Aspects of Biosecurity in Indonesia - Plant Biosecurity CRC

Aspects of Biosecurity in Indonesia Collected Papers Denpasar, January 2018

CONTENTS Foreword

4

Participants

5

Presenters

7

Genetic Diversity of Grouper as a Marker of Food Security in Enggano Island, a Small Outer Island of Indonesia - Aradea Bujana Kusuma

8

Food Security of Rubber Farmer and Rimba Corridor Landscape Base Protection Area - Aryani Kodriyana

10

Authentic Dialogue to Achieve Collaborative Forest Fires Management, Program Framework in “Caring Society for Forest Fires” - Azwar Najib Alhafi

12

The Regulation for Online Seeds Sale - Daisy Margaret Waworuntu

14

Yard Management to Support Families Food Security Through M-KRPL Program in Baha Village and Getasan Village, Badung Regency - Dewa Putu Aris Sadana

16

Utilization of Sunflower (Helianthus annuus L.) Through Habitat Manipulation as Integrated Pest Management to Decrease Pesticide Demand for Sustainable Agriculture - Fariz Kustiawan Alfarisy, SP.

18

Case Study: Risk Analysis of Cadmium Exposure in Population Consuming Asaphis Violacens in Tawiri Village, Ambon - Gracia Victoria Souisa

21

Sago Palm as Local Food Security: Sustainability and Awareness - Henny Tribuana Cinnawara

23

Utilization of Local Resources in Support of Food Security in Simantri (Integrated Agricultural Systems) in Sub Lukluk, Mengwi, Badung - I Gusti Lanang Adiwirawan Patra

25

Community Structure, Prospective Teacher & Society Perception of Seagrass in Sanur Beach - Ida Bagus Ari Arjaya

27

Strengthening the Role of SRI (System of Rice Intensification) Method as Paddy Biosecurity and Food Security in Indonesia - Luh Putu Suciati

29

The ‘Biochar’ Application in Paddy Farming to Mitigate the Incursion of Pests and Diseases - Maria Maghdalena Diana Widiastuti

32

Food Security Based on Urban Community by Verticulture - Putu Eka Pasmidi Ariati

34

Development Community Based Tourism to Support Food Security Issues: Case Study of Petang Village - Robinardus Jampur

36

Greenhouse Biosecurity Measures for Indonesian Horticultural Farmers - Sri Ita Tarigan, Peter Juma Ochieng

38

The Study of Characteristics and Cultivation of Katokkon Pepper from North Toraja - Reisky Megawati Tammu

40

The Role of Endophytic Fungi Verticillium lecanii and Nigrospora oryzae as Biological Control against Blast Diseases on Rice Crop - Ni Luh Putu Emayanti

42

Towards Food Sovereignty: Increasing Food Production through Community-Based Pests and Diseases Control System - Widhi Handayani

44

Analysis of Household Food Consumption Patterns on Indigenous People of Bayan Village - Baiq Santi Rengganis

46

Spatial Distribution of Sago (Metroxylon Spp.) using Vegetation Indices: a Case Study of Luwu Raya, South Sulawesi Province - Afandi Ahmad

48

Securing the Right to Access Biodiversity for Protecting Biosecurity - Wahyu Yun Santoso

51

The Importance of Family Poultry to Support Food Security among Indigenous Ammatoa Kajang People in South Sulawesi, Indonesia - Nurbaya

54

Genus Bactrocera in Several Countries - Muh. Adiwena

56

Changing Farmers’ Habits in using Excessive Chemical Pesticides - Marcella Wayan Kartika Rini

58

Effect of Different Cultivation Systems with Population Abundance of Root-Knot Nematode (Meloidogyne spp.) in Tomato Plants - Ankardiansyah Pandu Pradana

60

Effect of Healthy and Gemini Virus Infected Ageratum conyzoides on Seed Germination of Zea mays - Aditya Murtilaksono

63

Co-Sponsors and organisations providing in-kind support

67

International Master Class in Plant.Biosecurity | 14–26 January 2018, Denpasar

3

FOREWORD More than 250 000 000 million people inhabit an estimated 17 000 islands in the Indonesian archipelago, the largest in the world, and representing significant challenges to biosecurity. Economic, environmental and social, many of these issues are shared by Australia. In particular, biosecurity as it affects trade and market access, and the unique biodiversity which is found in both countries. Since 2015, a Bilateral Plant Biosecurity Initiative (BPBI) between Indonesia and Australia has promoted the need for national Indonesian coordination of biosecurity interests. Building capacity across public and private sectors is fundamental to achieving this objective. An International Master Class in Plant Biosecurity, supported by The Crawford Fund and the Plant Biosecurity Cooperative Research Centre; and hosted by Universitas Mahasaraswati Denpasar, Bali with additional in-kind resources from the Centre for Agriculture and Bioscience International (CABI), with at least thirty additional Indonesian participating organisations, represented a significant contribution to meeting biosecurity needs in Indonesia – in an international context. The Master Class was held in Denpasar from 14 to 26 January 2018. Twenty-six participants, selected from a large field of applicants, represented a diversity of disciplines, regions and sectors of the Indonesian economy. Each participant contributed existing contacts, ranging from a university’s regional network with local government departments and agricultural groups, to organisations such as the World Wildlife Federation, tourism and several agricultural and horticultural interests. The Master Class Participants were eager to record their biosecurity interests by means of publishing Short Communications. These refer to work completed, in progress and in prospect. Together they portray the richness of diversity which was the hallmark of an event which will be memorable to the Participants, Presenters, and Organisers. They will also provide impetus to the nascent Indonesia Biosecurity Foundation which seeks to realise the objective of creating a pan-Indonesian biosecurity entity which can liaise, globally, in meeting a major challenge of the times.

JOHN LOVETT IAN FALK LINDA SUSILOWATI Denpasar and Canberra, January 2018

4 International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar

PARTICIPANTS Fariz Kustiawan Alfarisy

Sri Ita Tarigan

Jember University, East Java [email protected]

Kristen Wira Wacana Sumba University, East Sumba [email protected]

Gracia Souisa The Mollucan Christian University of Indonesia, Maluku Islands [email protected]

Dewa Putu Aris Sadana

Robinardus Jampur

Arjuna Bali [email protected]

Tours,

Baiq Santi Rengganis

Mahasaraswati University of Denpasar, Bali [email protected]

Islamic University of Al-Azhar, Mataram [email protected]

I Gusti Lanang Patra Adiwirawan

Aradea Bujana Kusuma

Agricultural Technology Assessment Agency of Bali Province, Bali [email protected]

Afandi Ahmad And Djemma University, Palop [email protected]

Luh Putu Suciati Jember University, East Java [email protected]

Ni Luh Putu Emayanti State University of Malang, East Java [email protected]

Reisky Megawati Tammu Pelita Harapan University, Jakarta [email protected]

Wahyu Yun Santoso Gadjah Mada University, Yogyakarta [email protected]

Aryani Kodriyana

WWF Rimba, Riau [email protected]

Putu Eka Pasmidi Ariati Mahasaraswati University of Denpasar, Bali [email protected]

Azwar Najib Alhafi Araya Bumi Indonesia Ltd Group [email protected]

Marcella Wayan Kartika Rini Agriculture Agency of Denpasar, Bali [email protected]

Bali

University of Bengkulu, Bengkulu [email protected]

Ankardiansyah Pandu Pradana Borneo Tarakan University, Tarakan [email protected]

Maria Maghdalena Diana Widiastuti Musamus Merauke University, Merauke [email protected]

Henny Cinnawara Andi Djemma University, Palopo [email protected]

Muhammad Adiwena Borneo Tarakan University, Tarakan [email protected]

Aditya Murtilaksono Borneo Tarakan University, Tarakan [email protected]

Nurbaya Poltekkes Kemenkes Mamuju [email protected]

Ida Bagus Ari Arjaya Mahasaraswati University of Denpasar, Bali [email protected]

Widhi Handayani Satya Wacana Christian University, Salatiga [email protected]

Daisy Margaret Waworuntu Pacific Institute, Manado [email protected]

International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar 5


PRESENTERS Miss Paramitha Eka Putri

Dr Helen Scott-Orr

Universitas Mahasaraswati Denpasar, Bali [email protected]

Inspector-General of Biosecurity, Australia [email protected]

Ms Trish Gleeson

Dr Wiske Rotinsulu

Counsellor (Agriculture) Australian Embassy Jakarta [email protected]

