Aptamers and Aptasensors for Highly Specific Recognition and ... - MDPI

toxins Review

Aptamers and Aptasensors for Highly Specific Recognition and Sensitive Detection of Marine Biotoxins: Recent Advances and Perspectives Lianhui Zhao 1 , Yunfei Huang 1 , Yiyang Dong 2 , Xutiange Han 1 , Sai Wang 1, * and Xingguo Liang 1,3 1

2 3

*

College of Food Science and Engineering, Ocean University of China, Qingdao 266003, China; [email protected] (L.Z.); [email protected] (Y.H.); [email protected] (X.H.); [email protected] (X.L.) College of Life Science and Technology, Beijing University of Chemical Technology, Beijing 100029, China; [email protected] Laboratory for Marine Drugs and Bioproducts of Qingdao National Laboratory for Marine Science and Technology, Qingdao 266000, China Correspondence: [email protected]; Tel.: +86-0532-8203-1318

Received: 28 September 2018; Accepted: 22 October 2018; Published: 25 October 2018







Abstract: Marine biotoxins distribute widely, have high toxicity, and can be easily accumulated in water or seafood, exposing a serious threat to consumer health. Achieving specific and sensitive detection is the most effective way to prevent emergent issues caused by marine biotoxins; however, the previous detection methods cannot meet the requirements because of ethical or technical drawbacks. Aptamers, a kind of novel recognition element with high affinity and specificity, can be used to fabricate various aptasensors (aptamer-based biosensors) for sensitive and rapid detection. In recent years, an increasing number of aptamers and aptasensors have greatly promoted the development of marine biotoxins detection. In this review, we summarized the recent aptamer-related advances for marine biotoxins detection and discussed their perspectives. Firstly, we summarized the sequences, selection methods, affinity, secondary structures, and the ion conditions of all aptamers to provide a database-like information; secondly, we summarized the reported aptasensors for marine biotoxins, including principles, detection sensitivity, linear detection range, etc.; thirdly, on the basis of the existing reports and our own research experience, we forecast the development prospects of aptamers and aptasensors for marine biotoxins detection. We hope this review not only provides a comprehensive summary of aptamer selection and aptasensor development for marine biotoxins, but also arouses a broad readership amongst academic researchers and industrial chemists. Keywords: marine biotoxin; aptamer; aptasensor; rapid detection; food safety Key Contribution: Advances of aptamer selection and aptasensor development for marine biotoxins were summarized and their development prospects were forecast.

1. Introduction Marine biotoxins, also known as algal biotoxins, are a large and diverse group of highly active metabolites from marine organisms, and can be accumulated at a high level in water or seafood via the food chain. More than 1000 kinds of marine biotoxins have been identified, and they are classified into three categories; i.e., polyether toxins, polypeptide toxins, and alkaloid toxins, according to the difference of their chemical structures [1–4]. For example, okadaic acid (OA) is a typical polyether toxin, and the well-known tetrodotoxin (TTX) is classed as one of the alkaloid toxins. Most of the Toxins 2018, 10, 427; doi:10.3390/toxins10110427

www.mdpi.com/journal/toxins

Toxins 2018, 10, 427

2 of 26

marine biotoxins have high toxicity. They usually act on some key target sites of the cell membrane such as neural receptors or ion channels [5], causing symptoms such as dizziness, vomiting, diarrhea, muscle pain, heart failure, and even death within a few minutes [6–9]. For example, TTX at low dose of 0.5~3 mg can make an adult die of poisoning, because TTX can block Na+ channels on nerve cell membranes selectively and further leads to nerve paralysis, respiratory failure, and finally death [10–12]. Achieving specific and sensitive screening is the most effective way to prevent emergent issues caused by marine biotoxins; however, the previous detection methods cannot meet the requirements because of ethical or technical drawbacks. Cytotoxicity-based mouse bioassay is standardized for testing overall marine toxin toxicity [13], according to the survival time of mice and the poisoning symptoms after injection; however, the mouse bioassay receives much ethical criticism and has technical drawbacks, including poor specificity, high cost, and high variability [14–18]. Some other alternative methods, such as thin-layer chromatography and phosphatase activity inhibition are easy to be operated; however, these methods exhibit low specificity and limited applicability [19–22]. High performance liquid chromatography (HPLC) and HPLC-mass spectrometry (HPLC-MS) are believed to be interchangeable with mouse bioassay [23–28], as HPLC and HPLC-MS can distinguish the toxin structure accurately and achieve accurate quantitation; however, these methods require professional instrumentation and the analysis process is time-consuming, not suitable for on-site monitoring. Enzyme linked immunosorbent assay (ELISA) and other antibody-related immunosensors then attract much interest because of the high specificity based on the specific antibody-antigen interaction [29–34]; however, these methods have limited availability. Because many marine biotoxins are low weight molecules and have high toxicity, the antibody production needs complicated steps and high cost. Additionally, antibodies are easily denatured and thus may result in the low repeatability of the detection methods. Given the varieties of drawbacks of these previous analytical methods, it is urgent and significant to explore novel recognition elements and detection methods, which can achieve rapid, cost effective, highly specific, and highly sensitive screening. Recently, aptamers and aptasensors emerged as novel and potential tools for rapid detection [35–38]. Aptamers can be selected in vitro based on Systematic Evolution of Ligands by Exponential Enrichment (SELEX) [39,40], with high affinity and specificity and with no limitation to the target size [41,42]. The highly specific binding between aptamers and the targets are mainly based on adaptive folding of aptamers under specific ion condition to form specific three-dimensional structures containing hair folds, pseudoknots, convex rings, G-quartets, etc. [38,43]. Compared with antibodies, aptamers show significant advantages in terms of low generation cost, quick chemical synthesis, and the excellent batch unity. Moreover, aptamers have similar or even higher specificity than antibodies [44–46], for example, the aptamers can even distinguish chiral molecules and analogs that have a little structural difference, such as the L and D-amino acid [46,47]. Aptamers are easily labeled and fabricated into various aptasensors to achieve rapid, sensitive, and specific detection [48–50]. In recent years, an increasing number of highly specific aptamers and highly sensitive aptasensors have been reported. The selected aptamer shows high affinity and specificity, and most of the developed aptasensors are simple to be performed with miniaturized instruments to achieve on-site monitoring of marine biotoxins. The advances of aptamers and aptasensors greatly promote the development of marine biotoxins detection, and thus it is necessary to provide a summary of the recent advances. In this review, we summarized the aptamer-related advances for marine biotoxin to provide a comprehensive summary of aptamer selection and aptasensor development for marine biotoxins, including the detailed information of each aptamer and each kind of aptasensor. All of the reported literatures on aptamer-based research we could find are present herein. Moreover, we forecast the development prospect of aptamers and aptasensors targeting marine biotoxins, based on the existing reports and our own research experience. We hope this review not only provides a comprehensive summary of the recent advances, but also arouses a broad readership amongst academic researchers and industrial chemists. To the best of our knowledge, only two Review papers concerning

Toxins 2018, 10, x FOR PEER REVIEW Toxins 2018, 10, 427

3 of 26 3 of 26

academic researchers and industrial chemists. To the best of our knowledge, only two Review papers concerning aptasensors and marine biotoxins have been published so far. In 2018, Bostan et aptasensors andamarine have and beenelectrochemical published so far. In 2018, Bostan et al. summarized al. summarized reviewbiotoxins about optical aptasensors for detection of a kind of amarine reviewbiotoxin about optical electrochemical aptasensors for detection of a for kindone of marine called and microcystin-LR (MC-LR) [51]. Only aptasensors kind ofbiotoxin marine called microcystin-LR [51]. Also Onlyinaptasensors foretone of marine MC-LR, biotoxin, MC-LR, were(MC-LR) introduced. 2018, Cunha al. kind summarized thebiotoxin, aptasensors for were introduced. Alsoand in 2018, Cunha et[52]. al. summarized the aptasensors for aquatic phycotoxins aquatic phycotoxins cyanotoxins Some aptasensors and aptamers sequences used in and the cyanotoxins aptasensors and aptamers sequencesmethods used in the were summarized; aptasensors [52]. wereSome summarized; however, the selection of aptasensors the aptamers, the secondary however, thethe selection methods of the aptamers, the secondary structure of thewere aptamers, and the structure of aptamers, and the specific ion conditions for aptamer folding not involved, specific ion conditions for aptamer folding were not involved, and manywere newlynot published papers about and many newly published papers about aptasensor development included. From the aptasensor were not included.ofFrom the point view ofresearches a comprehensive summary of the point view development of a comprehensive summary the aptamer-related for marine biotoxins, it aptamer-related researches marineabiotoxins, it is better and necessary to provide a more is better and necessary to for provide more systematic review, which should include thesystematic aptamer review, which should include the aptamer detailed information of each aptamer, and each selection, the detailed information of eachselection, aptamer,the and each kind of aptasensor. kind of aptasensor. 2. Aptamers Targeting Marine Biotoxins 2. Aptamers Targeting Marine Biotoxins The selection principle of aptamers (SELEX principle) is summarized first. The detailed The selection principle of aptamers (SELEX in principle) summarized first. viewpoints The detailedare information information of each aptamer is summarized Table 1.is Our summative listed in of each aptamer is summarized in Table 1. Our summative viewpoints are listed in Section 2.2. Section 2.2. 2.1. Selection Principle of Aptamers (SELEX Principle) 2.1. Selection Principle of Aptamers (SELEX Principle) Before summarizing the aptamers that target marine biotoxins, the selection principle of Before summarizing the aptamers that target marine biotoxins, the selection principle of aptamers The SELEX SELEX process process is is carried carried out out in in vitro, aptamers is is introduced introduced herein. herein. The vitro, with with aa relatively relatively simple simple and economical principle [39,40,53]. As shown in Figure 1, the whole SELEX processincludes mainly and economical principle [39,40,53]. As shown in Figure 1, the whole SELEX process mainly includes the following (1) Synthesis of a single-stranded oligonucleotide (2)selection, Positive the following parts: (1) parts: Synthesis of a single-stranded oligonucleotide library; (2)library; Positive selection, including incubation of the library and the targets, partition of the oligonucleotides-target including incubation of the library and the targets, partition of the oligonucleotides-target complex complex the unbound oligonucleotides, and elution of the boundoligonucleotides oligonucleotidesfrom from the and the and unbound oligonucleotides, and elution of the bound the oligonucleotides-target complex;(3) (3)Negative Negative[54] [54]ororcounter counterselection selection [55], including incubation oligonucleotides-target complex; [55], including incubation of of bound oligonucleotides obtained from (2) with negative matrix or analogues oftargets, the targets, thethe bound oligonucleotides obtained from (2) with negative matrix or analogues of the and and partition of the oligonucleotides-target complexand andunbound unbound oligonucleotides; oligonucleotides; (4) (4) PCR partition of the oligonucleotides-target complex PCR amplification amplification of of the the unbound unbound oligonucleotides oligonucleotides obtained obtained from from (3); (3); (5) (5) Repetition Repetition of of the the above above process process so dodo notnot bindbind to the or have affinity to the targets aretargets discarded so that thatoligonucleotides oligonucleotidesthat that totargets the targets orlow have low affinity to the are away gradually, while those having high affinity can be selected with purity increment in each discarded away gradually, while those having high affinity can be selected with purity increment in round [35,56]. AfterAfter several rounds of selection, the last DNADNA pool pool is amplified by PCR each round [35,56]. several rounds of selection, theenriched last enriched is amplified by and sequenced, the affinity of the potential aptamers is analyzed, and the aptamer with highest PCR and sequenced, the affinity of the potential aptamers is analyzed, and the aptamer with affinity finallyisobtained. Usually, a matrix (X) is needed in needed the process (2) process and (3) to highest is affinity finally obtained. Usually, a matrix (X) is in the (2)achieve and (3)the to partition, and the process is thus named as X-SELEX, such as Beads-SELEX [57], Graphene-SELEX achieve the partition, and the process is thus named as X-SELEX, such as Beads-SELEX [57], (GO-SELEX) [58], and so on. [58], and so on. Graphene-SELEX (GO-SELEX)

Figure 1. Principle of aptamer selection (SELEX process).

Toxins 2018, 10, 427

4 of 26

Toxins 2018, 10, x FOR PEER REVIEW

4 of 26

2.2. Detailed Information of Aptamers Targeting for Marine Biotoxins 2.2. Detailed Information of Aptamers Targeting for Marine Biotoxins In recent years, an increasing number of aptamers targeting marine biotoxins have been selected. In recent years, an increasing isnumber of aptamers marine have been Detailed database-like information summarized in Tabletargeting 1. The target, thebiotoxins name, the selection selected. Detailed database-like information is summarized in Table 1. The target, the name, the method, the sequence, and the affinity of each aptamer are listed in detail. Moreover, as the high selection method, the sequence, and the affinity of each aptamer are listed in detail. Moreover, as specific recognition of the aptamers is based on their adaptive folding, we predicted and added the the high specific recognition of the aptamers based on theirwas adaptive weanpredicted and secondary structure of each aptamer in Table 1.isThe prediction carriedfolding, out using Mfold online added the secondary structure of each aptamer in Table 1. The prediction was carried out using an server, based on the specific folding condition of each aptamer. Mfold online server,are based on the specific folding condition of each aptamer. The following several summative points based the analysis of the literature review: The following are several summative points based the analysis of the literature review: (a) Firstly, aptamers have drawn much attention in the field of marine biotoxins in recent years. (a) Firstly, aptamers have drawn much attention in the field of marine biotoxins in recent years. According to our investigation, there have been 15 novel aptamers reported, covering all of According to our investigation, there have been 15 novel aptamers reported, covering all of the the three categories of marine biotoxins. Among the targets shown in Table 1, palytoxin three categories of marine biotoxins. Among the targets shown in Table 1, palytoxin (PTX) and (PTX) and okadaic acid (OA) are polyether toxins; brevetoxin-2 (BTX-2) and microcystin okadaic acid (OA) are polyether toxins; brevetoxin-2 (BTX-2) and microcystin (MC) are (MC) are polypeptide toxins; and tetrodotoxin (TTX), saxitoxin (STX), anatoxin-a (ATX-a), polypeptide toxins; and tetrodotoxin (TTX), saxitoxin (STX), anatoxin-a (ATX-a), and and gonyautoxin1/4 (GTX1/4) are alkaloid toxins. And all of the aptamers were reported gonyautoxin1/4 (GTX1/4) are alkaloid toxins. And all of the aptamers were reported after 2012, after 2012, and 50% of them were successfully selected after 2015. This indicates a high level of and 50% of them were successfully selected after 2015. This indicates a high level of academic academic attention on the aptamers for marine biotoxins. attention on the aptamers for marine biotoxins. (b) Secondly, most aptamers targeting marine biotoxins were selected using beads-SELEX or (b) Secondly, most aptamers targeting marine biotoxins were selected using beads-SELEX or magnetic-beads-SELEX (Mag-beads-SELEX), and most of the selection were finished within magnetic-beads-SELEX (Mag-beads-SELEX), and most of the selection were finished within no no more than 20 rounds. The marine biotoxins were immobilized onto the surface of beads or more than 20 rounds. The marine biotoxins were immobilized onto the surface of beads or magnetic-beads. The surface with a spherical shape facilitates the full display of the targets on magnetic-beads. The surface with a spherical shape facilitates the full display of the targets on the beads and beads facilitate the convenient separation [59,60]. Figure 2 illustrates the partition the beads and beads facilitate the convenient separation [59,60]. Figure 2 illustrates the and elution process of the positive selection part in the Mag-beads-SELEX. After the incubation partition and elution process of the positive selection part in the Mag-beads-SELEX. After the of the target-immobilized magnetic beads with the oligonucleotides in the library, the partition incubation of the target-immobilized magnetic beads with the oligonucleotides in the library, of the oligonucleotides-beads complex from the unbound oligonucleotides and the elution of the partition of the oligonucleotides-beads complex from the unbound oligonucleotides and the bound oligonucleotides from the oligonucleotides-beads are both achieved using the magnetic elution of bound oligonucleotides from the oligonucleotides-beads are both achieved using the separation. The procedure of the beads-SELEX is similar, and the only difference is the partition magnetic separation. The procedure of the beads-SELEX is similar, and the only difference is of the beads and the supernatant is based on centrifugal separation. the partition of the beads and the supernatant is based on centrifugal separation.

Figure 2. Procedure of positive selection process in Mag-beads-SELEX.

