pISSN 2287-7991, eISSN 2287-8009 J. Prev. Vet. Med. Vol. 42, No. 1: 41-45, March 2018 https://doi.org/10.13041/jpvm.2018.42.1.41
Antimicrobial susceptibility of Staphylococcus hyicus isolated from Korean pigs with exudative epidermitis Jung-Eun Park1,2, Maheswaran Easwaran2, Jin-Woo Park2, Hyun-Jin Shin1,2† 1
Research Institute of Veterinary Medicine, College of Veterinary Medicine, Chungnam National University, Daejeon 34134, Republic of Korea Laboratory of Infectious Disease, College of Veterinary Medicine, Chungnam National University, Daejeon 34134, Republic of Korea
2
7)
Abstract: Exudative epidermitis (EE) is a generalized skin disease of pigs, mainly caused by Staphylococcus hyicus (S. hyicus). Antibiotic resistant S. hyicus leads to the failure of antimicrobial treatments. This necessitates proper identification of the strains in the field and determination of their antimicrobial susceptibility. This study was carried out to isolate Korean S. hyicus and determine its antimicrobial resistance. Isolate was sensitive to ceftiofur, ciprofloxacin, enrofloxacin, gentamicin, neomycin, and tylosin, but remarkably resistant to amoxicillin, lincomycin, penicillin, streptomycin, and tetracycline. Our study contributes to the understanding of the characteristics and antimicrobial resistance of Korean S. hyicus, which in turn will provide an antimicrobial treatment strategy to control EE. Key words: Staphylococcus hyicus, exudative epidermitis, greasy pig disease, antimicrobial resistance
Staphylococcus hyicus (S. hyicus) is one of the important pathogens associated with various diseases in animals [3]. It is responsible for EE, a skin disease in pigs, especially affecting piglets and weaners. In piglets, it causes crusts, vesicles, pustules, acanthosis, and reddening of the skin, which is associated with inflammation and excess sebaceous secretion [1, 6]. Morbidity and mortality of EE is 10 - 90% and 5 - 90%, respectively. It also causes arthritis, endometritis, dehydration in pigs; skin infection in horses, goats, cattle, and sepsis in humans [4, 6]. Importantly, porcine EE causes significant economic losses in pig-producing countries, such as Denmark, Germany, Japan, Switzerland, and Russia [2, 7]. Previously, numerous antimicrobial agents have been used for the treatment of S. hyicus. The development of resistance against many antimicrobial agents, such as erythromycin, penicillin, streptomycin, sulfonamides, tetracycline, and trimethoprim, has been observed and reported in swine industries [1]. Since the 1990s, the antimicrobial resistance has been reported as an uncontrolled problem, especially in treating pigs with EE because of the short list of antimicrobial agents available [8]. To identify potential antimicrobial agents for the Received 02 February 2018, Revised 16 March 2018, Accepted 20 March 2018 Corresponding Author. Hyun-Jin Shin, Tel: +82-42-821-6760, E-mail:
[email protected] Copyright © 2018 The Korean Society of Preventive Veterinary Medicine. The full text is freely available on the web at http://www.jpvm.kr/. †
treatment of porcine EE, we isolated a new strain of S. hyicus strain CNU-SH2010 from piglets exhibiting clinical and histopathological characteristics of EE and determined its antimicrobial resistance profile. Thirty-five days old piglets from a Korean farm were hospitalized with typical epidermitis symptoms, such as redness, scabs, and exudates. Initially, the biopsy samples were collected from clinical regions for the identification of pathogenic strains; then piglets were treated with an antibiotic complex from a Korean pharmaceutical company (PPS, Daesung Ltd, Korea) for one week, followed by Ivermectin (Ivomec, Merial Ltd, USA) for two days, and Enrofloxacin (Baytril 50, Bayer Ltd, Germany) for three days prior to confirming the S. hyicus strain. Finally, the ground