Sam Ratulangi University, Manado, North Sulawesi [email protected]

Professor John Lovett

Mr Tony Steeper

Foundation Chairman Plant Biosecurity Cooperative Research Centre [email protected]

Corporate Communications and Engagement Manager, PBCRC [email protected]

Professor Ian Falk

Professor Sang Putu Kaler Surata

Charles Darwin University [email protected]

Universitas Mahasaraswati Denpasar, Bali [email protected]

Dr Mariana Campos

Dr John Tasirin

Murdoch University [email protected]

Sam Ratulangi University, Manado [email protected]

Dr Muhammad Faheem

Mr Mike Thompson

Centre for Agriculture and Bioscience International (CABI) [email protected]

Pestpoint [email protected]

Dr Felipe Gonzales

Satya Wacana Christian University, Salatiga [email protected]

Dr Jacob Uktolseja

Queensland University of Technology [email protected]

Ms Heleen Kruger

Dr Susie Hester University of New England, Centre of Excellence for Biosecurity Risk Analysis (CEBRA) [email protected]

Dr Eka Martiningsih Universitas Mahasaraswati Denpasar, Bali [email protected]

Dr I Wayan Mudita Universitas Nusa Cendana, Kupang [email protected]

Miss Linda Susilowati

Australian Bureau of Agricultural and Resource Economics and Sciences (ABARES) [email protected]

Professor Enny Sudarmonowati, PhD. Deputy Chair of Life Sciences, Lembaga Ilmu Pengetahuan, Indonesia (National Research Institute LIPI) [email protected]

Dr I Ketut Arnawa Universitas Mahasaraswati Denpasar, Bali [email protected]

Satya Wacana Christian University, Salatiga [email protected]


GENETIC DIVERSITY OF GROUPER AS A MARKER OF FOOD SECURITY IN ENGGANO ISLAND, A SMALL OUTER ISLAND OF INDONESIA Aradea Bujana Kusuma

Bertoka Fajar SPN, Person Pesona Renta, Nurlaila Ervina Herliany, Mei Yunisari Marine Science Department, Bengkulu University; Indonesia *Corresponding author email: [email protected]

Abstract

Grouper is a fish with decreasing population in nature. The decreasing population of groupers can lead to inbreeding, resulting in a decrease of genetic diversity. The purpose of this research was to know the relationship between genetic diversity of grouper (Ephinepelus coeruleopunctatus and Ephinepelus merra) and food security. The mitochondrial protein-coding gene (COI) was used to analyze genetic diversity. The results showed the genetic diversity of groupers was categorized as low. This could lead to extinction, a big problem for human lives by loss of food security. Keywords: food security, genetic, grouper

Abstrak

Ikan kerapu merupakan salah satu ikan yang mengalami penurunan populasi di alam. Penurunan populasi kerapu dapat menyebabkan terjadinya perkawinan sedarah pada satu populasi sehingga menyebabkan menurunnya keragaman genetik. Tujuan penelitian ini adalah untuk mengetahui hubungan keragaman genetik ikan kerapu ((Ephinepelus coeruleopunctatus dan Ephinepelus merra) terhadap ketahanan pangan. Analisis keragaman genetik menggunakan gen mitokondria (COI). Hasil menunjukan bahwa keragaman genetik kerapu termasuk dalam kategori yang rendah. Rendahnya keragaman genetik dapat menyebabkan kepunahan yang akan menjadi masalah besar bagi manusia, salah satunya yaitu pada keamanan pangan. Kata Kunci: genetik, jerapu, ketahanan pangan Introduction Grouper is a target fish in Enggano Island that has high economic value in Indonesia. IIlegal fishing by foreign countries, impacted by less monitoring and management in Indonesia's outer islands, could contribute to a decline in the grouper population, leading to inbreeding in the population. This will lead to a decrease in genetic diversity.The decreasing of genetic diversity in fish was indicated by low growth rate, high mortality rate and low antibody (Mantau, 2005). It can threaten some organisms, perhaps leading to extinction. Genetic diversity can reflect environment or habitat quality. High of genetic diversity of individuals indicates presence of a large population (Kusuma, 2016). Genetic diversity in some individuals has an important role to adaptation to environment, climate change, and disease. A higher value of genetic diversity indicates the ability to survive and adapt to environmental changes. It can also impact on food security. The decreasing of fish food stock in small and outer islands in Indonesia could impact on hunger and poverty. Therefore, the aim of this study was to analyze the relationship between genetic diversity of grouper (E. coeruleopunctatus and E. merra) and food security. Approach  Grouper (E. coeruleopunctatus and E. merra) was collected from fishermen in Enggano Island. The fins of grouper were preserved in 96% ethanol. The tissue of E. coeruleopunctatus and E. merra was extracted using gSYNC DNA Extraction Kit Quick Protocol. COI mitochondrial amplification was performed using PCR primers Fish R15’TAGACTTCTGGGTGGCCAAAGAATCA3’ dan Fish F1-5TCAACCAACCACAAAGACATTGGCAC3’ (Sachithanandam et al., 2012). The PCR programs were done, pre-denaturation at 95ºC for 30 sec, denaturation at 95ºC for 30 sec, annealing at 55ºC for 30 sec, extension at 72 ºC for 60 sec and final extension at 72 ºC for 5 min on 35 cycles. The electrophoresis process used 1.5 % agarose. The sequences of the sample were aligned using MEGA 5.05 (Molecular Evolutionary Genetic Analysis). Clustal W was used to edit the multiple alignments. Software DNAsp 5.0 was used to analyze haplotype Diversity (Hd) and nucleotide diversity (π) in the each population.


Discussion and future work The genetic diversity of groupers was categorized into the low category (0.22222 and 0.25000). Haplotype diversity 0.1 – 0.4 was categorized as low genetic diversity (Nei, 1987). Low genetic diversity of groupers in Enggano Island is impacted by the damaging of their habitat in nature. Habitat destruction can cause the damage in various ecosystems by disruption of the ecosystem components. This can lead to loss of some biological species that have a function as producers and consumers. The analysis of habitat destruction in Enggano Island, based on low genetic diversity of grouper, could be categorized into less good condition. Groupers occupy coral reefs as their habitat. Low genetic diversity was suspected as a result of the coral reef ecosystem conditions in Enggano Island which was began to decline. The decreasing of the grouper population in Enggano Island, with consequent loss of genetic diversity, impacts on the social-economy of fisherman in Enggano Island. There are general concerns about food stocks in Indonesia but it is especially a concern in these small and outer islands which have poor transportation and food distribution infrastructure. Participation of local citizens is needed to protect marine biodiversity and to make sure food stocks in small outer islands of Indonesia are preserved. In future work we hope to collaborate with other countries to ensure food security in each island in Indonesia using a genetic approach. References Kusuma AB, Dietrich GB, Hawis M, Beginer S, Dondy A. 2016. Keanekaragaman Genetik Karang Lunak Sarcophyton trocheliophorum pada Populasi Laut Jawa, Nusa Tenggara dan Sulawesi. Jurnal Enggano. 1 (1): 89-96. Mantau Z. 2005. Produksi Benih Ikan Nila Jantan Dengan Rangsangan Hormon Metil Testosteron Dalam Tepung Pelet. Jurnal Litbang Pertanian, 24(2): 80-84. Nei M. 1987. Molecular Evolutionary Genetics. New York. Columbia University. Press. New York. 512 pp. Sachithanandam, Mohan, V., Muruganandam, P.M., Chaaithanya, N., Dhivya, I.K, and Baskaran, P.R. 2012. DNA Barcoding, Phylogenetic Study of Epinephelus spp. from Andaman Coastal Region, India. Indian Journal of Geo-Marine Sciences, 41(3): 203-211.