Toxins 2018, 10, 427

5 of 26 Toxins 2018, 2018, 10, 10, xx FOR FOR PEER PEER REVIEW REVIEW Toxins Toxins 2018, 10, x FOR REVIEW Toxins 2018, 10, x FOR PEER PEER REVIEW

of 26 26 555 of 5 of of 26 26

Table 1. Detailed information of the aptamers selected for marine biotoxins.

Num.

Target

1

Palytoxin (PTX) C1

2

Okadaic acid (OA) C1

3

Brevetoxin 2 (BTX-2) C2

Aptamer Num. Name Target Target Num. Num. Target Target Num.

111 1

Table 1. 1. Detailed Detailed information information of of the the aptamers aptamers selected selected for for marine marine biotoxins. biotoxins. Table Table Table 1. 1. Detailed Detailed information information of the the aptamers aptamers selected for marine biotoxins. Affinity 0) Affinity Aptamer Affinity Aptamer Secondary Selection Method Selection Year (50 –3 Affinity Aptamer Selection Method Year Sequence Sequence (5′–3′) Secondary Structure Structure Affinity Aptamer Year Sequence Secondary (Kd, nM) Selection Method Method Year Sequence (5′–3′) (5′–3′) Secondary Structure Structure Name (Kd, nM) Selection Method Year Sequence (5′–3′) Secondary Structure Name (Kd, nM) Name Name

(Kd, (Kd, nM) nM)

222 2

333 3

Brevetoxin 22 Brevetoxin Brevetoxin BrevetoxinC222 BT10(BTX-2) (BTX-2) C2 C2 (BTX-2) C2 C2 (BTX-2)

OA34 OA34 Beads-SELEX OA34 OA34

BT10

BT10 BT10 Beads-SELEX BT10

Ref.

20 mM mM Tris, Tris, 100 100 mM mM NaCl, NaCl, 20 20 mM 100 mM NaCl, 20 mM Tris, 100 mM NaCl, 20 mMTris, Tris, 100 mM NaCl, [61] mM MgCl MgCl22,, 55 mM mM KCl, KCl, 222 mM [61] mM MgCl 2,, 5 5 mM KCl, [61] 2 mM MgCl 2 mM KCl, [61] 2 mM MgClpH mM KCl, pH 7.5 2 , 257.5 pH 7.5 pH 7.5 pH 7.5

[61]

Condition Condition Condition Condition

Ref. Ref.

GGAGGTGGTGGG GGAGGTGGTGGG GGAGGTGGTGGG GGAGGTGGTGGG GGAGGTGGTGGG GACTTTGCTTGTA GACTTTGCTTGTA GACTTTGCTTGTA GACTTTGCTTGTA 2017 GACTTTGCTTGTA 2017 2017CTGGGCGCCCGG CTGGGCGCCCGGT 2017 CTGGGCGCCCGGT CTGGGCGCCCGGT CTGGGCGCCCGGT TGAA TTGAA TGAA TGAA TGAA

84.3 84.3 84.3 84.3 84.3

Beads-SELEX Beads-SELEX 2013 Beads-SELEX Beads-SELEX

GGTCACCAACAA GGTCACCAACAA GGTCACCAACAA GGTCACCAACAA GGTCACCAACAA CAGGGAGCGCTA CAGGGAGCGCTA CAGGGAGCGCTA CAGGGAGCGCTA CAGGGAGCGCTA 2013 CGCGAAGGGTCA 2013 CGCGAAGGGTCA 2013 CGCGAAGGGTCA 2013CGCGAAGGGTCA CGCGAAGGGTCA ATGTGACGTCATG ATGTGACGTCATG ATGTGACGTCATG ATGTGACGTCATG ATGTGACGTCATG CGGATGTGTGG CGGATGTGTGG CGGATGTGTGG CGGATGTGTGG CGGATGTGTGG

77 77 77 77 77

50 mM Tris, 150 mM NaCl, 50 150 mM NaCl, 50mM mMTris, Tris, 150 mM NaCl, [62] 50 mM Tris, 150 mM NaCl, [62] 50 mM Tris, 150 mM NaCl, [62] mM MgCl pH 7.5 [62] 2222mM 22,, pH 7.5 mMMgCl MgCl MgCl 22,, pH 7.5 2 , pH mM MgCl 7.5 7.5 2 mM 2 pH

[62]

Beads-SELEX Beads-SELEX Beads-SELEX 2015 Beads-SELEX

GGCCACCAA GGCCACCAAACC GGCCACCAAACC GGCCACCAAACC GGCCACCAAACC ACCACACCGTC ACACCGTCGCAA ACACCGTCGCAA ACACCGTCGCAA ACACCGTCGCAA 2015GCAACCGCGAG CCGCGAGAACCG 2015 CCGCGAGAACCG 2015 CCGCGAGAACCG 2015 CCGCGAGAACCG AACCGAAGTAGT AAGTAGTGATCAT AAGTAGTGATCAT AAGTAGTGATCAT AAGTAGTGATCAT GATCATGTCCCTG GTCCCTGCGTG GTCCCTGCGTG GTCCCTGCGTG GTCCCTGCGTG CGTG

92 92 92 92 92

50 mM mM Tris, Tris, 10 10 mM mM MgCl MgCl22,, 50 50 mM Tris, 1010 mM MgCl 50mM mMTris, Tris, mM MgCl [63] 50 10 mM MgCl 222,, 2 , [63] [63] pH 7.5 7.5 [63] pH pH 7.57.5 pH 7.5 pH

[63]

Palytoxin Palytoxin PTX-13 Mag-beads-SELEX Palytoxin PTX-13Palytoxin Mag-beads-SELEX 2017 PTX-13 Mag-beads-SELEX C1 PTX-13 Mag-beads-SELEX (PTX)C1 PTX-13 Mag-beads-SELEX (PTX) C1 C1 (PTX) (PTX)C1

Okadaic acid acid Okadaic Okadaic acid acid Okadaic OA34 C1 (OA) C1 (OA) C1 (OA) C1 (OA) C1

Folding Reference Folding Reference Folding Reference ConditionRef. Folding Reference Ref. Folding Reference

GAGGCAGCACTTC GAGGCAGCACTTC

4

Brevetoxin 2 (BTX-2) C2

444 4

Brevetoxin 22 Brevetoxin Brevetoxin Bap5 Microwell-SELEX BrevetoxinC222 Bap5 Microwell-SELEX Bap5 Microwell-SELEX (BTX-2) C2 Bap5 Microwell-SELEX C2 Bap5(BTX-2) 2016 C2 Microwell-SELEX (BTX-2) C2 (BTX-2)

GAGGCAGCACTTC GAGGCAGCACTTC GAGGCAGCACTTC ACACGATCTGTGA ACACGATCTGTGA ACACGATCTGTGA ACACGATCTGTGA ACACGATCTGTGA AGTTTTTGTCATG AGTTTTTGTCATG AGTTTTTGTCATG AGTTTTTGTCATG AGTTTTTGTCATGG 2016 GTTTGGGGGTGGT 2016 GTTTGGGGGTGGT 2016 GTTTGGGGGTGGT 2016 GTTTGGGGGTGGT TTTGGGGGTGGTAG AGGGGTGTTGTCT AGGGGTGTTGTCT AGGGGTGTTGTCT AGGGGTGTTGTCT GGGTGTTGTCTGC GCGTAATGACTGT GCGTAATGACTGT GCGTAATGACTGT GCGTAATGACTGT GTAATGACTGTAG AGAGATG AGAGATG AGAGATG AGAGATG AGATG

Microcystin-LR Microcystin-LR Microcystin-LR AN6 AN6 Microcystin-LR C2 AN6 (MC-LR) C2 AN6 AN6(MC-LR) Beads-SELEX C2 (MC-LR) C2 C2 (MC-LR)

GGCGCCAAACAG GGCGCCAAACAG GGCGCCAAACAGG GACCACCATGAC GACCACCATGAC GACCACCATGAC GACCACCATGAC ACCACCATGACAAT 2012 AATTACCCATACC 2012 AATTACCCATACC 2012 AATTACCCATACC 2012 AATTACCCATACC TACCCATACCACCT ACCTCATTATGCC ACCTCATTATGCC ACCTCATTATGCC ACCTCATTATGCC CATTATGCCCCATCT CCATCTCCGC CCATCTCCGC CCATCTCCGC CCATCTCCGC CCGC

20 mM mM Hepes, Hepes, 120 120 mM mM 20

4830 4830 4830 4830 4830

20 mM mM Hepes, Hepes, 120mM mMNaCl, 5 20 120 mM 20 mM 120 [64] NaCl,Hepes, mM KCl, mM [64] NaCl, 555 mM 111 mM [64] NaCl, mM 1KCl, KCl, mM , [64] NaCl, 5KCl, mM KCl, 1 CaCl mM mM mM 2 2 , 1 mM MgCl CaCl 2, 1 mM MgCl22 CaCl mMMgCl MgCl222 CaCl 11 mM MgCl CaCl1222,, mM 2

[64]

GGCGCCAAACAG GGCGCCAAACAG

5

Microcystin-LR 5555 (MC-LR) C2

Beads-SELEX Beads-SELEX Beads-SELEX Beads-SELEX

2012

50 50 50 50 50

50 mM Tris, Tris, 150 mM mM NaCl, 50 50 mM mM Tris, Tris, 150 150 mM mM NaCl, NaCl, [65] 50 150 NaCl, 50mM mM mM [65] 2, pH 7.5 7.5 NaCl, [65] mMTris, MgCl150 [65] 222 mM pH 7.5 7.5 mM MgCl MgCl2222,,, pH pH 2 mM MgCl

2 mM MgCl2 , pH 7.5

[65]

Toxins 2018, 10, 427

6 of 26

Table 1. Cont. Toxins 2018, ToxinsAptamer 2018, 10, 10, xx FOR FOR PEER PEER REVIEW REVIEW Toxins 2018, 10, x FOR PEER REVIEW Selection Method Num. Target Toxins 2018, 10, x FOR PEER REVIEW Name

6 6

7 7

9 9

10 10

11

11

Year

Sequence (50 –30 )

Affinity (Kd, nM)

Secondary Structure

66 of of 26 26

6 of 26 Folding Reference Condition 6 of 26

Ref.

66 Microcystin-LA Microcystin-LA 6 C2 (MC-LA) (MC-LA) C2

CACGCACAGAAG CACGCACAGAAG CACGCACAGAAG CACGCACAGAAG CACGCACAGAAG ACACCTACAGGG ACACCTACAGGG Microcystin-LA ACACCTACAGGGC ACACCTACAGGG Microcystin-LA ACACCTACAGGG RC4 Beads-SELEX 2012 Microcystin-LA RC4 Beads-SELEX 2012 CCAGATCACAATC CCAGATCACAATC C2 C2 (MC-LA) RC4 Beads-SELEX 2012 CAGATCACAATC RC4 Beads-SELEX 2012 CCAGATCACAATC (MC-LA) C2Beads-SELEX RC4(MC-LA) C2 2012 CCAGATCACAATC 76 GGTTAGTGAACTC C2 GGTTAGTGAACTC GGTTAGTGAACT GGTTAGTGAACTC GGTTAGTGAACTC GTACGGCGCG GTACGGCGCG CGTACGGCGCG GTACGGCGCG GTACGGCGCG

76 76 76 76

50 50 mM mM Tris, Tris, 150 150 mM mM NaCl, NaCl, 50mM mMTris, Tris, 150 mM NaCl, [65] 50 150 mM NaCl, [65] 50 mM Tris, 150 mM NaCl, 22 mM MgCl [65] mM MgCl222,, pH pH 7.5 7.5 [65] 2 mM MgCl , pH 7.5 2 mM MgCl 22, pH 7.5 2 2 mM MgCl2, pH 7.5

[65]

7 Microcystin-YR Microcystin-YR 777 C2 (MC-YR) (MC-YR) C2

GGACAACATAGG GGACAACATAGG GGACAACATAGG GGACAACATAGG GGACAACATAGG GGACAACATAGG AAAAAGGCTCTG AAAAAGGCTCTG Microcystin-YR AAAAAGGCTCTG Microcystin-YR AAAAAGGCTCTG AAAAAGGCTCTG AAAAAGGCTCTG HC1 Beads-SELEX 2012 CTACCGGATCCCT Microcystin-YR HC1 Beads-SELEX 2012 CTACCGGATCCCT Microcystin-YR C2 C2 (MC-YR) HC1 Beads-SELEX 2012 CTACCGGATCCCT (MC-YR) C2 HC1 Beads-SELEX 2012 CTACCGGATCCCT HC1 Beads-SELEX 2012 CTACCGGATCCCT C2Beads-SELEX HC1(MC-YR) 2012 CTACCGGATCCCT 193 GTTGTATGGGCAT GTTGTATGGGCAT (MC-YR) C2 GTTGTATGGGCAT GTTGTATGGGCAT GTTGTATGGGCATGTTGTATGGGCATA ATCTGTTGAT ATCTGTTGAT ATCTGTTGAT ATCTGTTGAT TCTGTTGAT ATCTGTTGAT

193 193 193 193 193

50 50 mM mM Tris, Tris, 150 150 mM mM NaCl, NaCl, 50 Tris, 150 mM NaCl, [65] 50mM Tris, 150 mM NaCl, [65] 50 mM Tris, 150 mM NaCl, 50 mM Tris, 150 mM NaCl, 22mM mM MgCl [65] pH 7.5 7.5 mM MgCl222,,, pH [65] [65] 7.5 222mM MgCl 22, pH mMMgCl MgCl pH 7.5 7.5 mM 2 , pH 2 mM MgCl2, pH 7.5

[65]

AAAAATTTCACAC AAAAATTTCACAC AAAAATTTCACAC AAAAATTTCACAC AAAAATTTCACAC Truncation 2012 GGGTGCCTCGGCT Truncation 2012 GGGTGCCTCGGCT Truncation 2012 GGGTGCCTCGGCT 2012 GGGTGCCTCGGC 2012 GGGTGCCTCGGCT N/AGTCC GTCC GTCC TGTCC GTCC

N/A N/A N/A N/A

250 250 mM mM NaCl, NaCl, 11 mM mM 250 mM NaCl, 1 mM 1 250 mM NaCl, 1 mM MgCl 22,, 0.1 mM MgCl 0.1 mM 1EDTA, EDTA, 1 250 mM NaCl, mM MgCl , 2[66,67] MgCl 222, 0.1 mM EDTA, 1 [66,67] MgCl2, 0.1 mM EDTA, 1mM 20 mM DTT, 20 mM mM Tris-HCl, Tris-HCl, 0.1 DTT, mM EDTA, 1 mM DTT,[66,67] [66,67] mM DTT, 20 mM Tris-HCl, mM DTT, 20 mM Tris-HCl, 7.5 pH 7.5 20 mMpH Tris-HCl, pH 7.5 pH 7.5 pH 7.5

GGGAGCTCAGAA GGGAGCTCAGAA GGGAGCTCAGA GGGAGCTCAGAA GGGAGCTCAGAA TAA TAA ACGCTCAAC ACGCTCAAC ATAAACGCTCAA TAA ACGCTCAAC TAA ACGCTCAAC CCTGCCGGGGGCT CCTGCCGGGGGCT Tetrodotoxin CCCTGCCGGGGG CCTGCCGGGGGCT Tetrodotoxin CCTGCCGGGGGCT A3 Beads-SELEX 2014 TCTCCTTGCTGCT Tetrodotoxin A3 Beads-SELEX 2014 TCTCCTTGCTGCT C3 (TTX) A3 Beads-SELEX 2014 A3 2014CTTCTCCTTGCTG TCTCCTTGCTGCT (TTX) C3 C3 Beads-SELEX A3 (TTX) 2014Beads-SELEX TCTCCTTGCTGCT N/A C3 CTGCTCTGTTCGA C3 CTGCTCTGTTCGA CTCTGCTCTGTTCG CTGCTCTGTTCGA CTGCTCTGTTCGA CATGAGGCCCGG CATGAGGCCCGG ACATGAGGCCCG CATGAGGCCCGG CATGAGGCCCGG ATC ATC GATC ATC ATC