samples were inoculated into devriese media and incubated at 37 ℃ for 24 h. Inoculum was spread onto nutrient agar plates and maintained in the same media. Various biochemical tests, including catalase, gelatinase, hemolysis, lactose, maltose, mannitol, nitrate reduction, Tw een 80 hydrolysis, and Voges-Proskauer tests were performed according to the manufacturer’s instructions to identify the species. For molecular analyses, the 16S ribosomal RNA (rRNA) and four exfoliative toxin genes (ExhA, ExhB, ExhC and ExhD) of S. hyicus were investigated among hospitaliz ed pigs by polymerase chain reaction (PCR), using AmpOne Taq premix kit (Gene All Biotechnology Co., LTD, Korea) and specific primers; for 16S rRNA, 16S rRNA-F: AGGATGAACG
42
Jung-Eun Park, Maheswaran Easwaran, Jin-Woo Park, Hyun-Jin Shin
CTGGCGGCGTGCCTAAT and 16S rRNA-R: CACCCCAATCAT TTGTCCCAC; for ExhA, ExhA-F: CTAATTCCGCAATGTCAAG TGAATCT and ExhA-R: AGGCTTACCCTTTTAGCAGATGG; for Ex hB, ExhB-F: GGAGGATCTATCATATTTAATTTC and ExhB-R: AATTCTATTTTCATAAAATCGGA; for ExhC, ExhC-F: AATTT TATAAAAATACTTGTTTTTATG and ExhC-R: GAAATAATAT ATAAAAAGAATCGA; for ExhD, ExhD-F: GAATTAGTGGTAT TCTAAATGGCA and ExhD-R: CGATTTCTTGGAGTTGTTACG GG. Cycling conditions were: an initial denaturation at 94°C for 5 min followed by 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 90 s, with an elongation of 10 min at 72°C. Finally, the PCR products were purified, using PCRpurification kit (GeneAll Biotechnology Co., Ltd., Seoul, Sout h Korea). The purified product was cloned into pGEM-T Easy vector (Promega, USA), and the sequence was analyzed via Basi c Local Alignment Search Tool (http://blast.ncbi.nlm.nih.gov/B last.cgi). Multiple-sequence alignments and phylogenetic anal ysis were carried out by Molecular Evolutionary Genetics Analysis version 6.06, with the help of maximum likelihood method, using 500 bootstrap replicates to estimate the stand ard errors [10].
Biopsy samples were collected from clinical regions for histopathological examination. The samples were fixed with formalin and prepared as 5-μm thick sections from paraffin-embedded tissue sample. Furthermore, the tissue sections were deparaffinized, using xylene and rehydrated with graded alcohols. All tissues were examined by light microscopy after staining with hematoxylin and eosin (H&E). The antimicrobial susceptibility test for S. hyicus was performed by the agar-disc-diffusion method according to the Clinical and Laboratory Standards Institute (CLSI) specifications. Following the McFarland nephelometer barium sulfate standards technique, the strain was diluted with saline to 10 6 colony-forming units per mL and spread on nutrient agar plates. The plates were incubated with various antibiotic discs listed in Table 1 at 37 ℃ for 12 h, and the diameter of the zone of inhibition was measured. The isolates were interpreted as sensitive and resistant according to the inhibition zone diameter based on CLSI recommendations. Typical epidermitis symptoms (e.g. skin redness and
Table 1. Antimicrobial susceptibility of Staphylococcus hyicus isolated from pigs with exudative epidermitis Antibiotics Ampicillin
Code
Disc potency (µg)
Susceptibility
Sourcesa
AM10
10
R
1
AM+C30
20/10
R
1
Ceftiofur
EFT30
30
S
1
Ciprofloxacin
CIP10
10
S
1
Colistin
CL10
10
R
1
Enrofloxacin
ENR5
5
S
3
Florfenicol
FFC30
30
R
1
Gentamicin
GM10
10
S
1
Lincomycin + Spectinomycin
LI+SP
15/200
R
2
Nitrofurantoin
F300
300
R
1
Neomycin
N30
3
S
1
Penicillin
P10
10 U
R
1
Amoxicillin + Clavulanic acid
Streptomycin
S10
10
R
1
Sulfamethoxazole + Trimethoprim
SXT
23.75/1.25
R
1
SP100
100
R
1
Spiramycin Tetracycline
T30
30
R
1
Tylosin
TYLOS
150
S
2
Tiamulin
TIAMU
30
R
2
Vancomycin
VA30
30
R
1
R, resistant; S, susceptible. a1, purchased from Becton Dickinson and Company (BD; USA); 2, purchased from Rosco (Denmark); 3, purchased from Bayer (Germany).