FOOD SECURITY OF RUBBER FARMER AND RIMBA CORRIDOR LANDSCAPE BASE PROTECTION AREA Aryani Kodriyana Yudi Agusrin, Lutfie, Puji Lestari, Mirza Ahmad

Abstract RIMBA Corridor is one of the five ecosystem corridors listed in the President Regulation No. 13/2012 about Sumatra Spatial Plan. WWF Indonesia through the RIMBA Program aims to optimize RIMBA Corridor Protection through intensification in agriculture by applying sustainable agriculture to alleviate food vulnerability in the closest areas to RIMBA Corridor. As sustainable agriculture prioritizes biosecurity for human, animal and plants, biosecurity aspects are also promoted in the program. This study was conducted to see how the program impacts food security in six villages in the intervention area. The methods used were surveys and interviews with questionaire as tools for data collection. Keywords: RIMBA (NGO for forest conservation)

Abstrak Koridor RIMBA adalah salah satu dari lima koridor ekosistem yang ditetapkan dalam Peraturan Presiden No. 13 tahun 2012 tentang Rencana Tata Ruang Pulau Sumatera. WWF Indonesia melalui Program Kemakmuran Hijau RIMBA bertujuan mengoptimalkan perlindungan Koridor RIMBA melalui intensifikasi pertanian melalui pertanian berkelanjutan untuk menurunkan kerentanan pangan di area terdekat dengan Koridor RIMBA. Sebagaimana pertanian berkelanjutan memprioritaskan ketahanan hayati untuk manusia, hewan dan tumbuhan, aspek ketahanan hayati disebarluaskan dalam program. Penelitian ini dilaksanakan untuk melihat pengaruh program terhadap ketahanan pangan di 6 desa dampingan. Metode yang digunakan adalah survey dan wawancara dengan kuisioner sebagai alat yang digunakan dalam pengumpulan data. Kata kunci: RIMBA (NGO untuk konservasi) Introduction The RIMBA Corridor covers 3.8 million hectares over 19 districts in the provinces of Riau, Jambi and West Sumatra. Most of the RIMBA Corridor is in Jambi (2.1 million hectares, or 54%), with about a third in West Sumatra (1.3 million hectares, or 35%), and the remainder in Riau (440,000 hectares, or 11%). The RIMBA Corridor is crucial for carbon sequestration and economic development (as an enabler and as source of wealth), and includes three important watershed areas – the headwaters of the Indragiri, the Kampar and Batanghari Rivers – that deliver water from over one million hectares. Based on significant land use changing in Dharmasraya district in five years, almost all opened areas are used as agriculture areas (Mirza Ahmad, 2017). In early 2016 WWF Indonesia received funding support from the Millennium Challenge Account - Indonesia (MCA-I) to the Project window Prosperity Green (Green Prosperity Project), with the concept of activities entitled "Strengthening Natural Resource Management and Increasing carbon Stocks Across Central Sumatra by Enhancing Forest Ecosystem Connectivity and Alleviating Poverty through Green Economic Development". This Program aims to reduce risk to the protection area through intensification of the agriculture area as a major sector used for food security fulfillment. Food Agriculture Association in D. C. Du Toit (2011), define Food Security as the condition in which “all people, at all times, have physical, social and economic access to sufficient safe and nutritious food that meets their dietary needs and food preferences for an active and healthy life”. The food security condition could be reached by various methods especially by improving income so that it is possible for the community to reach food security.


Discussion Synthetic chemical product usage in agriculture is one program supported by the Department of Agriculture. In Dharmasraya district the Department distributes pesticide, herbicide and fertilizer every year. High amounts of chemical usage cause some cases related to human, animal and plant health in Dharmasraya. In fact, programs high on chemical product usage are not friendly to the ecosystem as farmers use the agriculture land also as cattle grazing area and the chemicals used may impact people around the agriculture. More than 70 % of farmers who had periodical activities in spraying pesticide and herbicide felt some respiratory tract disease. Based on observations in the intervention area, canals around agriculture fields no longer provided a complex ecosystem cycle and the number or fish surviving in the canals decreased from the usage of chemicals coming from pesticide, herbicide and fertilizer. Since chemical product usage caused some concerns in this area, the RIMBA Program organized the program through training and community empowerment in order to provide a large opportunity in land intensification. The activities organized by RIMBA Program consist of: (1) Introduction of sustainable agriculture concept, (2) Training of trainer in sustainable rubber management, (3) Training of trainer in field school method to champion farmer, (4) Training in agroforestry and stingless bee cultivation as agriculture land intensification, (5) Field school activities in seven times meeting, (6) Monitoring in method and productivity of commodity, (7) Assistance in field group strengthening and (8) Initiation of a stable rubber supply chain. Biosecurity is an important part of this Program. Approach Minimum number of agriculture trainers and less skills in integrating knowledge by farmers in Dharmasraya are challenges in intensification of agriculture land. Various kind of land need intensive observation while the farmer lacks skill and there are insufficient trainers to achieve optimum impact. Building farmer capacity needs a method that is suited to the various ages and experience of farmers gained through a long period of time in practice and trial-and-error. Field schools are an adult education method which involve farmer personages in building farmer capacity not only in managing their field but also improving their social skills. Field schools make them able to think scientifically by observing their land and analysing their daily activities in agriculture land management. This method also improves farmer ability to giving factual and scientific opinion and improves their impact not only in their village but also in the district as the field schools in the RIMBA Program connects farmer personages in four subdistricts. Results In December 2016 Dharmasraya farmers were trained for sustainable natural rubber management. In March 2017 farmer were trained to apply agroforestry and stingless bee breeding techniques. In May 2017 farmer personages were trained to facilitate the villages. From June to December 2017 farmer personages were training farmers in their villages. In September 2017 palm oil farmers were trained for sustainable palm oil management. In December 2017, 15 logs of stingless bee were provided in intervention villages for income generation. In December 2017, 20 rubber farmer from six villages were interviewed. In December 2017 rubber farmer had improved their rubber productivity by 25%. Future work Cooperation, in terms of assessments of comprehensive conservation programs; food security analysis based on multicommodity impact; multicommodity and climate change; multicommodity agriculture management and biosecurity; rural development and food security; strategic approach in improving spatial plans to maximize productivity of agriculture areas are all needed. A program with these elements will be developed for submission for funding in 2018. References Ahmad, Mirza. 2017. WWF RIMBA Program Cluster 1. Toit, D. C Du. 2011. Food Security. Directorate Economic Services, Production Economic Unit.


AUTHENTIC DIALOGUE TO ACHIEVE COLLABORATIVE FOREST FIRES MANAGEMENT, PROGRAM FRAMEWORK IN “CARING SOCIETY FOR FOREST FIRES” Azwar Najib Alhafi

Master Degree in Faculty of Forestry, Gadjah Mada University Jl. Agro No.1, UGM, Bulaksumur Yogyakarta, Indonesia 55281 [email protected] ; +6282226861167

Abstract

The Indonesian Government has been trying to run preventive actions in order to tackle forest fires by forming the Caring Society for Forest Fires. This program is expected to provide a platform for collaborative management. Its implementation in many regions suggests that such collaboration is rarely to be achieved. The main issue that arose was because there was no authentic dialogue (the practice of speaking one's personal truth and listening well to others for deeper understanding). The absence of authentic dialogue meant that collaborative principles could not be formed (Innes and Booher, 2003). Using a qualitative approach, this research aimed to observe how the authentic dialogue works in the collaborative forest fire management. The study area will be in Central Sumatera, East Kalimantan, and West Kalimantan. Expected findings from this research are a description of the implementation of a program in the field and its authentic dialogue process. The expected outcome of this research will provide benefits for the development of science, especially those related to the issue of forest fires, and will also provide a learning vehicle for stakeholders in forest management with a focus on forest fires. Keywords: authentic dialogue; forest fire

Abstrak Pemerintah Indonesia telah berupaya menanggulangi kebakaran hutan melalui program Masyarakat Peduli Api. Program ini diharapkan dapat menyediakan bentuk pengelolaan yang kolaboratif. Implementasinya di beberapa wilayah dianggap belum mencapai tingkat kolaborasi. Hal tersebut disinyalir akibat tidak adanya dialog otentik. Ketiadaan dari dialog otentik berarti prinsip-prinsip kolaborasi tidak terbentuk (Innes dan Booher, 2003). Menggunakan pendekatan kualitatif, penelitian ini bertujuan untuk mengamati bagaimana dialog otentik berjalan dalam pengelolaan kolaborasi kebakaran hutan. Area studi akan ditujukan di Sumatera Tengah, Kalimantan Timur, dan Kalimantan Barat. Temuan yang diharapkan dari penelitian ini adalah deskripsi dari implementasi program di lapangan dan bagaimana proses dialog otentik di dalamnya. Diharapkan dengan adanya penelitian ini mampu memberikan manfaat untuk pengembangan ilmu pengetahuan khususnya yang berkaitan dengan kebaran hutan, dan juga mampu menjadi wahana pembelajaran bagi pihak-pihak terkait dalam pengelolaan hutan dengan fokus kebakaran hutan. Kata kunci: dialok otentik; kebakaran hutan Introduction Forest fires have become a routine phenomenon worldwide, including in Indonesia. Recorded in 2015, forest fires burned approximately 2.6 million hectares of forests in Indonesia. It reduced in 2016 to 438,363 hectare and 124,743 hectares in 2017 (KLHK, 2017). Reduced forest area has a direct impact on biodiversity. Recently forest fires have become an international concern involving environmental, social and economic issues. Forest fires were considered a potential threat to sustainable development because of their direct impacts on the ecosystem including loss of biodiversity. Furthermore, related to the biosecurity issue, forest fires are becoming a problem that requires special concern, especially in Indonesia. Resolving forest fires means the need for mutual responsibility in handling them. It requires cooperation from stakeholders, including government, society or the private sector. The Indonesian Government, in this case through government regulation number P.2/2014, has been trying to implement preventive actions by forming The Caring Society for Forest Fires or Masyarakat Peduli Api (MPA). Through this program, community awareness is expected to play an active role in the prevention of forest fires. The regulation mentioned above has been implemented for the last three years, however, this research assumes that its implementation is not optimised due to lack of authentic dialogue in collaborative management. Authentic dialogue is investigated to establish the key to its role in collaborative management.