N/A N/A N/A N/A

GGTATTGAGGGTC GGTATTGAGGGTC GGTATTGAGGGTC GGTATTGAGGGTC GGTATTGAGGGTC GGTATTGAGGGTC GCATCCCGTGG GCATCCCGTGGAA GCATCCCGTGGAA GCATCCCGTGGAA GCATCCCGTGGAA GCATCCCGTGGAA Saxitoxin (STX) ACATGTTCATTGG Saxitoxin (STX) ACATGTTCATTGG Saxitoxin AAACATGTTCATT STX STX APT 11 Mag-beads-SELEX 2013 (STX) ACATGTTCATTGG APTSTX 11 APTSaxitoxin Mag-beads-SELEX 2013 GCGCACTCCGCTT Mag-beads-SELEX 2013 Saxitoxin ACATGTTCATTGG C3 STX Saxitoxin (STX) ACATGTTCATTGG C3 STX C3 (STX) APT 11 Mag-beads-SELEX 2013 GCGCACTCCGCTT (STX) APTSTX 11 APTSTX C3 Mag-beads-SELEX 2013GGGCGCACTCCG C3 Mag-beads-SELEX 2013 3840 GCGCACTCCGCTT C3 C3 GCGCACTCCGCTT GCGCACTCCGCTTCTTTCTGTAGATGG TCTGTAGATGGCT TCTGTAGATGGCT TCTGTAGATGGCT TCTGTAGATGGCT TCTGTAGATGGCT CTAACTCTCCTCT CTAACTCTCCTCT CTCTAACTCTCCTCT CTAACTCTCCTCT CTAACTCTCCTCT CTAACTCTCCTCT

3840 3840 3840 3840 3840

Tetrodotoxin Tetrodotoxin C3 C3 (TTX) (TTX)

99 9

10 Tetrodotoxin 10 Tetrodotoxin 10 C3 (TTX) (TTX) C3

Tetrodotoxin Tetrodotoxin G11-T Tetrodotoxin G11-T ⁑⁑ C3 (TTX) G11-T ⁑⁑⁑ (TTX) C3 C3 G11-T Truncation G11-T ⁑(TTX) Truncation C3 C3

[68] [68] [68]

[68]

10 phosphate buffer, 10 mM mM phosphatebuffer, buffer,2.7 mM 10 mM phosphate 10 mM phosphate buffer, 10mM mMKCl, phosphate buffer, 10 mM phosphate buffer, 2.7 140 mM 2.7 mM140 KCl,mM 140 NaCl, mM NaCl, NaCl, [69] KCl, 0.05% [69] 2.7 mM KCl, 140 mM NaCl, [69] 2.7 mM [69] KCl, 140 mM NaCl, [69] 2.7 mM KCl, 140 mM NaCl, 0.05% Tween-20, pH 7.4 0.05% Tween-20,pH pH7.4 7.4 Tween-20, 0.05% Tween-20, pH 7.4 0.05% Tween-20, pH 7.4 0.05% Tween-20, pH 7.4

[69]

10 mM PBS, pH 7.5

10 10 mM mM PBS, PBS, pH pH 7.5 7.5 10mM mM PBS, pH 7.5 10 [68] PBS, pH 7.5

[66,67]

Toxins 2018, 10, 427

7 of 26

Table 1. Cont. Num.

12

Target

Toxins 2018, 10, FOR PEER REVIEW ToxinsAptamer 2018, 10, 10, xxx FOR FOR PEER PEER REVIEW Toxins 2018, REVIEW Selection Method

Name

Saxitoxin(STX) C3

12 12

Saxitoxin

M-30fSaxitoxin (STX) C3 C3 C3 (STX) C3

M-30f Truncation M-30f

Year

Truncation 2015 Truncation

Toxins 2018, 10, x FOR PEER REVIEW

Sequence (50 –30 )

TTGAGGGTCGCAT TTGAGGGTCGCAT TTGAGGGTCGCAT TTGAGGGTCGCAT 2015 CCCGTGGAAACA CCCGTGGAAACAG 2015 CCCGTGGAAACA GGTTCATTG GTTCATTG GGTTCATTG

Affinity (Kd, nM)

Secondary Structure

7 of 26

of 26 26 77 of Folding Reference Condition

10 mM phosphate buffer, 10 mM phosphate buffer, 10 mM mM phosphate buffer,2.7 mM 10 phosphate buffer, 2.7 mM KCl, 140 mM KCl, 0.05% [70] 2.7 mM140 KCl,mM 140 NaCl, mM NaCl, NaCl, [70] 0.05% Tween-20, pH 7.4 Tween-20, 0.05% Tween-20,pH pH7.4 7.4

133 133 133

Ref.

[70]

6 of 26

CACGCACAGAAG

13

Anatoxin-a Anatoxin-a Anatoxin-a Microcystin-LA 13 13 ATX8Anatoxin-a C3 13 6 (ATX-a) C3 C3 C3 C3 (ATX-a) (ATX-a) C2 (MC-LA)(ATX-a)

ATX8 ATX8 Beads-SELEX ATX8 RC4

TGGCGACAAGAA TGGCGACAAGAA TGGCGACAAGAA TGGCGACAAGAA GACGTACAAACA ACACCTACAGGG GACGTACAAACA GACGTACAAACAC GACGTACAAACA Beads-SELEX 2015 CGCACCAGGCCG 81.378 Beads-SELEX 2015 CGCACCAGGCCG 81.378 2015 GCACCAGGCCGGA 81.378 Beads-SELEX 2015 CGCACCAGGCCG 81.378 Beads-SELEX 2012 CCAGATCACAATC GAGTGGAGTATTC GAGTGGAGTATTC GTGGAGTATTCTGA GAGTGGAGTATTC GGTTAGTGAACTC TGAGGTCGG TGAGGTCGG GGTCGG TGAGGTCGG

50 mM Tris, pH 7.5, 150 50 mM mM Tris, Tris, pH pH 7.5, 7.5, 150 150 50

76

50mM mM Tris, pH 7.5, 150 mM [71] 50 mM Tris, 150 mM NaCl, NaCl, mM MgCl mM NaCl, NaCl, 222 mM mM MgCl MgCl2222,,, [71] [71] mM [71] NaCl, 2 mM MgCl2 , pH 7.5 pH 2 mM MgCl2, pH 7.5 pH 7.5 7.5

[65]

pH 7.5

GTACGGCGCG

AGCAGCACAGAG AGCAGCACAGAG AGCAGCACAGAG

Gonyautoxin1/4

14

Gonyautoxin1/4 Gonyautoxin1/4 Gonyautoxin1/4 14 GO18-T GO18-T 14 GO18-T C3 GO18-T 14 GO-SELEX (GTX1/4) C3 C3 (GTX1/4) C3 (GTX1/4) (GTX1/4) C3

7

Microcystin-YR (MC-YR) C2

HC1

AGCAGCACAGAGG GTCAGATGCAATC GTCAGATGCAATC GTCAGATGCAATC TCAGATGCAATCGG GGAACGAGTAAC GGAACGAGTAAC GGAACGAGTAAC GGACAACATAGG AACGAGTAACCTTT GO-SELEX 2016 CTTTGGTCGGGCA 62 GO-SELEX 2016 CTTTGGTCGGGCA 62 GO-SELEX 2016 CTTTGGTCGGGCA 62 2016 62 AAAAAGGCTCTG GGTCGGGCAAGG AGGTAGGTTGCCT AGGTAGGTTGCCT AGGTAGGTTGCCT TAGGTTGCCTATGC ATGCGTGCTACCG Beads-SELEX 2012 CTACCGGATCCCT ATGCGTGCTACCG ATGCGTGCTACCG TGAA GTGCTACCGTGAA TGAA GTTGTATGGGCAT

20 mM Tris-HCl, 100 mM 20 mM mM Tris-HCl, Tris-HCl, 100 100 mM mM 20

193

20NaCl, mM Tris-HCl, 100 2, 5 mM [72] 2 mM MgCl 5mM mM NaCl, [72] NaCl, mM MgCl MgCl 222,, 5 mM [72] NaCl, 22 mM 2 mM MgCl 5 mM KCl, pH 7.5 2 ,pH KCl, pH 7.5 KCl, pH 7.5 KCl, 7.5

[72]

50 mM Tris, 150 mM NaCl, 2 mM MgCl2, pH 7.5

[65]

ATCTGTTGAT Gonyautoxin1/4

15

Gonyautoxin1/4 Gonyautoxin1/4 GO18-T-d 15 Gonyautoxin1/4 15 GO18-T-d 15 GO18-T-d C3 GO18-T-d (GTX1/4) Truncation C3 C3 (GTX1/4) C3 (GTX1/4) (GTX1/4) C3

Truncation Truncation Truncation 2016

AACCTTTGGTCGG AACCTTTGGTCGG AACCTTTGGTCGG 2016 AACCTTTGGTCGGG 2016 2016 GCAAGGTAGGTT GCAAGGTAGGTT GCAAGGTAGGTT CAAGGTAGGTT

20 mM Tris–HCl and 10

20mM mMTris–HCl Tris–HCl and and 10 10 mM Tris–HCl [72] 2020 and 10 mM [72] [72] mM MgCl pH mMMgCl MgCl2222,,,, pH pH 7.5 7.5 mM MgCl 7.5 2 pH7.5

8.1 8.1 8.1 8.1

[72]

250 mM NaCl, 1 mM AAAAATTTCACAC ⁑ The aptamer was named as G11-T in this review, because several papers cited the sequence but it was not Num., number; Ref., reference; N/A, not available; Tetrodotoxin MgCl2, 0.1 mM EDTA, 1 Num., number; number; Ref., Ref., reference; reference; N/A, not not available; available; ⁑⁑⁑ The The aptamer aptamer was was named named as as G11-T G11-T in in this this review, review, because because several several papers papers cited cited the the sequence sequence but but itit was was not not Num., N/A, ⁑ Num., number;9Ref., reference; N/A, not available; The aptamer was namedC1as G11-T this review, because several papers cited the sequence but it was not wholly consist with that in G11-T Truncation 2012 intoxins; GGGTGCCTCGGCT N/A toxins. C2 C3 C3 consist C1,, polyether C2,, polypeptide C3,, alkaloid toxins; Secondary structure of each aptamer was wholly with that in the original selection paper; C1 C2 C3 C1 C2 C3 (TTX) mM DTT, polyether toxins; polypeptide toxins;of alkaloid toxins. Secondary Secondary structure of each each aptamer was sever, wholly consist with with that C2 in,the the original selection selection paper; C1 , polyether C3 , alkaloid , polyether toxins; , polypeptide toxins; , each alkaloid toxins. structure of was wholly consist that in original paper; the original selection paper; toxins; polypeptide toxins; toxins. Secondary structure aptamer was predicted using the aptamer Mfold online with20 themM Tris-HCl, GTCC predicted using the Mfold online sever, with the parameters listed in the “Folding reference condition”. predicted using the the Mfold online online sever, sever, with with the the parameters parameters listed listed in in the the “Folding “Folding reference reference condition”. condition”. pH 7.5 predicted using Mfold parameters listed in the “Folding reference condition”.

10

Tetrodotoxin (TTX) C3

A3

Beads-SELEX

2014

GGGAGCTCAGAA TAA ACGCTCAAC CCTGCCGGGGGCT TCTCCTTGCTGCT CTGCTCTGTTCGA CATGAGGCCCGG ATC

GGTATTGAGGGTC GCATCCCGTGGAA

N/A

10 mM PBS, pH 7.5

10 mM phosphate buffer,

[66,67]

[68]

Toxins 2018, 10, 427

Toxins 2018, 10, x FOR PEER REVIEW

8 of 26

11 of 26

Except GTX 1/4, all the remaining targets in Table 1 were immobilized onto beads or magnetic GTX 1/4, all the remaining in Table 1 were immobilized onto beads or magnetic ® M-270 beadsExcept for aptamer selection. Gao et al.targets [61] immobilized the PTX onto Dynabeads via an ® beads for aptamer selection. Gao et al. [61] immobilized the PTX onto Dynabeads M-270 an amine-carboxylic group coupling as PTX contains a -NH2 group. OA, STX, MC-LR, BTX werevia used amine-carboxylic group coupling as PTX contains a -NH 2 group. OA, STX, MC-LR, BTX were used as counter-targets in the counter selection. The aptamer with highest affinity, PTX-13, was obtained as counter-targets the Eissa counter selection. The aptamer highest affinity, PTX-13, was beads obtained after 10 rounds. In in 2013, et al. [62] coupled OA ontowith Diaminodipropylamine agarose by after 10 rounds. In 2013, Eissa et al. [62] coupled OA onto Diaminodipropylamine agarose beads by coupling the terminal carboxylic groups on OA with the amine groups on the beads via EDC/NHS coupling the terminal carboxylic groups on OA with the amine groups on the beads via EDC/NHS chemistry. Dinophysistoxin-1 (DTX1)-beads and Dinophysistoxin-1 (DTX2)-beads were used in the chemistry. Dinophysistoxin-1 (DTX1)-beads Dinophysistoxin-1 (DTX2)-beads were used in the counter selection. OA34 was obtained after 18and rounds. In 2015, Eissa et al. [63] immobilized BTX-2 to counter selection. OA34 was obtained after 18 rounds. In 2015, Eissa et al. [63] immobilized BTX-2 to the divinyl sulfone beads (DVS beads) by coupling the terminal DVS groups on the beads with the the divinyl sulfone beads (DVS beads) by coupling the terminal DVS groups on the beads with the hydroxyl groups on BTX-2. Negative DVS beads blocked with ethanolamine were used for negative hydroxyl groups on BTX-2. Negative DVS beads Ng blocked used for selection. BT10 was obtained after 10 rounds. et al.with [65] ethanolamine selected DNAwere aptamers for negative MC-LR, selection. BT10 was obtained after 10 rounds. Ng et al. [65] selected DNA aptamers for MC-LR, -YR, and -LA. MC-LR, -YR, and -LA were firstly aminoethanethiolled, and then immobilized-YR, on and -LA. MC-LR, -YR, and beads. -LA were aminoethanethiolled, then immobilized on NHS-activated sepharose-4B Blankfirstly sepharose beads were used and in counter selection. AN6, NHS-activated sepharose-4B beads. Blank sepharose beads wereand used in counter selection. RC4, and HC1 showed high specificity towards MC-LR, MC-LA, MC-YR, respectively. In AN6, 2012, RC4, and HC1 showed high specificity towards MC-LR, MC-LA, and MC-YR, respectively. In 2012, Shao et al. [67] coupled TTX onto acrylic cyclopropane beads for the positive selection and the acrylic Shao et al. [67] coupled TTX as onto acrylic cyclopropane beads was for the positive and the cyclopropane beads were used the negative group. The aptamer obtained afterselection 10 rounds. Then, acrylic cyclopropane beads were used as the negative group. The aptamer was obtained after 10 in 2014, Shao et al. [68] selected a highly specific aptamer through a combination of beads-SELEX rounds. Then, in 2014, Shao et al. [68] selected a highly specific aptamer through a combination of and mutagenic PCR, named A3. Handy et al. [69] conjugated the STX with a protein carrier (keyhole beads-SELEX and mutagenic named(2,2 A3. Handy et al. [69] conjugated theasSTX with abased protein 0 -(ethylenedioxy)bis(ethylamine)) limpet hemocyanin (KLH)) viaPCR, Jeffamine a spacer on carrier (keyhole limpet hemocyanin (KLH)) via Jeffamine (2,2′-(ethylenedioxy)bis(ethylamine)) as a ® the Mannich reaction. Then the KLH-STX was coupled on the Dynabeads M-270 epoxy magnetic ®M-270 spacerfor based on the MannichKHL reaction. Then the were KLH-STX wasascoupled on the Dynabeads beads positive selection. coupled beads applied the negative control. APTSTX was epoxy magnetic positiveet selection. KHL coupled were applied as agarose the negative obtained after 10 beads rounds.for Elshafey al. [71] conjugated ATX-abeads to hydrazide modified bead control. APTSTXcarbonyl was obtained 10 rounds. Elshafey [71] conjugated to hydrazide via its terminal moiety.after Agarose beads were used et foral. negative selections.ATX-a ATX8 was obtained modified agarose bead via its terminal carbonyl moiety. Agarose beads were used for negative after 13 rounds. These successful selections of aptamers for marine biotoxins can be referred to for selections. ATX8 was obtained after 13 rounds. These successful selections of aptamers for marine aptamer selection of other marine biotoxins, and maybe most targets can be directly immobilized biotoxins can be referred to for aptamer of other other molecules, marine biotoxins, maybe most targets on beads without any conjugation withselection protein or which and is necessary during the can be directly immobilized on beads without any conjugation with protein or other molecules, antibody generation. which is necessary during the antibody generation. (c) Thirdly, some new selection methods promote efficient aptamer selection for marine biotoxins. (c) Thirdly, some new selection methods promote efficient aptamer selection for marine biotoxins. In 2016, Tian et al. [64] completed a selection of aptamers binding to BTX-2 based on In 2016, Tian et al. [64] completed a selection of aptamers binding to BTX-2 based on microwell-SELEX. The positive selection process is illustrated in Figure 3. The BTX-2 was microwell-SELEX. The positive selection process is illustrated in Figure 3. The BTX-2 was coupled with a carrier protein, BSA (bovine serum albumin), and immobilized onto the inner coupled with a carrier protein, BSA (bovine serum albumin), and immobilized onto the inner bottom surface of the microwells, and the oligonucleotides were incubated with the immobilized bottom surface of the microwells, and the oligonucleotides were incubated with the BTX-2. Using the microwells as a matrix, no other special separation instruments were needed immobilized BTX-2. Using the microwells as a matrix, no other special separation instruments for theneeded partitionfor of oligonucleotides-beads complex and the unbound oligonucleotides or the were the partition of oligonucleotides-beads complex and the unbound elution of the bound oligonucleotides. oligonucleotides or the elution of the bound oligonucleotides.