Antimicrobial susceptibility of Korean S. hyicus
exudates) of the hospitalized piglets were recorded. Oily exudate secretion from the eye and ear regions, as well as blackish brown colored scabs found generally all over the body, depression, and decreased food intake were observed (Fig. 1A). Histopathological studies showed that the affected pig skin contained various combinations of the following: minimal epidermal hyperplasia with elongation of rete ridges, a low number of hair follicles, mild edema with capillary dilatation, and inflammatory cell infiltration (Fig. 1B). Prior to confirmation of the strain, the pig was treated with an antibiotic complex for one week with no
43
response, followed by Ivermectin treatment for two days. The affected skin regions showed some improvement; however, the infection had spread over the face, neck, and valley regions by that time. Clinical and histopathological studies strongly indicated EE, and the history of treatment suggested resistance to antimicrobial agents. The EE is mainly caused by S. hyicus; but it can also be caused by other Staphylococcus strains. To identify the causative agents of the EE, biochemical and molecular analyses were performed. The isolate was biochemically positive for catalase, gelatinase, lactose, nitrate reduction,
Fig. 1. Clinical and histopathological examination of piglets. (A) Gross lesion of a piglet head (a) and whole body (b). (B) Histological examination of pig skin with exudative epidermitis. (a) H&E stained skin tissue with decreased number of hair follicle, shown at x40. (b) High magnification of boxed region in panel a, shown at x100. (c) High magnification of boxed region in panel b, shown at x 400. Arrow indicates mild edema with capillary dilatation. (d) Mild inflammatory cell infiltration around follicle, shown at x400. S, Sweat glands; H, Hair follicle.
44
Jung-Eun Park, Maheswaran Easwaran, Jin-Woo Park, Hyun-Jin Shin
tween 80 hydrolysis tests, and it was negative for hemolysis, maltose, mannitol, Voges Proskauer tests. These biochemical features were similar to those found in the previous reports on S. hyicus [4]. The sequence analysis revealed that the 16S rRNA has a maximum similarity (100%) to S. hyicus subspecies D. Sompolinsky (NR_036905) and some other Staphylococcus species (Fig. 2A)[9]. Exh gene sequences of the isolates also closely related to the recently reported Exh genes of the S. hyicus, as shown in Fig. 2B. The sequences were deposited in the Genbank database under the accession numbers S. hyicus 16S rRNA (KT008125), ExhA (KT072728), ExhB (KT072729), ExhC (KT072730) and ExhD (KT072731). As a result, the isolate was identified as S. hyicus. The proper selection of antibiotics can support the eradication of pathogenic strains [8]. Therefore, we focused the antimicrobial susceptibility assay on the S. hyicus isolate. As shown in Table 1, the Korean S. hyicus strain was susceptible to ceftiofur, ciprofloxacin, enrofloxacin, gentam icin, neom ycin, and tylosin. Of those, neom ycin
(3 µg/disc) and enrofloxacin (5 µg/disc) exhibited stronger antimicrobial activity than the other antibiotics. In previous studies, Cheville reported that the S. hyicus was sensitive to ampicillin, penicillin, streptomycin and tetracycline [5]. In addition, Wegener reported that the combinations of two antibiotics (lincomycin and spectinomycin) were the best active agents against virulent S. hyicus [11]. However, in our study, the isolates were resistant to ampicillin, colistin, florfenicol, nitrofurantoin, penicillin, streptomycin, spiramycin, tetracycline, tiamulin, vancomycin, and the combination of two compounds, such as amoxicillin-clavulanic acid, lincomycin-spectinomycin, sulfamethoxazole-trimethoprim. Overall susceptibility data showed that S. hyicus isolates had increased resistance for up to 72.73% of the antibiotics (16 out of 22), which is higher than the previous reports [8, 11]. In conclusion, we isolated and characterized S. hyicus which spreads around the Korean farms. The newly isolated S. hyicus strain CNU-SH2010 was highly resistant to several antibiotics that were commonly used for the