Approach This research will use a qualitative approach with a case study method. The sampling model for primary data will use the purposive sampling technique. Primary data will be obtained directly from information sources by making observations during in-depth interviews, while secondary data will be obtained through literature study. Analysis of authentic dialogue of interest focuses on task, activity, and resources concept (TAR) based on forest resource management elements, such as: planning, organizing, actuating and controlling (POAC). Discussion Forest fire and biodiversity Fire can be a natural and major disturbance in many forests but in others it can cause total devastation. Although some forest fires occur naturally, a combination of human activity, fuel availability and climate accounts for the majority of fires. Uncontrolled fires have an effect on forest resources with an assortment of habitats. Commonly, research about forest fire impacts in Indonesia has been conducted to examine the environmental changes particularly on forest structure. Yulianti et.al (2010) found that repeated forest fires in Central Kalimantan have significantly decreased forest biodiversity. Flora composition became poorer and became dominated by invasive or fire-resistant species such as Melaleuca leucadendron and Imperata cylindrica. These vegetation changes bring changes in the other populations such as animals or other wildlife. Forest fires not only change the composition or biodiversity but also reduce forest productivity. Collaborative management Collaborative approaches are often referred to as "bridges" to improve resource management, that serve to cross boundaries limited by geography, interests, and perceptions between key stakeholders in the management of a given forest. A collaborative approach is often deployed as a rational response to a crisis in forest management and sustainable forest management is unworkable (Suporahardjo, 2005). Implementing authentic dialogue without observing the diversity and interdependency of interest among stakeholders will not significantly achieve the desired benefits. The authentic dialogue which observes diversity and interdependency of interest is expected to produce: Reciprocity, Relationships, Learn, and Creativity. The adoption of authentic dialogue takes place through four changes that lead to the occurrence of collaborative management; (a) formation of shared identities, (b) formation of shared meaning, which is formed in the process of social construction of the problems being faced. (c) developing new heuristics. The new heuristics are new norms developed and adopted by dialogue participants in an authentic dialogue process. (d) formation of genuine innovation which is not just creative ideas but ideas embodied in new practices and institutions. As consistently mentioned above, forest fire is a real problem in Indonesia which threatens biosecurity. Currently, the Indonesian government has released a policy named “Social Forestry (Perhutanan Sosial)” to tackle forest fire and encourage collaborative management. This policy supports The Caring Society for Forest Fires program. So far this program is not successful. Collaborative management is at the heart of tackling forest fires in order to strengthen Indonesian biosecurity. Future work Projecting ahead, the idea in this research should be a recommendation for the stakeholders in solving problems related to forest fire management. As a first step, preliminary research should be done according to the method described above. By fully understanding the impact of forest fires on biosecurity authentic dialogue contributes to a successful management model. References Innes, J.E., & Booher, D.E. 2003. Collaborative Policymaking: Governance Through Dialogue dalam Deliberative Policy Analysis: Understanding Governance in the Network Society, Maarten A. Hajer dan Hendrik Wagenaar (Eds), CambridgeUniversityPress. PPID KLHK. 2017. Luas Kebakaran Hutan dan Lahan. Kementrian LHK, Jakarta Suporahardjo. 2005. Manajemen Kolaborasi; Memahami Pluralisme Membangun Konsensus. Bogor: Pustaka Latin. Yulianti et.al, 2010. Analisis Vegetasi Hutan Rawa Gambut Pasca Kebakaran di Wilayah Desa Sebangau dan Desa Tarunajaya. UGM, Yogyakarta


THE REGULATION FOR ONLINE SEEDS SALE Daisy Margaret Waworuntu Pacific Institute Manado, [email protected]

Abstract The rise of online farming seed sales currently attracts farmers and agricultural practitioners. The transaction is very easy and the delivery is fast. Behind the technological advances unwittingly there are biosecurity "threats" that lurk that could see seeds containing pests unknown to the buyer and even the seller. This will endanger the region and biodiversity. Online seed sales have not been comprehensively supervised by the government. The current regulations are not yet regulated. Therefore the government needs to issue regulations on the sale of agricultural seeds online as an absolute requirement that must be obeyed by both the seller and the buyer. Keywords: biosecurity, online seeds, selling, regulation

Abstrak Maraknya penjualan bibit pertanian (bunga pohon ataupun buah) secara online saat ini menarik bagi para petani dan praktisi pertanian. Transaksinya sangat gampang dan pengirimannya cepat. Di balik kemajuan teknologi tersebut tanpa disadari ada “ancaman” yang mengintai ketahanan hayati yaitu bisa saja bibit yang dibeli itu mengandung hama yang tidak diketahui oleh pembeli bahkan penjualnya. Ini akan membahayakan wilayah dan keanekaragaman hayati setempat. Penjualan bibit secara online belum diawasi secara komprehensif oleh pemerintah yang berwenang. Regulasi yang ada saat ini belum mengatur tentang hal tersebut. Oleh karena itu pemerintah perlu mengeluarkan peraturan tentang penjualan bibit pertanian secara online ini sebagai syarat mutlak yang harus dipatuhi baik oleh penjual maupun pembelinya. Introduction Biosecurity is a relatively new concept in Indonesia. According to FAO (2007), biosecurity is a strategic and integrated approach that includes a policy and regulatory framework for analyzing the risks posed by living things to humans, animal and plant life, and risks associated with the environment. The principal objective of biosecurity is to prevent, control and / or manage risks to survival and health in accordance with the biodiversity sector which includes food security, animal health, plant health from pest, disease and weed diseases, introduction and release of genetically modified organisms, and environmental sustainability from the threat of invasive alien species. Therefore, biological endurance is a holistic concept that has direct relevance to agricultural sustainability and broad aspects related to public health and environmental protection, including the protection of biodiversity. Technological developments are increasingly advanced at this time to make many choices including agriculture. Now there are many sites that open the sale of agricultural seeds (tree or fruit flowers) online. Although Indonesia has many plant species, not all plants exist in all provinces, so the sale of agricultural seeds online is interesting to farmers and practitioners of agriculture. The transaction is very easy and the delivery is fast. Behind these technological advances without realizing there is a "threat" that lurks that could have purchased seeds that contain pests that are not known by the buyer and even the seller. This will endanger the local area and biodiversity. This may happen because online sales of seeds have not been comprehensively regulated and monitored by government authorities. Therefore the government needs to issue regulations on the sale of agricultural seeds online as an absolute requirement that must be obeyed by both the seller and the buyer. Approach Therefore, it is necessary to study the regulations that will be proposed to be made by the government. The proposed method is to conduct field surveys through interviews with farmers or agricultural practitioners who have purchased seeds online, cataloging online sites that sell agricultural seeds and interviewing their Standard Operational Procedure (SOP) in selling agricultural seeds. Subsequently, submit a proposal to the government and the parliament for further processing in accordance with the provisions of legislation in making one regulation.