Figure 3. positive selection process in Microwell-SELEX. T, target. BSA, bovine serum Figure 3. Procedure Procedureof of positive selection process in Microwell-SELEX. T, target. BSA, bovine albumin. serum albumin.

In 2016, Gao et al. [72] reported a Graphene-SELEX (GO-SELEX) for selecting aptamer targeting GTX1/4. diddid notnot need to be immobilized. As shown in Figure 4, the GTX1/4.The Thesmall smallmolecule moleculeGTX1/4 GTX1/4 need to be immobilized. As shown in Figure 4, random ssDNA library was firstly incubated with the target GTX1/4 and then incubated with the GO solution. The ssDNAs that could not bind to the target were absorbed onto the GO surface

Toxins 2018, 10, 427

9 of 26

the random ssDNA library was firstly incubated with the target GTX1/4 and then incubated with Toxins 10, x FORThe PEER REVIEW that could not bind to the target were absorbed onto the GO 12 of 26 the GO2018, solution. ssDNAs surface through π-π stacking and hydrophobic interactions, while the ssDNA that bound to the target remained π-π stacking hydrophobic interactions, thewell ssDNA bound ssDNAs to the target inthrough the solution with theand aptamer-toxin complexes. Thewhile GO as as thethat absorbed were remained in the solution with the aptamer-toxin complexes. The GO as well as the absorbed ssDNAs discarded by centrifugation, while the ssDNA bound to the target in the supernatant was recovered were discarded by centrifugation, while the ssDNA bound to the target in the supernatant was and amplified for the next round selection. An aptamer named as GO18-T was obtained after 8 rounds. recovered and amplified for the next round selection. An aptamer named as GO18-T was obtained Interestingly, the authors performed a Mag-beads-SELEX at the same time, and they found that after 8 rounds. Interestingly, the authors performed a Mag-beads-SELEX at the same time, and they GO-SELEX exhibited higher efficiency with the following significant advantages. (1) GO-SELEX is found that GO-SELEX exhibited higher efficiency with the following significant advantages. (1) easier to be operated without relying on special equipment; (2) Recovery of ssDNA in each round GO-SELEX is easier to be operated without relying on special equipment; (2) Recovery of ssDNA in of GO-SELEX was significantly higher than that in Mag-beads-SELEX; (3) Aptamers selected by each round of GO-SELEX was significantly higher than that in Mag-beads-SELEX; (3) Aptamers GO-SELEX exhibited higher affinity in nM range, and the aptamers selected by Mag-beads-SELEX selected by GO-SELEX exhibited higher affinity in nM range, and the aptamers selected by had relatively low affinity ranging from tens of µM to several µM, because the targets were freely Mag-beads-SELEX had relatively low affinity ranging from tens of μM to several μM, because the distributed in GO-SELEX while they were immobilized in Mag-beads-SELEX, and the immobilization targets were freely distributed in GO-SELEX while they were immobilized in Mag-beads-SELEX, might cause conformational changes to the targets and interference to the binding of the ssDNAs and and the immobilization might cause conformational changes to the targets and interference to the the conjugation side of the targets. Their practice and analysis showed that GO-SELEX really provided binding of the ssDNAs and the conjugation side of the targets. Their practice and analysis showed a good reference for aptamer selection for marine biotoxins. If the target does not have any chemical that GO-SELEX really provided a good reference for aptamer selection for marine biotoxins. If the group for immobilization, the GO-SELEX can be chosen. target does not have any chemical group for immobilization, the GO-SELEX can be chosen.

Figure4.4. Procedure Procedure of of positive positive selection selection in Figure in Graphene-SELEX Graphene-SELEX (GO-SELEX). (GO-SELEX).

(d) Fourthly, Fourthly, some some post postoptimization optimizationgreatly greatlyimproved improvedthe theaffinity affinityofofthe theselected selectedaptamers. aptamers.Two Twoof (d) of the aptamers in Table 1 were derived from truncation study. One is M-30f, and the other the aptamers in Table 1 were derived from truncation study. One is and the otherisis STX STX GO-18-T-d. Zheng et al. [70] improved the APT GO-18-T-d. APT selected selectedby byHandy Handyetetal. al.[69] [69]to tobe beshorter shorter STXand and to to have have higher higher affinity affinity towards towards STX. STX. The The authors authors analyzed analyzed the sequence sequence of APTSTX and and adopted rational site-directed mutagenesis, on the basis of secondary structure prediction adopted rational site-directed mutagenesis, on the basis of secondary structure predictiontoto improve the the conformational conformational stability stability and improve and thus thus to to strengthen strengthen its its interaction interactionwith withSTX. STX.Then Thenthe the authors adopted truncation to remove the unnecessary nucleotides and to remain the key authors adopted truncation to remove the unnecessary nucleotides and to remain the key binding binding structure, andwas M-30f was obtained with a 30-fold improved The other sample structure, and M-30f obtained with a 30-fold improved affinity.affinity. The other sample is the is the GO-18-T-d. It is truncated by Gao et al. [72] after they obtained the GO-18 using GO-18-T-d. It is truncated by Gao et al. [72] after they obtained the GO-18 using GO-SELEX. GO-SELEX. GO-18 was truncated based on structure the secondary structure prediction, and GO-18 was truncated based on the secondary prediction, and the GO-18-T-d hasthe an GO-18-T-d has an 8-fold improved affinity. 8-fold improved affinity. In short, aptamers targeting marine biotoxins attracts more and more attention, and the recent In short, aptamers targeting marine biotoxins attracts more and more attention, and the recent advances lay a good foundation for further exploration. Different selection methods can be chosen, advances layon a good foundationproperty for further selection methods can based be chosen, depending the individual of exploration. each target.Different And a post truncation study on depending on the individual property of each target. And a post truncation study based on secondary secondary structure prediction can be applied after the successful selection of an aptamer for structure prediction can be applied after the successful selection of an aptamer for marine biotoxin. marine biotoxin.

3. Developed Aptasensors Targeting Marine Biotoxins 3. Developed Aptasensors Targeting Marine Biotoxins Aptasensors show great potential in rapid detection. With the development of transducer Aptasensors show great potential in rapid detection. With the development of transducer technology, more and more advanced aptasensors have been reported [73–76]. For the marine technology, more and more advanced aptasensors have been reported [73–76]. For the marine biotoxins detection, there were mainly four kinds of aptasensors reported in recent years, i.e., biolayer biotoxins detection, there were mainly four kinds of aptasensors reported in recent years, i.e., interferometry (BLI)-based(BLI)-based aptasensors,aptasensors, electrochemistry (EC)-based aptasensors, fluorescence biolayer interferometry electrochemistry (EC)-based aptasensors, (FL)-based aptasensors, and enzyme linked aptamer assay (ELAA)-based aptasensors. We summarize fluorescence (FL)-based aptasensors, and enzyme linked aptamer assay (ELAA)-based aptasensors. these kinds of these aptasensors order,ofand provide ourinviewpoints simultaneously. More than 90% We four summarize four in kinds aptasensors order, and provide our viewpoints simultaneously. More than 90% of them were reported after 2015. The linear detection range and the limit of detection (LOD) of all these aptasensors were summarized in Table 2 and discussed at the end of this section.

Toxins 2018, 10, 427

10 of 26

of them were reported after 2015. The linear detection range and the limit of detection (LOD) of all these aptasensors were summarized in Table 2 and discussed at the end of this section. 3.1. Biolayer Interferometry (BLI)-Based Aptasensors BLI is a label-free and real-time optical analysis technique that utilizes fiber-optic biosensors for measuring the interactions between biomolecules [77]. The interaction of free analytes with the immobilized ligands on the sensor surface forms a monomolecular layer that in turn creates a proportional shift in the interference spectrum of reflected light (∆λ) [78]. This wavelength shift (∆λ) directly reflects the change in the optical thickness of the sensor layer, and is recorded in real time [79]. There are three BLI-based aptasensors developed for marine biotoxins. In 2016, Gao et al. [72] used GO18-T-d to construct a label-free and real-time optical BLI aptasensor for the detection of GTX1/4. As shown in Figure 5a, aptamers were immobilized on the sensor tip surface and incubated with the samples so as to capture the target molecules, GTX1/4, in samples. Interference signals were measured after the washing for quantitation. The authors carried out detailed optimization when developing the aptasensor, because the aptasensor signal was significantly dependent on Mg2+ concentration and buffer pH. With the optimized working condition, the aptasensor exhibited a high sensitivity and specificity for GTX1/4, when used for detecting GTX1/4 in spiked shellfish samples. A good recovery percentage of 86.70–101.29% was obtained, proving the high accuracy of the aptasensor. Moreover, the aptasensor can be readily regenerated by alkaline denaturation and washing. Then, a label-free and competitive BLI aptasensor for the detection of STX using the M-30f was developed in 2017 by the same group [80]. As shown in Figure 5b, the STX standard was immobilized onto the sensor surface and the aptamer (M-30f) was completely bound by the immobilized STX and the STX in samples. After washing, any change in the number of M-30f bound to the immobilized STX causes a shift in the interference pattern that can be measured in real-time. Similarly, with their previous study [72], they performed detailed working condition optimization for the development of the aptasensor, including the binding time, Na+ , K+ and Mg2+ concentrations, and the buffer pH. With the optimized working condition, the developed aptasensor showed high selectivity for STX and good reproducibility and stability, with a good recovery of 101.40–107.26% and a low coefficient of variation of 2.58–6.50%. The excellent practicability of the aptasensor was proven after using three kinds of real samples, including the shellfish matrix, ribbon fish, and the water components. Still in 2017, the same group improved the BLI-based aptasensor design and developed an enzyme-linked competitive BLI-based aptasensor for PTX detection using PTX-13 [61]. As shown in Figure 5c, the target PTX was immobilized on the AR2G surface, and HRP (horseradish peroxidase)-labeled aptamer (PTX-13) was competitively bound by the immobilized PTX and PTX in samples. After washing, the biosensor chip with immobilized PTX: aptamer-HRP complex was submerged in a 3,3’-diaminobenzidine solution and resulted in the formation of a precipitated polymeric product and a large signal change. This design achieved significant great signal amplification, with an excellent LOD at 0.04 pg/mL. The high selectivity of the aptasensor was further verified using the PTX-spiked shellfish and seawater. Although the principle of these three aptasensors is simple, either by a direct capture or a competitive binding similar to ELISA, the BLI is a novel transducer technique in the field of aptamer-based research and it is based on sensitive optical analysis. More efforts can be done to explore more application of the BLI-based aptasensor for marine biotoxin detection.

Toxins 2018, 10, 427 Toxins 2018, 10, x FOR PEER REVIEW

11 of 26 14 of 26

Figure Scheme Figure 5. 5. Biolayer Biolayer Interferometry Interferometry (BLI)-based (BLI)-based aptasensors aptasensors for formarine marinebiotoxin biotoxindetection. detection.(a) (a)Scheme of a label-free BLI-based aptasensor for GTX1/4 detection (Scheme was drawn according to of a label-free BLI-based aptasensor for GTX1/4 detection (Scheme was drawn according to the the text text description description of of Ref. Ref. [72]); [72]); (b) (b) Scheme Scheme of of aa label-free label-free and and competitive competitive BLI-based BLI-based aptasensor aptasensor for for STX STX detection detection (Scheme (Scheme was was drawn drawn according according to to the the text text description description and and the the original original Figure Figure 22 of ofRef. Ref.[80]); [80]); (c) Scheme of a competitive and signal-amplified BLI-based aptasensor for PTX detection (Scheme was (c) Scheme of a competitive and signal-amplified BLI-based aptasensor for PTX detection (Scheme drawn according to the text description and the original Figure 2 of Ref. [61]). was drawn according to the text description and the original Figure 2 of Ref. [61]).

3.2. Electrochemistry (EC)-Based Aptasensor 3.2. Electrochemistry (EC)-Based Aptasensor Electrochemical sensing draws particular attention, owing to its intrinsic advantages in terms Electrochemical sensing draws particular attention, owing to its intrinsic advantages in terms of of sensitive recognition, rapid response, low cost, excellent portability, modest requirement of sensitive recognition, rapid response, low cost, excellent portability, modest requirement of sample sample volumes, and easy signal amplification with redox-active reporters [81–83]. Electrochemical volumes, and easy signal amplification with redox-active reporters [81–83]. Electrochemical aptasensors are very suitable for the rapid and on-site detection of marine biotoxins. aptasensors are very suitable for the rapid and on-site detection of marine biotoxins. In 2013, a label-free EC-based aptasensor was developed by Eissa et al. for OA detection after In 2013, a label-free EC-based aptasensor was developed by Eissa et al. for OA detection after they selected the anti-OA aptamer, OA34 [62]. The principle is shown in Figure 6a. The –SH-labeled they selected the anti-OA aptamer, OA34 [62]. The principle is shown in Figure 6a. The –SH-labeled OA34 was immobilized on the Au electrode by a self-assembly approach through an Au−S interaction. OA34 was immobilized on the Au electrode by a self-assembly approach through an Au−S With the presence of the target, there will be a significant decrease in the electron-transfer resistance, interaction. With the presence of the target, there will be a significant decrease in the because the specific binding of the aptamer (OA34) and target (OA) induces an alteration of the aptamer electron-transfer resistance, because the specific binding of the aptamer (OA34) and target (OA) conformation. The electrochemical signals were monitored by electrochemical impedance spectroscopy induces an alteration of the aptamer conformation. The electrochemical signals were monitored by (EIS), and were negatively correlated with OA concentration. The aptasensor showed high sensitivity electrochemical impedance spectroscopy (EIS), and were negatively correlated with OA and did not show cross-reactivity toward toxins with structures similar to OA such as DTX-1 and concentration. The aptasensor showed high sensitivity and did not show cross-reactivity toward DTX-2. The similar scheme was applied to analyze ATX-a using ATX8 in 2015 by Elshafey et al. [71], toxins with structures similar to OA such as DTX-1 and DTX-2. The similar scheme was applied to and their results showed that the aptasensor achieved high sensitivity and high specificity towards analyze ATX-a using ATX8 in 2015 by Elshafey et al. [71], and their results showed that the aptasensor achieved high sensitivity and high specificity towards ATX-a, with high accuracy and reproducibility. To improve the sensitivity of detection, competitive schemes were further designed.

Toxins 2018, 10, 427

Toxins 2018, 10, x FOR PEER REVIEW Toxins 2018, 10, x FOR PEER REVIEW

12 of 26

15 of 26 15 of 26

ATX-a, withEissa high et accuracy To improve the sensitivity of EC detection, competitive In 2015, al. [63] and usedreproducibility. BT10 to construct a label-free competitive aptasensor for BTX-2 schemes were further designed. In 2015, Eissa et al. [63] used BT10 to construct a label-free competitive The scheme is shown Figure 6b. The target (BTX-2) EC standard substance was Indetection. 2015, Eissa et al. [63] used BT10 toinconstruct a label-free competitive aptasensor for BTX-2 EC aptasensor for BTX-2 is6b. shown Figure 6b. The standard target immobilized onscheme the Audetection. electrode surface via the coupling of its(BTX-2) hydroxyl group(BTX-2) and thestandard precoated detection. The is shownThe in scheme Figure The intarget substance was substance was on immobilized on the surface Au electrode via of theitscoupling of group its hydroxyl group and cysteamine, and immobilized BTX-2 was incubated with label-free aptamer (BT10) and immobilized thethen Au the electrode via thesurface coupling hydroxyl and the precoated the precoated cysteamine, and then the immobilized BTX-2 was incubated with label-free aptamer samples. After washing, the EIS signal waswas measured. BTX-2 spiked aptamer shellfish (BT10) extract and was cysteamine, and then the immobilized BTX-2 incubated with in label-free (BT10) and After samples. After washing, the EIS signal was measured. in spiked shellfish extract analyzed by thewashing, aptasensor high recovery percentage (102–110%) was obtained. samples. theand EISa very signal was measured. BTX-2BTX-2 in spiked shellfish extract was was analyzed by the aptasensor and a very high recovery percentage (102–110%) was obtained. analyzed by the aptasensor and a very high recovery percentage (102–110%) was obtained.

