, Pascual A, Ribera A, Rodriguez-Bano J, et al. Prevalence of the tetA and tetB genes as mechanisms of resistance to tetracycline and minocycline in Acinetobacter baumannii clinical isolates. Enferm Infecc Microbiol Clin 2006;24:77–80. [37] Park YK, Jung SI, Park KH, Cheong HS, Peck KR, Song JH, et al. Independent emergence of colistin-resistant Acinetobacter spp. isolates from Korea. Diagn Microbiol Infect Dis 2009;64:43–51. [38] Hernan RC, Karina B, Gabriela G, Marcela N, Carlos V, Angela F. Selection of colistin-resistant Acinetobacter baumannii isolates in postneurosurgical meningitis in an intensive care unit with high presence of heteroresistance to colistin. Diagn Microbiol Infect Dis 2009;65:188–91. [39] Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, et al. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother 2006;50:4114–23.