Discussion The principle of biological endurance is risk analysis. Risk analysis includes 3 (three) components that are interconnected with one another: • Risk assessment is required for the purpose of managing and to be able to assess risk consistently across agencies. • Risk management is done by referring to the results of the risk assessment and the activities and outcomes need to be communicated, not only between government agencies, but also between government and society. • Risk communication is needed to equate perceptions in conducting risk assessments and to improve the successful implementation of risk management. Biodiversity also implies that the protection of crops that have been so focused on technical aspects needs to be expanded to cover aspects of policy, legislation, and community. Future work The existence of regulations governing online seedling sales will maintain biodiversity. Because biosecurity touches the policy aspect, biodiversity cannot be unrelated to governance. Some important aspects of governance are the openness, the quality of public services, and accountability. Governance should not conceal biological threats, but rather should try to communicate with all stakeholders. In order to realize good governance, the government should serve the needs of the community to obtain rapid information on threats to biodiversity. Also, in realizing good governance accountability is not only given in the form of successful increase in production but also the success of anticipating the entry of threats outside biodiversity. According to Vayda from Rutgers University, New Jersey, USA: The focus given only on these technical aspects makes us forget that disasters can occur not because control technology is not available, but precisely because of the inadequate policies taken in the face of biological threats. Incorrect policies can occur due to various factors, among which are the factors of power politics and the factor of taking profit for a moment ¹. References ¹ Prof. Andrew P. Vayda, Rutgers University, New Jersey, USA – Citrus Biosecurity Blog.


YARD MANAGEMENT TO SUPPORT FAMILIES FOOD SECURITY THROUGH M-KRPL PROGRAM IN BAHA VILLAGE AND GETASAN VILLAGE, BADUNG REGENCY Dewa Putu Aris Sadana

Mahasaraswati Denpasar University Jalan Soka No.41, Kesiman Kertalangu, East Denpasar, Bali Phone: 0361-8442866, [email protected]

Abstract M-KRPL meets the needs of food and nutrition of families and communities through sustainable utilization of yard optimization. M-KRPL activities were implemented at Baha Village and Getasan Village, Badung. The food consumption diversification success can be measured by PPH score. PPH score of Baha village in 2013 increased by 1.5 percent from 72 to 73.1. PPH score of Getasan village in 2013 increased by 3.8 percent from 69.8 to 72.5. This shows that the yard utilization model through the M-KRPL in Badung can improve meeting the needs of food and nutrition Keywords: M-KRPL, PPH, utilization of the yard

Abstrak

M-KRPL memenuhi kebutuhan pangan dan gizi keluarga serta masyarakat melalui optimalisasi pemanfaatan lahan pekarangan. Kegiatan M-KRPL diimplementasikan di Desa Baha dan Desa Getasan, Badung. Keberhasilan diversifikasi konsumsi pangan diukur dengan skor PPH. Skor PPH desa Baha pada tahun 2013 meningkat dari 72 menjadi 73,1 atau meningkat 1,5 persen. Skor PPH desa Getasan pada tahun 2013 meningkat sebesar 3,8 persen dari 69,8 menjadi 72,5. Ini menunjukkan bahwa M-KRPL di Badung dapat meningkatkan skor PPH yang menunjukkan bahwa model pemanfaatan lahan pekarangan telah teradopsi untuk mencukupi kebutuhan pangan dan gizi. Kata kunci: M-KRPL, PPH, pemanfaatan pekarangan

Introduction The goal of food security in Indonesia is the fulfillment of conditions for every household food both in quantity and quality; safe, equitable and affordable. One effort to build food security is by utilizing available resources, including through the use of yards. Agricultural expansion opportunities are very limited, while the demands for land for food supply both in terms of quantity, quality, diversity and safety are increasing. Yard area, with intensive management, is expected to produce food to meet the nutritional needs of consumer and family, save expenses and also can provide additional income for the family. Awareness of the importance of optimizing the utilization of their yards can trigger creative efforts involving households in achieving food self-sufficiency. The optimization can be realized through the efforts of diversification so it no longer rests on the main food, rice. At Baha Village and Getasan Village, the optimization of land use yard effort is a longestablished practice to develop the integration of crop and livestock systems simultaneously and together. In an effort to encourage use of their yards, the Ministry of Agriculture Indonesia through the National Research and Development (R & D) developed a Model of Sustainable Food House Agricultural Region (M-KRPL). One of the missions in the M-KRPL expectancy is increasing PPH (food pattern of hope) score. To ensure the sustainability of the concept of the M-KRPL the availability of seeds is the main factor, therefore, needing to be equipped with Seed Garden Village or KBD (Ministry of Agriculture, 2011). The impact of the yard management program as proposed by Bunasor (1989), is that it can increase energy consumption and protein for household consumption reflected in improved PPH scores. Approach Activity M-KRPL in Badung was implemented in two places, Baha Village, Mengwi and Getasan Village, Petang District. The choice of location is done through meetings and coordination with the Department of Agriculture, Horticulture and Forestry, Badung. The choice of location is deliberately spread so that the activities of M-KRPL are known by the public to increase adoption. The research method used in this case study is a qualitative descriptive that is through exposure of M-KRPL by BPTP Bali and assessing the program's impact on the value of the PPH at Baha Village and Getasan Village. The assessment was done by collaborating through the analysis of existing data, theories, policies, and guidelines related to this case. Collecting data in this study involved collecting secondary data such as documents, photos, table data and interviews related to M-KRPL program Baha Village and Getasan Village to BPTP Bali. The data obtained was then processed using qualitative descriptive and tabulation analysis, and to obtain the value of food expectation pattern using AKE standard (energy sufficiency rate), and the maximum PPH is 100. Data analysis was done by comparing the score of Food Pattern of Hope (PPH) between before and after application of M-KRPL innovation. 16 International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar

Discussion The impact of the yard land use program as proposed by Bunasor (1989) is that it can increase energy consumption and protein for household consumption reflected in improved scores PPH (Pola Pangan Harapan). The Government, through the Ministry of Agriculture in 2014, set the national targets PPH score at 93.3 (UU No. 18 Tahun 2012). Food ConsumptionBased Local Resource Utilization Optimization activities implemented through the courtyard through the concept of MKRPL. PPH score for the province of Bali is obtained of 85.1. PPH score of Baha village in 2013 increased from 72 to 73.1 by 1.5 percent. PPH score of Getasan village in 2013 increased by 3.8 percent from 69.8 to 72.5. It shows the M-KRPL in Badung can increase the value of PPH from Baha Village and Getasan Village. The increasing value of PPH from both villages showed that the yards adopted the utilization model to meet the needs of food and nutrition. The availability of food all the time, in sufficient quantities and affordable, determines the level of food consumption at the household level. Furthermore, household food consumption patterns will affect the composition of food consumption. Future work The advice for M-KRPL program is strengthening policy and support related to the sustainability of the M-KRPL program by governments in Bali, especially in Badung. Furthermore, it also needs cooperation with international organizations working in the field of biological resilience, for example UNESCO. Because the M-KRPL program is not only to improve food security, but also can improve the resilience of the economy, environmental sustainability, and social security. It means the M-KRPL program is supportive of biosecurity. References Anonim. 2012. Undang-Undang Nomor 18 tahun 2012 Tentang Pangan. Jakarta. Bunasor, 1989. Aspek Teknologi, Sosial, dan Ekonomi dalam Diversifikasi Pangan. Tinjauan dari Sisi Produksi dan Konsumsi. Seminar of Food and Nutrition Policy Study: Experience and Hope, Darmaga, Bogor. Ministry of Agriculture Indonesia. 2011. Pedoman umum Model Kawasan Rumah Pangan Lestari (MKRPL). Jakarta.


UTILIZATION OF SUNFLOWER (Helianthus annuus L.) THROUGH HABITAT MANIPULATION AS INTEGRATED PEST MANAGEMENT TO DECREASE PESTICIDE DEMAND FOR SUSTAINABLE AGRICULTURE Fariz Kustiawan Alfarisy, SP.