Figure 6. Electrochemistry (EC)-based aptasensors based on gold electrodes. (a) Scheme of a label-free EC-based aptasensor for OA detection (Scheme was according to theoftext Figure 6. 6. Electrochemistry (EC)-based aptasensors basedbased on goldonelectrodes. (a) Scheme a label-free Figure Electrochemistry (EC)-based aptasensors gold drawn electrodes. (a)ofScheme a description and thefor original Scheme 1 of Ref. [62]).drawn (b) Scheme of a competitive EC-based EC-based aptasensor OA detection was according to the text description and label-free EC-based aptasensor for (Scheme OA detection (Scheme was drawn according to aptasensor the the text for BTX-2 detection (Scheme was drawn to Scheme theEC-based text of description andfor theBTX-2 original Scheme 1 original Scheme of Ref. [62]).Scheme (b) Scheme ofaccording a competitive aptasensor detection description and1 the original 1 of Ref. [62]). (b) a competitive EC-based aptasensor (Scheme was drawn according to the text description and the original Scheme 1 of Ref. [63]). EIS, 1 of Ref. [63]). EIS, electrochemical impedance spectroscopy. for BTX-2 detection (Scheme was drawn according to the text description and the original Scheme electrochemical impedance spectroscopy. of Ref. [63]). EIS, electrochemical impedance spectroscopy.

Another electrochemical aptasensor involving signal amplification was reported in 2017 by Another electrochemical aptasensor involving signalelectrical amplification wasreported reported 2017 Pan et al. [84]. They developed a label-free gap-based competitive aptasensor for OA Another electrochemical aptasensor involving signal amplification was inin2017 by by Pan et al. [84]. They developed a label-free gap-based electrical competitive aptasensor detection, using the OA34. As is shown in Figure 7, the gap-electrical biosensor is constructed by Pan et al. [84]. They developed a label-free gap-based electrical competitive aptasensor for OA for OA detection, using the OA34. As is shown in Figure 7, the gap-electrical biosensor is modifying interdigitated with7, the gold nanoparticles (AuNPs) via APTES detection, using the OA34. Asmicroelectrodes is shown in Figure gap-electrical biosensor is constructed by constructed byinterdigitated modifying interdigitated microelectrodes with gold nanoparticles (AuNPs) via APTES ((3-Aminopropyl)-triethoxysilane) mediated electrostatic interaction and(AuNPs) using thevia self-catalytic modifying microelectrodes with gold nanoparticles APTES ((3-Aminopropyl)-triethoxysilane) electrostatic interaction and using the self-catalytic growth of growth of AuNPs as conductivemediated bridges. Theelectrostatic OA aptamer was firstly absorbed onto surfaces ((3-Aminopropyl)-triethoxysilane) mediated interaction and using the the self-catalytic ofgrowth AuNPs as conductive bridges. The OA aptamer was firstly absorbed onto the surfaces of AuNPs dueof AuNPsofdue to electrostatic interaction, active sites of AuNPs fully blocked. AuNPs as conductive bridges.and Thethe OAcatalytically aptamer was firstly absorbed ontoare the surfaces toAuNPs electrostatic interaction, and the catalytically active sites of AuNPs are fully blocked. In the presence In the due presence of OA, the aptamer and bound to OA and active the AuNPs wereare partially or fully to electrostatic interaction, the catalytically sites ofsites AuNPs fully blocked. ofInOA, the aptamer bound to OA and the AuNPs sites were partially or fully exposed, triggering the exposed, triggering thethe catalytic growth glucosesites andwere HAuCl 4. The or catalytic the presence of OA, aptamer boundintothe OAsolution and theofAuNPs partially fully catalytic growth in the solution of glucose and HAuCl . The catalytic reaction product H O in turn 4 2 conductance 2 catalytic reaction product H2O 2 incatalytic turn reduces HAuCl 4 to make the of AuNPs grow, thus 4the exposed, triggering the growth in the solution glucose andand HAuCl . The reduces HAuCl to make the AuNPs grow, and thus the conductance signal amplification is closely 4 signal amplification is closely related to the catalytic activity of AuNPs upon their interaction with reaction product H2O2 in turn reduces HAuCl4 to make the AuNPs grow, and thus the conductance related to the catalytic activity of AuNPs upon their interaction with the OA and OA aptamer. the OA and OA aptamer. signal amplification is closely related to the catalytic activity of AuNPs upon their interaction with the OA and OA aptamer.

Figure 7. Scheme a competitive gap-based electrochemical aptasensor detection (Scheme Figure 7. Scheme of aofcompetitive gap-based electrochemical aptasensor forfor OAOA detection (Scheme was drawn according to the description original Figure of Ref. [84]). Figure 7. Scheme of to a competitive gap-based electrochemical aptasensor for OA detection (Scheme was drawn according the texttext description andand thethe original Figure 1 of1Ref. [84]). was drawn according to the text description and the original Figure 1 of Ref. [84]).

Toxins 2018, 10,10, 427 Toxins 2018, x FOR PEER REVIEW

26 1613ofof26

In 2018, a photoelectrochemical (PEC) aptasensor was developed by Tang et al. [85] for the In 2018, photoelectrochemical (PEC) aptasensor was Tang et al. [85] for the detection of aMC-LR using the aptamer AN6. As shown in developed Figure 8, aby CuS-TiO 2 heterojunction detection of MC-LR using the aptamer AN6. As shown in Figure 8, a CuS-TiO 2 heterojunction composite was prepared by dispersedly depositing CuS nanoparticles on TiO2 nanospheres surface composite was prepared by dispersedly depositing CuS nanoparticles on TiO nanospheres surface 2 with a hydrothermal method, which greatly alleviated the self-aggregation of CuS. The composite with a hydrothermal method, which greatly alleviated the self-aggregation of CuS. The composite exhibited enhanced visible light absorption, and the improved separation of photo-generated exhibited enhanced visible self-aggregation light absorption, of and thenanoparticles improved separation of photo-generated charges charges and the reduced CuS led to the enhanced photocurrent and the reduced CuSconstructed nanoparticles to the enhanced photocurrent response. response. A PECself-aggregation aptasensor wasofthen by led immobilizing CuS-TiO 2 composite on ITO Aelectrode PEC aptasensor was then constructed by immobilizing CuS-TiO composite on ITO electrode with 2 with chitosan film, which further covalently bounded the aminated aptamer. chitosan film, which bounded the aminated aptamer. Glutaraldehyde was Glutaraldehyde wasfurther used ascovalently a linker. When the target MC-LR was captured by the aptamer on used the asaptasensor, a linker. When the target MC-LR was captured by the aptamer on the aptasensor, it could it could be oxidized by the photogenerated hole to impede the electron-holebe oxidized by the hole to the impede the electron-hole recombination further amplify recombination photogenerated and further amplify photocurrent. The PEC aptasensor and showed superior the photocurrent. The PEC MC-LR with a analytical performance for aptasensor MC-LR withshowed a linearsuperior range ofanalytical 5.0 × 10−5 performance nM to 250 nMfor and a detection −5 nM to 250 nM and a detection limit of 2.0 × 10−5 nM. The proposed PEC −5 nM. linear 5.0 × 10The limit range of 2.0 ×of10 proposed PEC aptasensor showed high specificity for MC-LR detection aptasensor showed high specificity for MC-LR detection in real samples. in real samples.

Figure aptasensor for for detection detection of of microcystin-LR microcystin-LR (MC-LR) (MC-LR) Figure8.8. Scheme Scheme of of aa photoelectrochemical photoelectrochemical aptasensor (Scheme (Schemewas wasdrawn drawnaccording accordingtotothe thetext textdescription descriptionand andthe the original original Scheme Scheme 11 of of Ref. Ref. [85]). [85]).

The successful development of the above electrochemcial aptasensors proved that it was easy The successful development of the above electrochemcial aptasensors proved that it was easy to fabricate aptamers into aptasensors as the aptamers can be easily labelled with thiol group, to fabricate aptamers into aptasensors as the aptamers can be easily labelled with thiol group, which can react with the gold electrode or gold nanoparticles. Maybe some other metal particles and which can react with the gold electrode or gold nanoparticles. Maybe some other metal particles nanomaterials can be combined with the electrochemical technique for development of more novel and nanomaterials can be combined with the electrochemical technique for development of more aptasensors to furthertoimprove detection the development of the electrochemical novel aptasensors further the improve thesensitivity. detection With sensitivity. With the development of the working station, more and more portable electrochemical aptasensors can be available andcan canbebe electrochemical working station, more and more portable electrochemical aptasensors explored for on-site detection of marine biotoxins. available and can be explored for on-site detection of marine biotoxins. 3.3. Fluorescence (FL)-Based Aptasensors 3.3. Fluorescence (FL)-Based Aptasensors Fluorescence-based biosensors also attract much interest, owing to its advantages of high Fluorescence-based biosensors also attract much interest, owing to its advantages of high sensitivity, easy labeling, and specific characters [86–88]. For example, quantum dots (QDs) has good sensitivity, easy labeling, and specific characters [86–88]. For example, quantum dots (QDs) has stability, high molar extinction coefficient, high quantum yield and narrow peak fluorescence emission good stability, high molar extinction coefficient, high quantum yield and narrow peak fluorescence spectra and other excellent properties. Quantum dots have been applied as a emission spectra and otheroptical excellent optical properties. Quantum dotsgradually have beenwidely gradually widely new aptamer marker [89,90].marker Different materials were materials used during theused development of applied as afluorescent new aptamer fluorescent [89,90]. Different were during the FL-based aptasensors for marine biotoxins. There are three studies using up-conversion fluorescence development of FL-based aptasensors for marine biotoxins. There are three studies using orup-conversion down-conversion fluorescence, one study usingfluorescence, single-walledone carbon nanotubes (SWNTs), and two fluorescence or down-conversion study using single-walled carbon studies using fluorophores. nanotubes (SWNTs), and two studies using fluorophores. InIn2017, the aptamer, G11-T, was was usedused by Jinby et al. to develop a facilelyaself-assembled magnetic 2017, the aptamer, G11-T, Jin[66] et al. [66] to develop facilely self-assembled nanoparticles/aptamer/carbon dots (CDs) nanocomposites for TTX detection. As shown in Figure 9a, magnetic nanoparticles/aptamer/carbon dots (CDs) nanocomposites for TTX detection. As shown in thiodiglycolic acid (TA)-stabilized magnetic Fe3magnetic O4 nanoparticles were modified with a NH2 -labeled Figure 9a, thiodiglycolic acid (TA)-stabilized Fe3O4 nanoparticles were modified with a

Toxins 2018, 10, 427

14 of 26

aptamer (G11-T), and the CDs then self-assembled on the aptamer to form the Fe3 O4 /aptamer/CDs nanocomposites. The nanocomposites exhibited down-conversion fluorescen1ce and up-conversion fluorescence (UCF) emission simultaneously. And the UCF (peaked at 475 nm and excited at 780 nm) increased linearly with the TTX concentration ranging from 0.1 ng/mL to 0.1 mg/mL. Moreover, the author applied more than 10 potential interferences to prove the high selectivity, including toxins (AFB1, AFB2, et al.), biomolecules (histidine, cysteine, et al.), and anions (Cl− , PO4 3− and CO3 2− ). Three kinds of real samples were used to prove the high accuracy of the aptasensor, including gastric juice, serum, and urine. In the same year, Lv et al. [91] fabricated an ultrasensitive fluorescence-based aptasensor for detection of MC-LR using the aptamer, AN6. As shown in Figure 9b, the construction of the MC-LR aptasensor was based on an upconversion nanoparticle (CS-UCNPs) and MoS2 nanosheets, which have a high affinity toward ssDNA. Aptamer-modified CS-UCNPs were absorbed by MoS2 via the van der Waals force between nucleobases and the basal plane of MoS2 , resulting in the energy transfer from the CS-UCNPs to the MoS2 and quenching of the fluorescence. Once MC-LR was added, the aptamer combined with MC-LR preferentially changed the conformation, resulting in the detachment of aptamer-modified CS-UCNPs from MoS2 and the reconverment of the fluorescence. The aptasensor provides an ultrasensitive LOD at 0.002 ng/mL and owns well enough reliability and feasibility to allow the determination of MC-LR in real water samples. Another study using upconversion nanoparticles was carried out for the simultaneous detection of more than one kind of toxin. In 2015, Wu et al. [92] reported the first aptasensor for the simultaneous detection of two marine biotoxins, MC-LR and OA. Two aptamers, AN6 and OA34, were used. A homogenous dual fluorescence resonance energy transfer (FRET) system was fabricated between two donor–acceptor pairs. As shown in Figure 9c, green upconversion nanoparticles (NaYF4:Yb, Ho UCNPs) and red upconversion nanoparticles (NaYF4:Yb, Er/Mn UCNPs) were applied as the donors, and BHQ1 and BHQ3 were used as quenchers. The two donor–acceptor couples were fabricated by hybridizing the aptamers with their corresponding complementary DNA. In the presence of MC-LR and OA, the aptamers preferred to bind to their corresponding targets and de-hybridized with the complementary DNA, and thus significantly protected the green and red luminescence from quenching. The upconversion luminescence at 542 and 660 nm was chosen to monitor MC-LR and OA, respectively. The sensitivity of the aptasensor was obtained at pg/mL level. The high specificity was tested using DTX-1, DTX-2, MC-LA, and MC-YR. The practicability of the aptasensor was tested using fish, shrimps, and water samples. Another nanomaterial, single-walled carbon nanotubes (SWNTs), was used in a FL-based aptasensor constructed by Taghdisi et al. in 2017 [93]. The authors developed a simple fluorescent aptasensor for rapid detection of MC-LR using the aptamer, AN6. SWNTs were used as immobilizers owing to their unique properties of mechanical stability and large surface area. As shown in Figure 10, SWNTs were used as immobilizers, dapoxyl was used as afluorescent dye, DAP-10 was used as a specific aptamer for dapoxyl, and unmodified AN6 was used as a sensing ligand. The aptamer was label-free in this method. In the absence of MC-LR, the dapoxyl could bind to DAP-10, leading to a strong fluorescence intensity. In the presence of MC-LR, DAP-10 bound to the surface of SWNTs, resulting in a very weak fluorescence intensity. What is interesting is that the authors used the dye, dapoxyl. Dapoxyl is a very weak fluorescent dye in water, and usually its fluorescence intensity increases significantly in the presence of organic solvents. Similarly, when the dye binds with its aptamer, DAP-10, its fluorescence intensity is enhanced dramatically because its surrounding environment becomes less polar compared to its environment in water when the dye is free. The authors applied the unique property of the dye and designed the new label-free aptasensor.

Toxins 2018, 10, 427

Toxins 2018, 10, x FOR PEER REVIEW

15 of 26

18 of 26

Figure 9. Fluorescence (FL)-based aptasensors using up-conversion fluorescence or down-conversion Figure 9. Fluorescence (FL)-based aptasensors using up-conversion fluorescence or fluorescence. (a) Scheme of a Fe3 O4 /aptamer/CDs nanocomposites-based aptasensor for okadaic acid down-conversion fluorescence. (a) Scheme of a Fe3O4/aptamer/CDs nanocomposites-based (OA) detection (Scheme was drawn according to the text description and the original Scheme 1 aptasensor for okadaic acid (OA) detection (Scheme was drawn according to the text description of Ref. [66]). CDs, carbon dots. UCF, up-conversion fluorescence. (b) Scheme of a CS-UCNPs and the original Scheme 1 of Ref. [66]). CDs, carbon dots. UCF, up-conversion fluorescence. (b) and MoS2 -assisted FL-based aptasensor for MC-LR detection (Scheme was drawn according to the Scheme of a CS-UCNPs and MoS2-assisted FL-based aptasensor for MC-LR detection (Scheme was text description and the original Scheme 1 of Ref. [91]). (c) Scheme of a dual FRET aptasensor for drawn according to the text description and the original Scheme 1 of Ref. [91]). (c) Scheme of a dual simultaneous detection of MC-LR and OA (Scheme was drawn according to the text description and FRET aptasensor for simultaneous detection of MC-LR and OA (Scheme was drawn according to the Toxins 10, xFigure FOR PEER 19 of 26 the 2018, original 1 of REVIEW Ref. [92]). text description and the original Figure 1 of Ref. [92]).