Fig. 2. Molecular examination of isolates (A) Phylogenetic inferences of 16S rRNA sequence among Staphylococcus spp. A phylogenetic tree of 16S rRNA sequence was constructed with the maximum likelihood (ML) method using a Tamura-Nei (TN) model distance matrix. (B) Dendrogram analysis of the exfoliative toxin (Exh) gene sequences from Staphylococcus. This dendrogram was constructed with the maximum likelihood (ML) method using a Tamura-Nei (TN) model distance matrix. Scale bar indicates the degree of divergence represented by a given length of the branch. ♦ indicates newly identified Korean strain S. hyicus CNU-SH2010 (16S rRNA (KT008125), ExhA (KT072728), ExhB (KT072729), ExhC (KT072730) and ExhD (KT072731).
Antimicrobial susceptibility of Korean S. hyicus
treatment of EE, and the overall resistance to antibiotics was much higher than the previously reported resistance among Staphylococcus strains. Our in vitro results indicated that neomycin and enrofloxacin are considered as the most promising agents for the control of invasive bacterial infection caused by S. hyicus.
ACKNOWLEDGEMENTS This work supported financially by a grant from Chungnam National University.
REFERENCES 1. Aarestrup FM, Jensen NB. Trends in antimicrobial susceptibility in relation to antimicrobial usage and presence of resistance genes in Staphylococcus hyicus isolated from exudative epidermitis in pigs. Vet Microbiol. 2002, 89:83-94. 2. Ahrens P, Andresen LO. Cloning and sequence analysis of genes encoding Staphylococcus hyicus exfoliative toxin types A, B, C, and D. J Bacteriol. 2004, 186:1833-1837. 3. Andresen LO, Ahrens P. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus. J Appl Microbiol. 2005, 96:1265-1270. 4. Chen S, Wang Y, Chen F, Yang H, Gan M, Zheng SJ. A highly pathogenic strain of Staphylococcus sciuri caused fatal exudative epidermitis in piglets. PLoS One. 2007, 2:e147.
45
5. Cheville NF, Tappe J, Ackermann M, Jensen A. Acute fibrinopurulent blepharitis and conjunctivitis associated with Staphylococcus hyicus, Escherichia coli, and Streptococcus sp. in chickens and turkeys. Vet Pathol. 1988, 25:369-375. 6. Foster AP. Staphylococcal skin disease in livestock. Vet Dermatol. 2012, 23:342-351. 7. Hassler Ch, Nitzsche S, Iversen C, Zweifel C, Stephan R. Characteristics of Staphylococcus hyicus strains isolated from pig carcasses in two different slaughter houses. Meat Sci. 2008, 80:505-510. 8. Park JH, Robert M, Friendship P, Weese JS, Dewey CE. An investigation of exudative epidermitis (greasy pig disease) and antimicrobial resistance patterns of Staphylococcus hyicus and Staphylococcus aureus isolated from clinical cases. Can Vet J. 2013, 54:139 – 144. 9. Takahashi T, Kaneko M, Mori Y, Tsuji M, Kikuchi N, Hiramune T. Phylogenetic analyses of Staphylococcus based on the 16S rDNA sequence and assignment of clinical isolates from animals. J Vet Med Sci. 1997, 59:775-783. 10. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013, 30:2725-2729. 11. Wegener HC, Watts JL, Salmon SA, Yancey RJ Jr. Antimicrobial susceptibility of Staphylococcus hyicus isolated from exudative epidermitis in pigs. J Clin Microbiol. 1994, 32:793-795.