University of Jember, [email protected]

Abstract

To get high production and freedom from pests farmers often use pesticides. The use of unsuitable pesticides can cause environmental and health problems. To increase the sustainability of our agricultural system, we need to control pests and diseases without causing any damage to our environment. Growing natural enemies of the pests can be a good option to reduce the use of pesticides. Refugia plants such as Sunflowers (Helianthus annuus L.) are one of many hosts for natural enemies that can be used to control the pests rather than using pesticides. Based on that reason, research development on plant protection using integrated pest control (development of one of the pest’s natural enemies) is very important. This review-based research aims to examine the effectiveness of integrated pest management using sunflowers planted in plantations. The sunflowers are planted in random locations, a week after the main crop (WAP). The review-based research found that sunflowers are effective in controlling many pests such as Liriomyza, Helopeltis, Thrips, and Aphids. In addition, the sunflowers also can host natural enemies of pests, parasitoids and predators. Based on those results we can conclude that utilization of sunflowers through habitat manipulation can be a good option to reduce the use of pesticides. Keywords: sunflower, pesticide

Abstrak

Petani dalam mencapai produksi tinggi dan bebas serangan hama sering menggunakan pestisida sebagai pengendalian. Pestisida merupakan obat sintetik yang sering digunakan petani untuk mendapatkan hasil yang tinggi. Pestisida yang diapliksikan tidak sesuai dengan anjuran maka akan menyebabkan beberapa permasalahan baik untuk kesehatan, lingkungan, dan mahluk hidup lainnya. Menuju pertanian yang berkelanjutan maka bagaimana caranya untuk mengendalikan organisme penganggu tumbuhan tanpa harus menyebabkan permasalahan yang lain. Selain pestisida, penggunaan tanaman refugia seperti Bunga Matahari (Helianthus annuss L.) dapat dijadikan sebagai upaya pengendalian. Tujuan penulis untuk meningkatkan keragaman hayati musuh alami maupun tumbuhan sebagai habitat berkembangbiak dan untuk mengurangi penggunaan pestisida. Penelitian ini berkaitan tentang proteksi tanaman dengan menggunakan konsep pengendalian hama terpadu. Metode yang dilakukan dengan menyiapkan benih Bunga Matahari untuk ditanam disekitar pertanaman. Pola manipulasi habitat dilakukan secara random sampling spesifik lokasi. Bunga Matahari ditanam 1 minggu setelah tanam (HST). Hasil review literatur Bunga Matahari efektif untuk mengendalikan hama seperti Liriomyza, Helopeltis, Thrips, Aphids, dan lainnya. Selain itu Bunga Matahari dapat dijadikan inang atau berkembangnya musuh alami baik dari parasitoid dan predator. Hasil deskriptif menyimpulkan bahwa Bunga Matahari melalui manipulasi habitat efektif untuk mengendalikan hama dan mengurangi kebutuhan pestisida untuk pertanian berkelanjutan. Manfaat yang bisa diambil dari penelitian ini adalah mengoptimalkan pemanfaatan tanaman refugia sebagai alternatif pengganti pestisida, pengurangan penggunaan pestisida dapat mengurangi jumlah residu pada produk pertanian, mengurangi resistensi hama maupun penyakit, ramah lingkungan, dan meningkatkan keanekaragaman spesies predator maupun parasitoid dalam ekosistem. Kata Kunci: Bunga Matahari, hama, manipulasi, dan pestisida. Introduction

In pursuing high production, free from the attack of plant-disturbing organisms in the form of pests, diseases, and weeds, the majority of farmers use pesticides as an effort to control. Excessive use of pesticides causes problems such as residues in cabbage, tomato and carrots in Malang and Cianjur containing harmful compounds ranging from endosulfan sebebsar 7.4 ppb, chlorpyrifos, and carbonyl (Munarso, Broto, Wisnu, & Miskiyah, 2009). The highest residue was found in carrot plants with a value of 10.6 ppb both in Malang and Cianjur. Excessive use of pesticides in agricultural environments leads to a decrease in the amount of biodiversity because the toxin contained in pesticides kills not only pests but also beneficial organisms and may become toxic to the crop itself (Sanchez-Bayo, 2002).


In the biodiverse ecosystem biotic and abiotic components interact without any problems for the components. A positive association between biotics and abiotics as an indicator of ecosystem sustainability. Such an environment becomes the medium for the occurrence of life cycle processes ranging from food chain, pollination, biochemistry, and plant growth. The sustainability and enhancement of biodiversity in ecosystems is influenced by integrated pest management which reduces the use of pesticides to enhance natural conservation (Landis, Wratten, & Gurr, 2000). The use of pesticides, alone, within the scope of agriculture as an effort to protect plants is not a solution to reduce the attack of plant pest organisms. Efforts need more effective control which is safe, efficient and sustainable. Use of refugia can assist in attaining these objectives. Sunflower (Helianthus annuus L.) is one of the species of refugia that has the potential to increase biodiversity in the ecosystem. Sunflower is a source of protein production for both humans and animals and acts as a host for pollinators and predators (Laudadio, Bastoni, Introna and Tufarelli, 2013). The presence of sunflower has been shown to control Thrips in cucumber plants, an application of the concept of IPM (Integrated Pest Management) (Jones, Scott-Dupree, Harris, Shipp, & Harris, 2005) Approach The framework of innovation offered is to make ecosystem management by planting sunflower around the crop. In general, planting activities only apply to monoculture systems. The authors proposed that a certain area of land should be arranged to provide space for sunflower planted with a ratio of 30% sunflower and 70% commodities to be planted. Habitat modification for the use of refugia crops such as sunflower is grown using a random sampling model to achieve the desired effectiveness and biodiversity. Jonsson, Wratten, Landis, Tompkins, & Cullen, (2010) proposed that the existence of refugia crops in the planting section may serve as hosts pollinators and predators which may decrease the longevity and fecundity of pests. The design of habitat manipulation can be seen in Figure 1.

Figure 1. Design habitat manipulation using Sunflower by random sampling commodity age of a crop. This adjusted the condition of the Sunflower so that the maximum age of sunflower was 2 months. At flowering the crown of flowers will be the center of food for pollinators and parasitoid insects. At the bottom of the leaf can be a breeding ground or insect resting place. At certain plant growth stages insects such as parasitoids and predators will automatically use their sensors to search for and kill prey. So when a pest attack on commodities occurs natural enemies, both parasitoids and predators, will control it. One of the success variables that can be seen is the intensity of attacks and symptoms of attacks caused by plant pests. The author's illustration presents the framework graph of the applied method (seen in Figure 2.)

Figure 2. Mechanism of innovation manipulation habitat


Discussion Synthetic pesticides are toxic compounds used in controlling killing plant-disturbing organisms at the farm level. The use of synthetic pesticides is very effective in controlling, even killing plant pests that attack the main plants. Farmers assume that the more pesticides are used the higher the agricultural production is produced. However, the use of synthetic pesticides is the last alternative of control techniques that have been recommended by the government becausel some negative impacts result, such as pest resistance to chemical compounds causing pest resurgence (mass pest explosion). In the long term the use of excessive pesticides can also disrupt the balance of nature through environmental pollution. Residues from synthetic pesticides that affect humans, contributing to chronic diseases such as cancer, shortness of breath and heart attack. Policies in regulating and managing the use of pesticides need to be taken seriously so as not to harm farmers both economically and environmentally. Considering the disadvantages of pesticides, agricultural cultivation should be based on the concept of zero pesticides. Integrated pest control techniques become a reference in controlling pests with theemphasis on nature conservation or utilization of natural materials (natural resources), such as planting refugia plants on the periphery of crops. Refugia act as microhabitats for natural enemy insects and as a major pest plant trap. Refugia flowers produce nectar which can attract natural enemy insects or plant pests. Natural enemy insects will eat plant pests during competition in getting nectar. In this cycle there will be natural pest control without disturbing the environmental balance. Increasing public demand for food and public awareness of the importance of maintaining health makes organic products more widely sought after. Organic farming is one of the ecosystem management systems that requires assurance (ecolabelling) that agricultural products should be safe to eat (food safety attributes) and, nutritional attributes. Compared to the planting areas of the world, organic land in Indonesia is relatively small, only 2.9 million ha (Willer and Kilcher, 2011). The preferences of the world market for organic farming needs to increase by about 20% annually to meet demand. Therefore, considering the potential developments of export commodities such as coffee and cocoa in Indonesia are getting brighter, so it needs to be developed through organic farming. Future work An Indonesian program with a theme for better biodiversity is important for conservation of biodiversity. Such a program will need to be multi-disciplinary and multi-institutional. Reducing demand for pesticides; land use change; pollution of the environment; illegal logging and increasing population need to be considered as all can decrease biodiversity in an ecosystem. References Jones, T., Scott-Dupree, C., Harris, R., Shipp, L., & Harris, B. (2005). The efficacy of spinosad against the western flower thrips, Frankliniella occidentalis, and its impact on associated biological control agents on greenhouse cucumbers in southern Ontario. Pest Management Science, 61(2), 179–185. https://doi.org/10.1002/ps.939 Jonsson, M., Wratten, S. D., Landis, D. A., Tompkins, J. M. L., & Cullen, R. (2010). Habitat manipulation to mitigate the impacts of invasive arthropod pests. Biological Invasions, 12(9), 2933–2945. https://doi.org/10.1007/s10530-010-9737-4 Landis, D. A., Wratten, S. D., & Gurr, G. M. (2000). HABITAT MANAGEMENT TO CONSERVE NATURAL ENEMIES OF ARTHROPOD PESTS, 175–201. Laudadio, V., Bastoni, E., Introna, M., & Tufarelli, V. (2013). Production of low-fiber sunflower (Helianthus annuus L.) meal by micronization and air classification processes. CYTA-Journal of Food, 11(4), 398–403. https://doi.org/10.1080/19476337.2013.781681 Munarso, Broto, Wisnu, & Miskiyah. (2009). Studi kandungan residu pestisida pada kubis, tomat, dan wortel di Malang dan Cianjur. Buletin Teknologi Pascapanen Pertanian, 5, 27–32. Sanchez-Bayo, F. (2002). An Approach for Ecological Risk Assessment of Pesticides in Agriculture. Journal of Pesticide Science, 27(4), 425–428. https://doi.org/10.1584/jpestics. 27.425. Willer, H. and L. Kilcher. 2011. The world of organic agriculture. Statistics and Emerging Trends 2011. IFOAM, Bonn, and FiBL, Frick.