Another nanomaterial, single-walled carbon nanotubes (SWNTs), was used in a FL-based aptasensor constructed by Taghdisi et al. in 2017 [93]. The authors developed a simple fluorescent aptasensor for rapid detection of MC-LR using the aptamer, AN6. SWNTs were used as immobilizers owing to their unique properties of mechanical stability and large surface area. As shown in Figure 10, SWNTs were used as immobilizers, dapoxyl was used as afluorescent dye, DAP-10 was used as a specific aptamer for dapoxyl, and unmodified AN6 was used as a sensing ligand. The aptamer was label-free in this method. In the absence of MC-LR, the dapoxyl could bind to DAP-10, leading to a strong fluorescence intensity. In the presence of MC-LR, DAP-10 bound to the surface of SWNTs, resulting in a very weak fluorescence intensity. What is interesting is that the authors used the dye, dapoxyl. Dapoxyl is a very weak fluorescent dye in water, and usually its fluorescence intensity increases significantly in the presence of organic solvents. Similarly, when the dye binds with its aptamer, DAP-10, its fluorescence intensity is enhanced dramatically because its surrounding environment becomes less polar compared to its Figure 10. Scheme of a single-walled carbon nanotubes (SWNTs)-assisted fluorescence (FL)-based environment water when the dye iscarbon free. The authors applied the unique property of the dye Figure 10.in Scheme of a single-walled nanotubes (SWNTs)-assisted fluorescence (FL)-based aptasensor for MC-LR detection (Scheme was drawn according to the text description and the and designed label-free aptasensorthe for new MC-LR detectionaptasensor. (Scheme was drawn according to the text description and the original original 1 of Ref. [93]). Scheme 1 ofScheme Ref. [93]).

Some fluorophores have specific properties and can be applied during the FL-based aptasensor development. In 2015, Alfaro et al. [94] reported the first design of a label-free fluorescent aptasensor for STX detection, using the Evagreen and anti-STX aptamer (APTSTX). The STX contributed to the secondary structure stability of APTSTX, resulting in a different double-stranded configuration

Toxins 2018, 10, 427

16 of 26

Some fluorophores have specific properties and can be applied during the FL-based aptasensor development. In 2015, Alfaro et al. [94] reported the first design of a label-free fluorescent aptasensor for STX detection, using the Evagreen and anti-STX aptamer (APTSTX ). The STX contributed to the secondary structure stability of APTSTX , resulting in a different double-stranded configuration compared to that of the free aptamer. Increased stability of the aptamer bound to the STX was verified by the distinct melting profiles observed in high resolution melting assay (HRM). Fluorescence from STX-binding aptamers ranged when exposed to different concentrations of STX, and thus the quantitation of STX was achieved. The high specificity of the aptasensor was tested using GTX2/3 as a control. However, the authors found the quantitation correlation fell dramatically when quantifying STX in a rough shellfish extract. This was probably caused by the relatively low affinity of APTSTX for STX. In 2017, Gu et al. [95] developed a competitive fluorophore-linked aptamer assay based on rolling circle amplification (RCA) for OA detection using OA34. As shown in Figure 11, biotinylated OA34 was firstly immobilized on the streptavidin coating microwells, and was then hybridized with an aptamer complementary sequence-primer complex. Then RCA reaction was performed to produce a long ssDNA with tandem repeated copies of complementary sequence of the circular DNA template. A large number of FAM (carboxyfluorescein) labeled signal probe was then added to introduce fluorescent signal probes. With the presence of OA in the samples, it would competitively bind with the immobilized aptamer, and led to a large number of detection probes releasing to the supernatant. The supernatant was then collected, and the fluorescence intensity was monitored for quantitation. An excellent LOD at 1 pg/mL was achieved and the aptasensor showed high selectivity towards OA, and almost no interference was observed by DTX-1, DTX-2, STX and DA. The fluorescence suppliers have specific properties, and aptamers are easily combined with them to develop FL-based aptasensors. Maybe more techniques about nucleic acids amplification can be introduced as toPEER further improve the sensitivity of FL-based aptasensors. Toxins 2018, 10,so x FOR REVIEW 20 of 26

Figure 11. 11.Scheme Scheme a competitive fluorophore-linked aptasensor based circle on rolling circle of aofcompetitive fluorophore-linked aptasensor based on rolling amplification amplification (RCA) for(OA) okadaic acid (Scheme (OA) detection (Scheme was to drawn according to the (RCA) for okadaic acid detection was drawn according the text description andtext the description and1the original original Figure of Ref. [94]).Figure 1 of Ref. [94]).

3.4. Enzyme Enzyme Linked Linked Aptamer Aptamer Assay Assay (ELAA)-Based (ELAA)-Based Aptasensors Aptasensors 3.4. ELISA isisa aclassical analytial method for rapid detection, with thewith advantages of high sensitivity, ELISA classical analytial method for rapid detection, the advantages of high easy operation, high throughput; however, application ELISA in marine biotoxin detection was sensitivity, easyand operation, and high throughput; however,ofapplication of ELISA in marine biotoxin detection was limited because of the limited availability of antibodies. Aptamers can be combined with enzyme to develop enzyme-linked aptamer assay (ELAA) for marine biotoxin detection. In 2016, Tian et al. [64] reported an indirect competitive ELAA-based aptasensor for BTX-2 detection using aptamer Bap5, with the scheme shown in Figure 12. BTX-2-OVA conjugate was immobilized on the bottom of the microwells. A fixed number of biotin-labeled Bap5 was completed

Toxins 2018, 10, 427

17 of 26

limited because of the limited availability of antibodies. Aptamers can be combined with enzyme to develop enzyme-linked aptamer assay (ELAA) for marine biotoxin detection. In 2016, Tian et al. [64] reported an indirect competitive ELAA-based aptasensor for BTX-2 detection using aptamer Bap5, with the scheme shown in Figure 12. BTX-2-OVA conjugate was immobilized on the bottom of the microwells. A fixed number of biotin-labeled Bap5 was completed by the immobilized BTX-2 and the free BTX-2 in the samples. After washing, horseradish peroxidase (HRP)-conjugated streptavidin was added to introduce the HRP enzyme via the specific binding between streptavidin and biotin. After washing, o-phenylenediamine/H2 O2 solution was added and the enzyme-catalyzed reaction began. The reaction was stopped by the addition of acid. The optical density was measured for quantitation. A LOD of 3.125 ng/mL was obtained, and this sensitivity was greater than that of the NSP (neurotoxic shellfsh poison) ELISA kit for OA (Abraxis, America, Product No. PN520026). ELISA is a kind of typical on-site detection method with a commercial absorbance reader and a mature operation protocol, while the production of the antibody of the marine biotoxins is complicated and has high cost. The study herein can be referred for other kinds of marine biotoxins. More aptamers can be used to develop ELAA-based aptasensors for marine biotoxins. Toxins 2018, 10, x FOR PEER REVIEW

21 of 26

Figure12.12. Scheme an indirect competitive enzyme-linked aptamer assay (ELAA)-based Figure Scheme of anofindirect competitive enzyme-linked aptamer assay (ELAA)-based aptasensor aptasensor for BTX-2 detection was drawn to the textof description for BTX-2 detection (Scheme was(Scheme drawn according to according the text description Ref. [64]). of Ref. [64]).

3.5. 3.5.Detailed DetailedInformation Informationofofthe theReported ReportedAptasensors Aptasensorsfor forMarine MarineBiotoxin BiotoxinDetection Detection The Theabove aboveare arethe therecent recentadvances advancesofofaptasensors aptasensorsfor formarine marinebiotoxin biotoxindetection. detection.For Forfurther further understanding, understanding,we wesummarized summarizedthe theLOD LODand andlinear lineardetection detectionrange, range,as aswell wellas asother otherinformation informationof of the reported aptasensors in Table 2, and obtained the following summative points: the reported aptasensors in Table 2, and obtained the following summative points:

(a) Firstly, Firstly,all allofofthe thereported reported aptasensors achieved high sensitivity, almost of them have (a) aptasensors achieved high sensitivity, and and almost all ofall them have been been validated by real samples. Aptasensors show obvious for advantages for ultrasensitive sensitive and validated by real samples. Aptasensors show obvious advantages sensitive and ultrasensitive detection of marine biotoxins in the real world, compared with the HPLC or MS detection of marine biotoxins in the real world, compared with the HPLC or MS method. method. LODs of the all theaptasensors reported aptasensors are low enough forbiotxins the marine biotxins The LODsThe of the all the reported are low enough for the marine monitoring. monitoring. LOD of 80% of the reported aptasensors is lower than or equal to 1 ng/mL, LODof of LOD of 80% of the reported aptasensors is lower than or equal to 1 ng/mL, LOD of 73% 73% of the aptasensors is lower than or equal to 0.5 ng/mL, LOD of 33% of the aptasensors the aptasensors is lower than or equal to 0.5 ng/mL, LOD of 33% of the aptasensors is loweris lowerorthan or equal 0.05 ng/mL, is even as low 0.00004 ng/mL.While WhileLOD LOD than equal to 0.05tong/mL, and and somesome LODLOD is even as low as as 0.00004 ng/mL. methods are based on HPLC or MS, they can only achieve LOD at a 1 ng/mL level [23–28]. For methods are based on HPLC or MS, they can only achieve LOD at a 1 ng/mL level [23–28]. example, in 2015, Bragg et al. [25] developed an online solid phase extraction hydrophilic For example, in 2015, Bragg et al. [25] developed an online solid phase extraction hydrophilic interaction liquid liquid chromatography chromatography (HILIC) (HILIC) method method for for the the analysis analysis of ofSTX STXand andneosaxitoxin neosaxitoxin interaction (NEO) in human urine with tandem mass spectrometry, and obtained a LOD at 1.01 ng/mL (NEO) in human urine with tandem mass spectrometry, and obtained a LOD at 1.01 ng/mL and and ng/mL, 2.62 ng/mL, respectively. A newly reported inby 2018 byetDom et al. [96], uses which uses 2.62 respectively. A newly reported studystudy in 2018 Dom al. [96], which liquid liquid chromatography coupled with high resolution mass spectrometry (LC-HRMS) can only chromatography coupled with high resolution mass spectrometry (LC-HRMS) can only achieve a achieve a LOD at 1.1~337 ng/g for 18 kinds of marine biotoxins detection. Rey et al. used an improved liquid chromatography coupled with mass spectrometry (LC-MS) for the detection of paralytic shellfish toxins [97]. They tested 15 kinds of biotoxins in four kinds of real samples, and the LOD of the 15 × 14 samples ranged from 0.387 to 55.844 ng/g. (b) Secondly, the sensitivity of the BLI-based aptasensor is relatively higher, showing great

Toxins 2018, 10, 427

(b)

(c)

18 of 26

LOD at 1.1~337 ng/g for 18 kinds of marine biotoxins detection. Rey et al. used an improved liquid chromatography coupled with mass spectrometry (LC-MS) for the detection of paralytic shellfish toxins [97]. They tested 15 kinds of biotoxins in four kinds of real samples, and the LOD of the 15 × 14 samples ranged from 0.387 to 55.844 ng/g. Secondly, the sensitivity of the BLI-based aptasensor is relatively higher, showing great advantages in sensitive detection. However, the linear detection range of BLI-based aptasensors was relatively narrow. This may be caused by the limited chip surface space and limited number of immobilized molecules. Thirdly, when compared with other biological alternative methods, the reported aptasensors showed great advantages, as most of the aptasensors achieved LOD below 1 ng/mL. In recent years (from 2014 to now), there are some other alternative methods reported for marine biotoxin detection, such as the cell-based impedance biosensor [98], the SPR (surface plasmon resonance) immunosensor [99], the immunochromatographic sensor [8], and so on. However, most of these alternatives only obtained LOD at about 5 ng/mL. The obvious difference may be due to the higher affinity of the aptamers and the superiority of the aptamers to be easily combined with advanced sensitive transducers. In short, the development of aptasensors promotes the development of marine biotoxin detection.

Toxins 2018, 10, 427

19 of 26

Table 2. Detailed information of the developed aptasensors for marine biotoxin detection. Target

Aptamer

Aptasensor

Year

Linear detection Range (ng/mL) a

LOD (ng/mL) a

Samples

References

GTX1/4 STX PTX OA ATX BTX-2 OA MC-LR TTX MC-LR

GO18-T-d M-30f PTX-13 OA34 ATX8 BT10 OA34 AN6 G11-T AN6 AN6 for MC-LR and OA34 for OA AN6 APTSTX OA34 Bap5

BLI-based BLI-based BLI-based EC-based EC-based EC-based EC-based EC-based FL-based FL-based

2016 2017 2017 2013 2015 2015 2017 2018 2017 2017

0.2~200 0.1~0.8 0.2~0.7 0.1~60 1~100 0.01~2000 5~100 5.0 × 10−5 ~248.8 0.1~100,000 0.01~50

0.05 0.5 0.00004 0.07 0.5 0.106 1 2.0 0.06 0.002 0.025 for MC-LR and 0.05 for OA 0.137 7.5 0.001 3.125

shellfish shellfish shellfish, seawater shellfish drinking water, certified samples shellfish, mussel buffer water fish water

[72] [80] [61] [62] [71] [63] [84] [85] [66] [91]

water, shrimps, fish

[92]

water, serum samples gastric juice, serum, urine shellfish buffer

[93] [94] [95] [64]

MC-LR and OA MC-LR STX OA BTX-2

FL-based

2015

0.1~50

FL-based FL-based FL-based ELAA-based

2017 2015 2017 2016

0.4~1194 15~3000 0.001~100 3.125~200

a

converted to be ng/mL for easy comparison. LOD, limit of detection.

Toxins 2018, 10, 427

20 of 26

4. Perspectives Although there have been many advances in the detection of marine biotoxins, there is still a lot of work that needs to be done. More effort is needed for the further study of aptamer selection, recognition mechanism, and aptasensor development. (a)

(b)

(c)

Firstly, more efforts need to be made to select more aptamers for marine biotoxins. There are only 15 aptamers selected, while there are more than 1000 kinds of marine biotoxins identified in the world. A large number of aptamers is urgently needed. The beads-SELEX and Mag-beads-SELEX can be widely used, referring to the success in the reported selections. The GO-SELEX can be referred, especially for those marine biotoxins that are very small or hard to be immobilized. In addition, some other frontier methods achieve efficient selection [35,100–102], such as capillary electrophoresis-SELEX (CE-SELEX) and microfluidic SELEX. CE-SELEX has high-efficiency separation capabilities, and does not need immobilization [103–105]. Microfluidic SELEX combines microfluidic chip technology into the aptamer screening process, and can achieve rapid automated selection [106,107]. Secondly, the binding mechanism of each marine biotoxin and its aptamer needs to be further studied. Although many aptamers and aptasensors have been developed, the binding mechanism is not clear. So far, most studies concerning aptamer structures stop with Mfold prediction. However, as shown in Table 1, some of the aptamers have one stem and some of them have more than two. Information from secondary structures is not enough for the mechanism study. Further study should be explored, such as the tertiary structure and molecule docking. Only one study concerning the binding format of the aptamer and marine biotoxin was reported. In 2018, Cheng et al. reported their study about binding the way between STX and its aptamer, M-30f [108]. The authors used the circular dichroism spectra, fluorophore and quencher labeled aptamer, and crystal violet based assays to identify the binding way between STX and aptamer. The results show that the conformation of the aptamer is stabilized in PBS buffer (10 mM phosphate buffer, 2.7 mM KCl, 137 mM NaCl, pH 7.4) and K+ plays an important role in conformation stability, and this conformation may provide a suitable cave for STX binding. We have been conducting research on the recognition mechanism. We once analyzed the binding between tetracycline and its aptamer [109], using the computational prediction and isothermal titration calorimetry (ITC) experiment. The conformational tertiary structure and the potential binding sites of the aptamer were predicted by computational study and proved by chemical experiment. Our study provides a reference, and other methods [43,89,110] can be further referred. Thirdly, more kinds of aptasensors can be developed. The present aptasensors for marine biotoxins are mainly BLI-based, EC-based, FL-based, and ELAA-based aptasensors. Aptamers show great advantages in terms of easy labeling and easy fabrication. Many other methods can be explored so as to achieve on-site detection with high throughput, visual characters, and high portability. In recent years, various aptasensors have been used to detect various kinds of small molecules, such as optical, mass-dependent, lateral flow chromatography-based aptasensors [75,86,111–113], and so on. We also developed several kinds of aptasensors for small molecules, such as the indirect competitive [114] and direct competitive [115] ELAA-based aptasensors, AuNPs-based aptasensor, [116] and a SPR-based aptasensor [117]. All of these three kinds of aptasensors performed well for highly sensitive and specific detection. And all of these reported aptasensors can be used to develop more aptasensors for marine biotoxin detection.

In short, future studies should aim to develop new aptamers and new aptasensors so as to strictly monitor the marine biotoxins with highly sensitive and specific methods and to ensure the safety of consumers. Moreover, more attention should be paid to the binding mechanism study so as to understand the fundamental science of the aptamer. Author Contributions: Investigation, S.W. and X.L.; Resources, L.Z., Y.H., and X.H.; Writing-Original Draft Preparation, L.Z. and S.W.; Writing-Review & Editing, Y.D.

Toxins 2018, 10, 427

21 of 26

Funding: This research was funded by National natural science foundation of China No. 31801620, Special Foundation for Basic Research Program of Qingdao in 2018 No. 18-2-2-24-jch, China Postdoctoral Science Foundation No. 2017M622271, Open Research Program of State Key Laboratory of Chemo/Biosensing and Chemometrics (Hunan University) No. 2017009, and Qingdao Postdoctoral Application Foundation. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References 1. 2.

3. 4.

5. 6. 7.

8.

9. 10. 11. 12.

13. 14. 15.

16.

17.

18.

Vilariño, N.; Fonfría, E.S.; Louzao, M.C.; Botana, L.M. Use of biosensors as alternatives to current regulatory methods for marine biotoxins. Sensors 2009, 9, 9414–9443. [CrossRef] [PubMed] Turner, A.D.; Higgins, C.; Davidson, K.; Veszelovszki, A.; Payne, D.; Hungerford, J.; Higman, W. Potential threats posed by new or emerging marine biotoxins in UK waters and examination of detection methodology used in their control: Brevetoxins. Mar. Drugs 2015, 13, 1224–1254. [CrossRef] [PubMed] Rodríguez, I.; Vieytes, M.R.; Alfonso, A. Analytical challenges for regulated marine toxins. Detection methods. Curr. Opin. Food Sci. 2017, 18, 29–36. [CrossRef] Volpe, G.; Cozzi, L.; Migliorelli, D.; Croci, L.; Palleschi, G. Development of a haemolytic–enzymatic assay with mediated amperometric detection for palytoxin analysis: Application to mussels. Anal. Bioanal. Chem. 2014, 406, 2399–2410. [CrossRef] [PubMed] Alsabi, A.; Mcarthur, J.; Ostroumov, V.; French, R.J. Marine toxins that target voltage-gated sodium channels. Mar. Drugs 2006, 4, 157–192. [CrossRef] Louzao, M.C.; Ares, I.R.; Cagide, E. Marine toxins and the cytoskeleton: A new view of palytoxin toxicity. FEBS J. 2008, 275, 6067–6074. [CrossRef] [PubMed] Hinder, S.L.; Hays, G.C.; Brooks, C.J.; Davies, A.P.; Edwards, M.; Walne, A.W.; Gravenor, M.B. Toxic marine microalgae and shellfish poisoning in the British Isles: History, review of epidemiology, and future implications. Environ. Health 2011, 10, 54. [CrossRef] [PubMed] Liu, B.; Hung, C.; Lu, C.; Chou, H.; Yu, F. Production of monoclonal antibody for okadaic acid and its utilization in an ultrasensitive enzyme-linked immunosorbent assay and one-step immunochromatographic strip. J. Agric. Food Chem. 2014, 62, 1254–1260. [CrossRef] [PubMed] Gallardorodríguez, J.; Sánchezmirón, A.; Garcíacamacho, F.; Lópezrosales, L.; Chisti, Y.; Molinagrima, E. Bioactives from microalgal dinoflagellates. Biotechnol. Adv. 2012, 30, 1673–1684. [CrossRef] [PubMed] Miyazawa, K.; Noguchi, T. Distribution and origin of tetrodotoxin. J. Toxicol. Toxin Rev. 2001, 20, 11–33. [CrossRef] Narahashi, T. Pharmacology of tetrodotoxin. J. Toxicol. Toxin Rev. 2001, 20, 67–84. [CrossRef] Shang, F.; Liu, Y.; Wang, S. Simple electrochemiluminescence sensor based on nafion-graphene-ru(bpy) 3 2+ modified electrode for the ultrasensitive detection of tetrodotoxin. J. Electrochem. Soc. 2016, 163, B280–B285. [CrossRef] Park, D.L.; Adams, W.N.; Graham, S.L.; Jackson, R.C. Variability of mouse bioassay for determination of paralytic shellfish poisoning toxins. J. Assoc. Off. Anal. Chem. 1986, 69, 547–550. [PubMed] Etheridge, S.M. Paralytic shellfish poisoning: Seafood safety and human health perspectives. Toxicon 2010, 56, 108–122. [CrossRef] [PubMed] Vale, P.; Taleb, H. Assessment of the quantitative determination of paralytic shellfish poisoning toxins by pre-column derivatization and elimination of interfering compounds by solid-phase extraction. Food Addit. Contam. 2005, 22, 838–846. [CrossRef] [PubMed] Turrell, E.A.; Stobo, L. A comparison of the mouse bioassay with liquid chromatography-mass spectrometry for the detection of lipophilic toxins in shellfish from Scottish waters. Toxicon 2007, 50, 442–447. [CrossRef] [PubMed] Kralovec, J.A.; Laycock, M.V.; Richards, R.; Usleber, E. Immobilization of small molecules on solid matrices: A novel approach to enzyme-linked immunosorbent assay screening for saxitoxin and evaluation of anti-saxitoxin antibodies. Toxicon 1996, 34, 1127–1140. [CrossRef] Malaguti, C.; Milandri, A.; Poletti, R.; Rossini, G.P. Cytotoxic responses to unfractionated extracts from digestive glands of mussels. Toxicon 2002, 40, 573–578. [CrossRef]

Toxins 2018, 10, 427

19. 20.

21. 22. 23.

24.

25.

26.

27.

28. 29. 30. 31.

32.

33.

34.

35.

36. 37.

38.

22 of 26

Quilliam, M.A.; Thomas, K.; Wright, J.L.C. Analysis of domoic acid in shellfish by thin-layer chromatography. Nat. Toxins 1998, 6, 147–152. [CrossRef] Prassopoulou, E.; Katikou, P.; Georgantelis, D.; Kyritsakis, A. Detection of okadaic acid and related esters in mussels during diarrhetic shellfish poisoning (DSP) episodes in greece using the mouse bioassay, the pp2a inhibition assay and hplc with fluorimetric detection. Toxicon 2009, 53, 214–227. [CrossRef] [PubMed] Ikehara, T.; Imamura, S.; Yoshino, A.; Yasumoto, T. Pp2a inhibition assay using recombinant enzyme for rapid detection of okadaic acid and its analogs in shellfish. Toxins 2010, 2, 195–204. [CrossRef] [PubMed] Poli, M.A.; Rein, K.S.; Baden, D.G. Radioimmunoassay for pbtx-2-type brevetoxins: Epitope specificity of two anti-pbtx sera. J. AOAC Int. 1995, 78, 538–542. [PubMed] Huang, C.; Xiao-Jing, L.I.; Peng, R.F.; Hong, Y.U. Determination of 7 lipophilic shellfish toxins in shellfish by spe and high performance liquid chromatography-tandem mass spectrometry. Chin. J. Health Lab. Technol. 2011, 21, 1075–1077. Jen, H.C.; Nguyen, A.T.; Wu, Y.J.; Hoang, T.; Arakawa, O.; Lin, W.F.; Hwang, D.F. Tetrodotoxin and paralytic shellfish poisons in gastropod species from Vietnam analyzed by high-performance liquid chromatography and liquid chromatography-tandem mass spectrometry. J. Food Drug Anal. 2014, 22, 178–188. [CrossRef] Bragg, W.A.; Lemire, S.W.; Coleman, R.M.; Hamelin, E.I.; Johnson, R.C. Detection of human exposure to saxitoxin and neosaxitoxin in urine by online-solid phase extraction-liquid chromatography-tandem mass spectrometry. Toxicon 2015, 99, 118–124. [CrossRef] [PubMed] Lawrence, J.F.; Niedzwiadek, B.; Menard, C. Quantitative determination of paralytic shellfish poisoning toxins in shellfish using prechromatographic oxidation and liquid chromatography with fluorescence detection: Interlaboratory study. J. AOAC Int. 2004, 88, 1714–1732. Plakas, S.M.; Jester, E.L.; El Said, K.R.; Granade, H.R.; Abraham, A.; Dickey, R.W.; Scott, P.S.; Flewelling, L.J.; Henry, M.; Blum, P. Monitoring of brevetoxins in the karenia brevis bloom-exposed eastern oyster (Crassostrea virginica). Toxicon 2008, 52, 32–38. [CrossRef] [PubMed] Wang, Z.; Ramsdell, J.S. Analysis of interactions of brevetoxin-b and human serum albumin by liquid chromatography/mass spectrometry. Chem. Res. Toxicol. 2011, 24, 54–64. [CrossRef] [PubMed] Plakas, S.M.; Dickey, R.W. Advances in monitoring and toxicity assessment of brevetoxins in molluscan shellfish. Toxicon 2010, 56, 137–149. [CrossRef] [PubMed] Wharton, R.E.; Feyereisen, M.C.; Gonzalez, A.L.; Abbott, N.L.; Hamelin, E.I.; Johnson, R.C. Quantification of saxitoxin in human blood by ELISA. Toxicon 2017, 133, 110–115. [CrossRef] [PubMed] Dubois, M.; Demoulin, L.; Charlier, C.; Singh, G.; Godefroy, S.B.; Campbell, K.; Elliott, C.T.; Delahaut, P. Development of ELISAs for detecting domoic acid, okadaic acid, and saxitoxin and their applicability for the detection of marine toxins in samples collected in Belgium. Food Addit. Contam. 2010, 27, 859–868. [CrossRef] [PubMed] Garthwaite, I.; Ross, K.M.; Miles, C.O.; Briggs, L.R.; Towers, N.R.; Borrell, T.; Busby, P. Integrated enzyme-linked immunosorbent assay screening system for amnesic, neurotoxic, diarrhetic, and paralytic shellfish poisoning toxins found in New Zealand. J. AOAC Int. 2001, 84, 1643–1648. [PubMed] Szkola, A.; Linares, E.M.; Worbs, S.; Dorner, B.G.; Dietrich, R.; Märtlbauer, E.; Niessner, R.; Seidel, M. Rapid and simultaneous detection of ricin, staphylococcal enterotoxin b and saxitoxin by chemiluminescence-based microarray immunoassay. Analyst 2014, 139, 5885–5892. [CrossRef] [PubMed] Haughey, S.A.; Campbell, K.; Yakes, B.J.; Prezioso, S.M.; Degrasse, S.L.; Kawatsu, K.; Elliott, C.T. Comparison of biosensor platforms for surface plasmon resonance based detection of paralytic shellfish toxins. Talanta 2011, 85, 519–526. [CrossRef] [PubMed] Wu, J.; Zhu, Y.; Feng, X.; Mei, Z.; Li, Y.; Xin, W.; Lei, Z.; Jian, L.; Liu, G.; Peng, C. Recent trends in SELEX technique and its application to food safety monitoring. Microchim. Acta 2014, 181, 479–491. [CrossRef] [PubMed] Duan, N.; Wu, S.; Dai, S.; Gu, H.; Hao, L.; Ye, H.; Wang, Z. Advances in aptasensors for the detection of food contaminants. Analyst 2016, 141, 3942–3961. [CrossRef] [PubMed] Bostan, H.B.; Danesh, N.M.; Karimi, G.; Ramezani, M.; Shaegh, S.A.M.; Youssefi, K.; Charbgoo, F.; Abnous, K.; Taghdisi, S.M. Ultrasensitive detection of ochratoxin a using aptasensors. Biosens. Bioelectron. 2017, 98, 168–179. [CrossRef] [PubMed] Dong, Y.; Xu, Y.; Yong, W.; Chu, X.; Wang, D. Aptamer and its potential applications for food safety. Crit. Rev. Food Sci. Nutr. 2014, 54, 1548–1561. [CrossRef] [PubMed]

Toxins 2018, 10, 427

39. 40. 41. 42.

43. 44.

45. 46. 47.

48.

49. 50. 51.

52. 53. 54. 55. 56. 57.

58. 59.

60.

23 of 26

Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage t4 DNA polymerase. Science 1990, 249, 505–510. [CrossRef] [PubMed] Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [CrossRef] [PubMed] Amayagonzalez, S.; Delossantosalvarez, N.; Mirandaordieres, A.J.; Lobocastanon, M.J. Aptamer-based analysis: A promising alternative for food safety control. Sensors 2013, 13, 16292–16311. [CrossRef] [PubMed] Van Dorst, B.; Mehta, J.; Bekaert, K.M.; Rouahmartin, E.; De Coen, W.; Dubruel, P.; Blust, R.; Robbens, J. Recent advances in recognition elements of food and environmental biosensors: A review. Biosens. Bioelectron. 2010, 26, 1178–1194. [CrossRef] [PubMed] Hermann, T.; Patel, D.J. Adaptive recognition by nucleic acid aptamers. Science 2000, 287, 820–825. [CrossRef] [PubMed] Pagratis, N.C.; Chang, B.Y.F.; Jennings, S.; Fitzwater, T.; Jellinek, D.; Dang, C. Potent 20 -amino-, 20 -fluoro-20 -deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat. Biotechnol. 1997, 15, 68–73. [CrossRef] [PubMed] Lee, J.H.; Yigit, M.V.; Mazumdar, D.; Lu, Y. Molecular diagnostic and drug delivery agents based on aptamer-nanomaterial conjugates. Adv. Drug Deliv. Rev. 2010, 62, 592–605. [CrossRef] [PubMed] Weigand, J.E.; Wittmann, A.; Suess, B. RNA-based networks: Using RNA aptamers and ribozymes as synthetic genetic devices. Methods Mol. Boil. 2012, 813, 157–168. Geiger, A.; Burgstaller, P.; Von, d.E.H.; Roeder, A.; Famulok, M. RNA aptamers that bind L-arginine with sub-micromolar dissociation constants and high enantioselectivity. Nucleic Acids Res. 1996, 24, 1029–1036. [CrossRef] [PubMed] White, R.J.; Phares, N.; Lubin, A.A.; Xiao, Y.; Plaxco, K.W. Optimization of electrochemical aptamer-based sensors via optimization of probe packing density and surface chemistry. Langmuir ACS J. Surf. Colloids 2008, 24, 10513–10518. [CrossRef] [PubMed] Pang, S.; Labuza, T.P.; He, L. Development of a single aptamer-based surface enhanced raman scattering method for rapid detection of multiple pesticides. Analyst 2014, 139, 1895–1901. [CrossRef] [PubMed] Malekzad, H.; Jouyban, A.; Hasanzadeh, M.; Shadjou, N.; Guardia, M.D.L. Ensuring food safety using aptamer based assays: Electroanalytical approach. TrAC Trends Anal. Chem. 2017, 94, 77–94. [CrossRef] Bostana, H.B.; Taghdisib, S.M.; Bowenc, J.L.; Demertzisc, N.; Rezaeed, R.; Panahia, Y.; Tsatsakise, A.M.; Karimi, G. Determination of microcystin-LR, employing aptasensors. Biosens. Bioelectron. 2018, 119, 110–118. [CrossRef] [PubMed] Cunha, I.; Biltes, R.; Sales, M.; Vasconcelos, V. Aptamer-based biosensors to detect aquatic phycotoxins and cyanotoxins. Sensors 2018, 18, 2367. [CrossRef] [PubMed] Sefah, K.; Shangguan, D.; Xiong, X.; O’Donoghue, M.B.; Tan, W. Development of DNA aptamers using Cell-SELEX. Nat. Protoc. 2010, 5, 1169–1185. [CrossRef] [PubMed] Ellington, A.D.; Szostak, J.W. Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Nature 1992, 355, 850–852. [CrossRef] [PubMed] Sekella, P.T.; Rueda, D.; Walter, N.G. A biosensor for theophylline based on fluorescence detection of ligand-induced hammerhead ribozyme cleavage. RNA-A Publ. RNA Soc. 2002, 8, 1242–1252. [CrossRef] Stoltenburg, R.; Reinemann, C.; Strehlitz, B. Selex—A (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 2007, 24, 381–403. [CrossRef] [PubMed] Lin, C.; Liu, Z.; Wang, D.; Li, L.; Hu, P.; Gong, S.; Li, Y.; Cui, C.; Wu, Z.; Gao, Y. Generation of internal-image functional aptamers of okadaic acid via magnetic-bead SELEX. Mar. Drugs 2015, 13, 7433–7445. [CrossRef] [PubMed] Nguyen, V.T.; Kwon, Y.S.; Kim, J.H.; Gu, M.B. Multiple GO-SELEX for efficient screening of flexible aptamers. Chem. Commun. 2014, 50, 10513–10516. [CrossRef] [PubMed] Duan, Y.; Gao, Z.; Wang, L.; Wang, H.; Zhang, H.; Li, H. Selection and identification of chloramphenicol-specific DNA aptamers by Mag-SELEX. Appl. Biochem. Biotechnol. 2016, 180, 1644–1656. [CrossRef] [PubMed] Paniel, N.; Istamboulié, G.; Triki, A.; Lozano, C.; Barthelmebs, L.; Noguer, T. Selection of DNA aptamers against penicillin g using capture-selex for the development of an impedimetric sensor. Talanta 2016, 162, 232–240. [CrossRef] [PubMed]

Toxins 2018, 10, 427

61. 62. 63. 64.