CASE STUDY: RISK ANALYSIS OF CADMIUM EXPOSURE IN POPULATION CONSUMING ASAPHIS VIOLACENS IN TAWIRI VILLAGE, AMBON Gracia Victoria Souisa Faculty of Health, Indonesia Christian University of Mollucan Jalan OT Pattimaipauw, Ambon, Mollucas, [email protected]

Abstract The village of Tawiri is located on the outer Ambon Bay and is potentially susceptible to contamination by heavy metal cadmium sourced from shipping activities. Pollution in the waters can accumulate in marine life such as Asaphis violacens shells consumed by the people of Tawiri Village so it is important to note the biosecurity implications of chemical agents. This type of research is an observational study with an Environmental Health Risk Analysis design where risk factors are measured at the same time to predict the magnitude of health risks due to cadmium metal in shells. This study was conducted to determine the level of health risks to the population in the village of Tawiri due to consuming shell containing cadmium from the coast Keywords: contamination; cadmium; shipping; health

Abstrak Desa Tawiri, berada pada Teluk Ambon bagian luar dan potensial terjadi pencemaran logam berat cadmium yang bersumber dari aktivitas perkapalan. Pencemaran pada perairan dapat terakumulasi pada biota laut seperti kerang Asaphis violacens yang dikonsumsi oleh masyarakat Desa Tawiri sehingga penting diperhatikan biosecuritasnya dari agent kimia. Jenis penelitian ini adalah penelitian observasional dengan rancangan Analisis Risiko Kesehatan Lingkungan dimana faktor-faktor risiko diukur pada waktu yang sama untuk memberikan prediksi besarnya risiko kesehatan akibat logam cadmium dalam kerang. Studi ini dilakukan untuk mengetahui tingkat risiko kesehatan pada penduduk di Desa Tawiri akibat mengkonsumsi kerang yang mengandung Cadmium dari pesisir pantai Desa Tawiri. Kata kunci: kontaminasi; cadmium; pengiriman; kesehatan Introduction Ambon Bay is a producer of various marine biota, such as fish and shellfish. This local food is in demand and often consumed by society so it is important to pay attention to its biosecurity. Ambon Bay has potential in various activities for catching and cultivating fish. In addition, Ambon Bay is a marine traffic lane. With the improving economic conditions, the ownership of coastal land, including coastal waters is being seized by entrepreneurs and the general public so that the need for good spatial arrangements and land ownership is great. Some of the activities that contaminate the bay and marine biota, among others, are domestic waste due to the development of settlements in the coastal area of Ambon Bay, waste disposal by diesel, Pertamina depots, shipyards, ferries and speedboat sea transport, shipwrecks scattered around the bay, agricultural waste, and other wastes, potentially contributing heavy metal contaminants such as lead, cadmium, chromium and various other heavy metals. This is thought to lead to a decrease in the number, species and individuals of certain types of benthos (flora and fauna found on the bottom, or in the bottom sediments, of a sea, lake, or other body of water) as well as molluscs, crustaceans and mangroves. The village of Tawiri, located on the outer bay of Ambon is susceptible to heavy metal pollution originating from shipping activities. People in Tawiri Village consume shellfish, so it is important to examine the concentration of heavy metals in the shell so as not to endanger public health. Research in Inner Bay of Ambon using the Gafrarium tumidum shells showed the concentration of chromium ranging from 0,09 – 0,36 mg/kg dry weight, cadmium 0,01 mg/kg dry weight and copper 0,37 – 0,51 mg/kg dry weight (Hattu, 2007). Asaphis violacens shells in Tawiri Village show the concentration of cadmium 0.0424 mg/kg (Souisa, 2015). Approach This was an observational study with an Environmental Health Risk Analysis (EHRA) design, where risk factors were measured at the same time to predict the magnitude of health risks due to cadmium metal in shells. The study was conducted to determine the level of health risks to residents in the village of Tawiri due to consuming Asaphis violacens shells containing cadmium originating from the coast of Tawiri Village. This research will be done through four stages of study that is hazard identification, dose-response analysis, exposure analysis and risk characterization. International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar 21

Calculation of intake rate will be used the following formula:

I =

C × R × f E × Dt …………………………………………….(1) W b × t avg

Added information: I = Intake (mg/kg/day). Number of cadmium that enter (intake) into human body/ body weight/ day C = cadmium concentration in shells (mg/gram) fE = Exposure frequency (365 day/year) Dt = Exposure duration (year), 30 years for exposure duration with noncarcinogenic effect Wb = Body weight of respondent (kg) R = Intake rate (gram/day) tavg = Averaging exposure time for non-carcinogens (Dt x 365 day/years) While the magnitude of the risk will be calculated based on the following formula (Reference dose (RfD) value is a constant with a value of 1 x 10-3 mg/kg/day for cadmium):

RQ =

I RfD

……………………………………………………….(2)

Discussion Food biosecurity is an important issue in Indonesia to avoid exposure to agents in food, thus helping to maintain the health and well-being of the people. One potential agent is a chemical agent such as heavy metal cadmium, which is present in the waters due to contamination by various human activities. Shellfish can accumulate larger metals in other animals because of their sedentary nature, slow to avoid pollution effects, and having a high tolerance to certain metal concentrations. Thus, shellfish can be excellent indicators for monitoring pollution of an environment (Darmono, 2010). Chronic toxicity cadmium can damage the body's physiological system, including the urinary system, the respiratory system, the circulatory system (blood) and the heart, the reproductive system, the nervous system, can even cause bone fragility. It is therefore important to assess the level of health risks to residents in Tawiri Village due to consuming shrimp containing cadmium originating from the coast of Tawiri Village. In an environmental health risk analysis, risk agent exposure received by each individual is expressed relative to intake. It is therefore important to know the concentration of risk agents within the shell, and anthropometric characteristics (weight, consumption pattern). EHRA estimates or calculates risks that have been, are and will be. EHRA research was conducted through four stages of study: hazard identification, dose-response analysis, exposure analysis and risk characterization. Furthermore, it needs to be communicated to the stakeholders (risk communication). Future work A further project that can be done from this result is a biomarker approach that utilizes a biomolecular system that is a system under an individual organization of molecules in the form of enzymes or proteins secreted by aquatic organisms in response to the presence of heavy metals. When heavy metal accumulates in the cell, the biomolecular system responds by detoxification or assimilation which allows for homeostasis. Some proteins that can be used as biomarkers of heavy metals in the waters are metallothionein (MT) and hsp70 (proteins which are central components of the cellular network of molecular chaperones and folding catalysts). Furthermore, it can also be calculated from the number of mg of shell safe to be consumed by society. References: Hattu, S. (2007). Analisis Kadar Logam Berat Cu, Cd, Cr dalam Daging Kerang Manis (Gafrarium tumidum) pada Perairan Teluk Ambon Bagian Dalam. Universitas Pattimura, Ambon. Souisa Gracia. (2015). Model Dinamis Pencemaran Cadmium dan Timbal di Teluk Ambon. Media Kesehatan Masyarakat Indonesia. Volume 11 No 3. Darmono. (2010). Lingkungan Hidup dan Pencemaran. Jakarta: UI Press.