65.

66.

67. 68. 69.

70.

71.

72.

73. 74. 75. 76. 77. 78. 79.

80. 81. 82.

24 of 26

Gao, S.; Zheng, X.; Hu, B.; Sun, M.; Wu, J.; Jiao, B.; Wang, L. Enzyme-linked, aptamer-based, competitive biolayer interferometry biosensor for palytoxin. Biosens. Bioelectron. 2017, 89, 952–958. [CrossRef] [PubMed] Eissa, S.; Ng, A.; Siaj, M.; Tavares, A.C.; Zourob, M. Selection and identification of DNA aptamers against okadaic acid for biosensing application. Anal. Chem. 2013, 85, 11794–11801. [CrossRef] [PubMed] Eissa, S.; Siaj, M.; Zourob, M. Aptamer-based competitive electrochemical biosensor for brevetoxin-2. Biosens. Bioelectron. 2015, 69, 148–154. [CrossRef] [PubMed] Tian, R.Y.; Lin, C.; Yu, S.Y.; Gong, S.; Hu, P.; Li, Y.S.; Wu, Z.C.; Gao, Y.; Zhou, Y.; Liu, Z.S. Preparation of a specific ssDNA aptamer for brevetoxin-2 using SELEX. J. Anal. Methods Chem. 2016, 2016, 9241860. [CrossRef] [PubMed] Ng, A.; Chinnappan, R.; Eissa, S.; Liu, H.; Tlili, C.; Zourob, M. Selection, characterization, and biosensing application of high affinity congener-specific microcystin-targeting aptamers. Environ. Sci. Technol. 2012, 46, 10697–10703. [CrossRef] [PubMed] Jin, H.; Gui, R.; Sun, J.; Wang, Y. Facilely self-assembled magnetic nanoparticles/aptamer/carbon dots nanocomposites for highly sensitive up-conversion fluorescence turn-on detection of tetrodotoxin. Talanta 2017, 176, 277–283. [CrossRef] [PubMed] Shao, B.; Gao, X.; Yang, F.; Chen, W.; Miao, T.; Peng, J. Screening and structure analysis of the aptamer against tetrodotoxin. J. Chin. Inst. Food Sci. Technol. 2012, 12, 137–143. Shao, B.Y.; Chen, B.; Chen, W.B.; Yang, F.; Miao, T.Y.; Peng, J. Preparation and application of tetrodotoxin DNA aptamer. Food Sci. 2014, 35, 205–208. Handy, S.M.; Yakes, B.J.; Degrasse, J.A.; Campbell, K.; Elliott, C.T.; Kanyuck, K.M.; Degrasse, S.L. First report of the use of a saxitoxin–protein conjugate to develop a DNA aptamer to a small molecule toxin. Toxicon 2013, 61, 30–37. [CrossRef] [PubMed] Zheng, X.; Hu, B.; Gao, S.X.; Liu, D.J.; Sun, M.J.; Jiao, B.H.; Wang, L.H. A saxitoxin-binding aptamer with higher affinity and inhibitory activity optimized by rational site-directed mutagenesis and truncation. Toxicon 2015, 101, 41–47. [CrossRef] [PubMed] Elshafey, R.; Siaj, M.; Zourob, M. DNA aptamers selection and characterization for development of label-free impedimetric aptasensor for neurotoxin anatoxin-a. Biosens. Bioelectron. 2015, 68, 295–302. [CrossRef] [PubMed] Gao, S.; Hu, B.; Zheng, X.; Cao, Y.; Liu, D.; Sun, M.; Jiao, B.; Wang, L. Gonyautoxin 1/4 aptamers with high-affinity and high-specificity: From efficient selection to aptasensor application. Biosens. Bioelectron. 2016, 79, 938–944. [CrossRef] [PubMed] Lim, Y.C.; Kouzani, A.Z.; Duan, W. Aptasensors: A review. J. Biomed. Nanotechnol. 2010, 6, 93–105. [CrossRef] [PubMed] Torreschavolla, E.; Alocilja, E.C. Aptasensors for detection of microbial and viral pathogens. Biosens. Bioelectron. 2009, 24, 3175–3182. [CrossRef] [PubMed] Kim, Y.S.; Raston, N.H.A.; Gu, M.B. Aptamer-based nanobiosensors. Biosens. Bioelectron. 2016, 76, 2–19. [PubMed] Wang, Z.; Yu, J.; Gui, R.; Jin, H.; Xia, Y. Carbon nanomaterials-based electrochemical aptasensors. Biosens. Bioelectron. 2016, 79, 136–149. [CrossRef] [PubMed] Ciesielski, G.L.; Hytönen, V.P.; Kaguni, L.S. Biolayer Interferometry: A Novel Method to Elucidate Protein-Protein and Protein-DNA Interactions in the Mitochondrial DNA Replisome; Springer: New York, NY, USA, 2016; p. 223. Kumaraswamy, S.; Tobias, R. Label-Free Kinetic Analysis of an Antibody-Antigen Interaction Using Biolayer Interferometry; Springer: New York, NY, USA, 2015; pp. 165–182. Concepcion, J.; Witte, K.; Wartchow, C.; Choo, S.; Yao, D.; Persson, H.; Wei, J.; Li, P.; Heidecker, B.; Ma, W. Label-free detection of biomolecular interactions using biolayer interferometry for kinetic characterization. Comb. Chem. High Throughput Screen. 2009, 12, 791–800. [CrossRef] [PubMed] Gao, S.; Zheng, X.; Wu, J. A biolayer interferometry-based competitive biosensor for rapid and sensitive detection of saxitoxin. Sens. Actuators B Chem. 2017, 246, 169–174. [CrossRef] Zhu, C.; Yang, G.; Li, H.; Du, D.; Lin, Y. Electrochemical sensors and biosensors based on nanomaterials and nanostructures. Anal. Chem. 2015, 87, 230–249. [CrossRef] [PubMed] Stradiotto, N.R.; Yamanaka, H.; Zanoni, M.V.B. Electrochemical sensors: A powerful tool in analytical chemistry. J. Braz. Chem. Soc. 2003, 14, 159–173. [CrossRef]

Toxins 2018, 10, 427

83. 84.

85.

86. 87. 88. 89.

90.

91. 92.

93.

94. 95. 96.

97.

98.

99.

100. 101. 102.

103.

25 of 26

Yu, J.; Zhang, Y.; Li, H.; Wan, Q.; Li, Y.; Yang, N. Electrochemical properties and sensing applications of nanocarbons: A comparative study. Carbon 2018, 129, 301–309. [CrossRef] Pan, Y.; Wan, Z.; Zhong, L.; Li, X.; Wu, Q.; Wang, J.; Wang, P. Label-free okadaic acid detection using growth of gold nanoparticles in sensor gaps as a conductive tag. Biomed. Microdevices 2017, 19, 33. [CrossRef] [PubMed] Tang, Y.F.; Chai, Y.; Liu, X.Q.; Li, L.L.; Yang, L.W.; Liu, P.P.; Zhou, Y.M.; Ju, H.X.; Cheng, Y.Z. A photoelectrochemical aptasensor constructed with core-shell CuS-TiO2 heterostructure for detection of microcystin-LR. Biosens. Bioelectron. 2018, 117, 224–231. [CrossRef] [PubMed] Wang, R.E.; Zhang, Y.; Cai, J.; Cai, W.; Gao, T. Aptamer-based fluorescent biosensors. Curr. Med. Chem. 2011, 18, 4175–4184. [CrossRef] [PubMed] Zheng, P.; Wu, N. Fluorescence and sensing applications of graphene oxide and graphene quantum dots: A review. Chem. Asian J. 2017, 12, 2343–2353. [CrossRef] [PubMed] Ma, F.; Li, Y.; Tang, B.; Zhang, C. Fluorescent biosensors based on single-molecule counting. Acc. Chem. Res. 2016, 49, 1722–1730. [CrossRef] [PubMed] Pilehvar, S.; Jambrec, D.; Gebala, M.; Schuhmann, W.; De Wael, K. Intercalation of proflavine in ssdna aptamers: Effect on binding of the specific target chloramphenicol. Electroanalysis 2015, 27, 1836–1841. [CrossRef] Lu, Z.; Chen, X.; Wang, Y.; Zheng, X.; Li, C.M. Aptamer based fluorescence recovery assay for aflatoxin b1 using a quencher system composed of quantum dots and graphene oxide. Microchim. Acta 2015, 182, 571–578. [CrossRef] Lv, J.J.; Zhao, S.; Wu, S.J.; Wang, Z.P. Upconversion nanoparticles grafted molybdenum disulfide nanosheets platform for microcystin-LR sensing. Biosens. Bioelectron. 2017, 90, 203–209. [CrossRef] [PubMed] Wu, S.; Duan, N.; Zhang, H.; Wang, Z. Simultaneous detection of microcysin-lr and okadaic acid using a dual fluorescence resonance energy transfer aptasensor. Anal. Bioanal. Chem. 2015, 407, 1303–1312. [CrossRef] [PubMed] Taghdisi, S.M.; Danesh, N.M.; Ramezani, M.; Ghows, N.; Shaegh, S.A.M.; Abnous, K. A novel fluorescent aptasensor for ultrasensitive detection of microcystin-LR based on single-walled carbon nanotubes and dapoxyl. Talanta 2017, 16, 187–192. [CrossRef] [PubMed] Alfaro, K.; Bustos, P.; Sullivan, C.O.; Conejeros, P. Facile and cost-effective detection of saxitoxin exploiting aptamer structural switching. Food Technol. Biotechnol. 2015, 53, 337–341. [CrossRef] [PubMed] Gu, H.; Hao, L.; Duan, N.; Wu, S.; Xia, Y.; Ma, X.; Wang, Z. A competitive fluorescent aptasensor for okadaic acid detection assisted by rolling circle amplification. Microchim. Acta 2017, 184, 2893–2899. [CrossRef] Dom, I.; Biré, R.; Hort, V.; Lavison-Bompard, G.; Nicolas, M.; Guérin, T. Extended targeted and non-targeted strategies for the analysis of marine toxins in mussels and oysters by (LC-HRMS). Toxins 2018, 10, 375. [CrossRef] [PubMed] Rey, V.; Botana, A.M.; Antelo, A.; Alvarez, M. Botana, L.M. Rapid analysis of paralytic shellfish toxins and tetrodotoxins by liquid chromatography-tandem mass spectrometry using a porous graphitic carbon column. Food Chem. 2018, 269, 166–172. [CrossRef] [PubMed] Zou, L.; Wu, C.; Wang, Q.; Zhou, J.; Su, K.; Li, H.; Hu, N.; Wang, P. An improved sensitive assay for the detection of psp toxins with neuroblastoma cell-based impedance biosensor. Biosens. Bioelectron. 2015, 67, 458–464. [CrossRef] [PubMed] Garibo, D.; Campbell, K.; Casanova, A.; Iglesia, P.D.L.; Fernández-Tejedor, M.; Diogène, J.; Elliott, C.T.; Campàs, M. Spr immunosensor for the detection of okadaic acid in mussels using magnetic particles as antibody carriers. Sens. Actuators B Chem. 2014, 190, 822–828. [CrossRef] Gopinath, S.C.B. Methods developed for SELEX. Anal. Bioanal. Chem. 2006, 387, 171–182. [CrossRef] [PubMed] Darmostuk, M.; Rimpelova, S.; Gbelcova, H.; Ruml, T. Current approaches in SELEX: An update to aptamer selection technology. Biotechnol. Adv. 2015, 33, 1141–1161. [CrossRef] [PubMed] Zhuo, Z.; Yu, Y.; Wang, M.; Li, J.; Zhang, Z.; Liu, J.; Wu, X.; Lu, A.; Zhang, G.; Zhang, B. Recent advances in selex technology and aptamer applications in biomedicine. Int. J. Mol. Sci. 2017, 18, 2142. [CrossRef] [PubMed] Mendonsa, S.D.; Bowser, M.T. In vitro evolution of functional DNA using capillary electrophoresis. J. Am. Chem. Soc. 2004, 126, 20–21. [CrossRef] [PubMed]

Toxins 2018, 10, 427

26 of 26

104. Yang, J.; Bowser, M.T. Capillary electrophoresis–SELEX selection of catalytic DNA aptamers for a small-molecule porphyrin target. Anal. Chem. 2013, 85, 1525–1530. [CrossRef] [PubMed] 105. Mosing, R.K.; Bowser, M.T. Isolating aptamers using capillary electrophoresis-SELEX (CE-SELEX). Methods Mol. Boil. 2009, 535, 33–43. 106. Olsen, T.; Zhu, J.; Kim, J.; Pei, R.; Stojanovic, M.N.; Lin, Q. An integrated microfluidic SELEX approach using combined electrokinetic and hydrodynamic manipulation. J. Lab. Autom. 2017, 22, 63–72. [CrossRef] [PubMed] 107. Liu, X.; Li, H.; Jia, W.; Chen, Z.; Xu, D. Selection of aptamers based on a protein microarray integrated with a microfluidic chip. Lab Chip 2017, 17, 178–185. [CrossRef] [PubMed] 108. Cheng, S.; Zheng, B.; Yao, D.B.; Kuai, S.L.; Tian, J.J.; Liang, H.L.; Ding, Y.S. Study of the binding way between saxitoxin and its aptamer and a fluorescent aptasensor for detection of saxitoxin. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2018, 204, 180–187. [CrossRef] [PubMed] 109. Wang, S.; Liu, J.; Dong, Y.; Su, H.; Tan, T. Conformational structure-dependent molecular recognition of two aptamers for tetracycline. RSC Adv. 2015, 5, 53796–53801. [CrossRef] 110. Cassiday, L.A.; Lebruska, L.L.; Benson, L.M.; Naylor, S.; Owen, W.G.; Maher, L.J. Binding stoichiometry of an rna aptamer and its transcription factor target. Anal. Biochem. 2002, 306, 290–297. [CrossRef] [PubMed] 111. Kim, Y.S.; Gu, M.B. Advances in aptamer screening and small molecule aptasensors. Adv. Biochem. Eng. Biotechnol. 2013, 140, 29–67. 112. Nguyen, V.T.; Kwon, Y.S.; Gu, M.B. Aptamer-based environmental biosensors for small molecule contaminants. Curr. Opin. Biotechnol. 2017, 45, 15–23. [CrossRef] [PubMed] 113. Zhao, S.; Wang, S.; Zhang, S.; Liu, J.; Dong, Y. State of the art: Lateral flow assay (LFA) biosensor for on-site rapid detection. Chin. Chem. Lett. 2018, 29, 1567–1577. [CrossRef] 114. Wang, S.; Yong, W.; Liu, J.; Zhang, L.; Chen, Q.; Dong, Y. Development of an indirect competitive assay-based aptasensor for highly sensitive detection of tetracycline residue in honey. Biosens. Bioelectron. 2014, 57, 192–198. [CrossRef] [PubMed] 115. Wang, S.; Liu, J.; Yong, W.; Chen, Q.; Zhang, L.; Dong, Y.; Su, H.; Tan, T. A direct competitive assay-based aptasensor for sensitive determination of tetracycline residue in honey. Talanta 2015, 131, 562–569. [CrossRef] [PubMed] 116. Wang, S.; Gao, S.; Sun, S.; Yang, Y.; Zhang, Y.; Liu, J.; Dong, Y.; Su, H.; Tan, T. A molecular recognition assisted colorimetric aptasensor for tetracycline. RSC Adv. 2016, 6, 45645–45651. [CrossRef] 117. Wang, S.; Dong, Y.; Liang, X. Development of a SPR aptasensor containing oriented aptamer for direct capture and detection of tetracycline in multiple honey samples. Biosens. Bioelectron. 2018, 109, 1–7. [CrossRef] [PubMed] © 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).