SAGO PALM AS LOCAL FOOD SECURITY: SUSTAINABILITY AND AWARENESS Henny Tribuana Cinnawara Center for Social Ecology and Biodiversity, Andi Djemma University [email protected]

Abstract In this paper sago palm is explored as a local food and potential contributor to future food security in a sustainability and community awareness context. Demand for sago will increase in the future. The sustainable use of sago palm needs educational programmes to raise community awareness of food security and its values. Keywords: Sago Palm, food security, sustainability, awareness, Palopo Indonesia

Abstrak Tulisan mengeksplorasi makanan lokal sagu sebagai penyumbang potensial ketahanan hayati di masa depan dalam konteks keberlanjutan dan kesadaran masyarakat. Permintaan sagu akan meningkat di masa depan. Kelestarian pemanfaatan sagu membutuhkan program pendidikan untuk peningkatan kesadaran masyarakat akan biosecurity dan nilai-nilainya. Kata kunci: sagu, ketahanan pangan, keberlanjutan, kepekaan, Palopo Indonesia Introduction Sago palm (Metroxylon sagu), a tropical plant which mostly grows naturally and is distributed in the Eastern Part of Indonesia, is an alternative food source to rice which is important in the future. The government and the United Nations Food and Agriculture Organization (FAO) opened an integrated sago processing plant in Southeast Sulawesi in December 2017. This FAO-led program aims to reduce dependency on common sources of carbohydrate (grain, rice and corn) by taking advantage of indigenous sources of starch. In some areas of Sulawesi, especially in Palopo, society consumed traditional food such as kapurung, dange, and sinole (sago based food) as daily food. Currently kapurung is favored by local people and by people outside Sulawesi; this is a challenge to sago as local food security in South Sulawesi. The sustainability of sago in the future is of concern. Demand has increased and the predicted need for sago in South Sulawesi will also increase. However, currently the existence of sago palm is facing threats due to land conversion into settlement areas, dry agriculture land, and industrial areas. The life cycle of sago palm is long (8-12 years). People’s knowledge about sago is still limited as well as the use of technology to produce food products. Market price of sago palm is very low because of the low product quality, which is affected by pest and disease influence. Sago palm is not much cultivated yet but many local people consume it as a staple food. To maintain availability of sago palm in the future we need to develop awareness of local people and multi-stakeholders about sustainable sago palm management including regulation of conserving and preserving sago palm in the community. Approach The purpose of this case study is to explore sago palm as a local food and as a potential contributor to future food security in a sustainability and community awareness context. This case study was conducted in Palopo City in Indonesia. Palopo is a city on the edge of the Gulf of Bone and at the foot of the Wallacea mountain range; it has the third largest area of sago in South Sulawesi, covering an area of 258km2 with a population of nearly 152,000 people, and is one of important commodities besides coconut, vanilla, and cocoa. Data were collected for this study from two studies through qualitative and quantitative research, using in-depth interviews. The first case study was LKR (Lela Kapurung Restaurant) in Palopo, a food restaurant which sells Kapurung as their main menu item. At that time, LKR is one of the famous kapurung restaurants in Palopo. A unique restaurant business was established in order to revive the flavor of local food using simple raw materials and suitable for all ages; the qualitative data was used for descriptive analysis to explore the increased demand for sago. The second study used a base line KAP survey as a quantitative study of a specific population. It collected information on what people know, how they feel, and how they behave in relation to known awareness of local people and multi-stakeholders about sustainable sago palm. The collected data were analyzed using a mixed research design, which is produced for collecting, analyzing, and mixing both quantitative and qualitative research and methods to understand a research problem. The quantitative data were used for statistical analysis to analyze the Knowledge, Attitude and Practices of community awareness of local people and multi-stakeholders about sustainable sago palm.


Results and Discussion LKR (Lela Kapurung Restaurant, sells Kapurung in Palopo. There are many kapurung restaurants listed in South Sulawesi and Indonesia now; in addition, it is predicted that this will increase in the future because the market of kapurung restaurants is promising. Currently LKR needs 2 balabba of crude sago (approx. 15kg/balabba) per day. This means, there should be approximately 900 kg of crude sago per month or 10,800 kg per year. So from this we can estimate how much sago is needed by all kapurung restaurants in South Sulawesi. To keep this sago based restaurant business running the sustainability of sago as an important raw material should be considered due to the potential increased need for sago by this business. The second study result obtained that 27% of known sago faced destruction, caused by land convertion to agriculture area, illegal logging, fire and expanding roads. Therefore, sago palm is threatened in its original habitat. Local regulation (especially in the village) of sago conservation does not yet exist. Awareness of conserving and maintaining sago is absent and there is limited knowledge about utilization of sago palm. Consequently, local people agree to develop an agreement to reduce forest destruction and expand knowledge of sago palm and is uses. Future work The extinction of sago palm will not only be a great loss to local food, but it also signals the loss of one part of Wallacea biodiversity. If sago becomes extinct, this will threaten the local food supply in the community. In addition, sago starch is not just limited to its uses for the food industry but can also be used as a key material input in various industries and many uses. Therefore, it is important to arise awareness of the local community and multi-stakeholders to maintain the sustainability of sago palm, including regulation of conserving and preserving sago palm in community. In the future sago has the potential to become a product in the global market. References Flach Michiel. 1997. Sago palm. Metroxylon Sagu Rottb. Promoting the conservation and use of underutiized and neglected crops. (ISBN 92-9043-314-X) 13. Institute of Plant Genetics and Crop Plant Research, Gatersleben/International Plant Genetic Resources Institute, Rome, Italy. Santillan Meriam M., and Jojen R. Santillan. 2013. Habitat suitability analysis of the starch-rich sago palm using satellitederived data and species distribution model. 34th Asian conference on remote sensing (ACRS 2013), Bali, Indonesia. Volume 4 pp 3107-3144


UTILIZATION OF LOCAL RESOURCES IN SUPPORT OF FOOD SECURITY IN SIMANTRI (INTEGRATED AGRICULTURAL SYSTEMS) IN SUB LUKLUK, MENGWI, BADUNG I Gusti Lanang Adiwirawan Patra

Bali Institute for Agricultural Technology Jl. Bay pass Ngurah Rai Pesanggaran South Denpasar, Bali 80222 Email: [email protected] / Phone: 085237384889

Abstract The purpose of this paper is to know how much influence the Integrated Farming System on Lukluk Village, Mengwi Subdistrict, Badung Regency has in utilizing local resources for livestock farming in support of food security. The research method is the use of Participatory Rural Appraisal (PRA) through direct interview and observation in the location of integrated farming system groups with descriptive analyzes. Based on the results of the study, the group of integrated farming system has largely utilized local resources in livestock farming. It is anticipated that, in the future, the utilization of local resources for livestock farming by the integrated farming system group In Lukluk Village, Mengwi Subdistrict, Badung Regency will further enhance its development. Keywords: Farming, Local Resources, Integrated Farming System

Abstrak

Tujuan dari penulisan ini adalah mengetahui seberapa besar pengaruh SIMANTRI (Sistem Pertanian Terintegrasi) pada Kelurahan Lukluk, Kecamatan Mengwi, Kabupaten Badung dalam memanfaatkan sumberdaya lokal untuk usahatani ternak dalam mendukung ketahanan pangan. Metode penelitian yang digunakan adalah Participatory Rural Apprasial melalui wawancara secara langsung kepada petani dan observasi ke lokasi SIMANTRI, dengan analisis secara deskriptif. Berdasarkan hasil penelitian, sebagian besar kelompok SIMANTRI telah memanfaatkan sumberdaya lokal dalam berusahatani ternak. Disarankan agar ke depan pemanfaatan sumber daya lokal untuk usahatani ternak oleh kelompok Simantri di Kelurahan Lukluk, Kecamatan Mengwi, Kabupaten Badung dapat ditingkatkan lagi pengembangannya. Kata kunci: Usahatani, Sumberdaya lokal, Simantri Introduction A farming system is a series of natural resource management activities. At present the application of agricultural systems towards more integrated farming systems is considered most appropriate to optimize the use of existing resources through the principle of zero waste in a process where all farming components can be utilized to the maximum until there is no waste. Simantri is a breakthrough in efforts to accelerate the adoption of agricultural technology transfer to rural communities. The technological innovations introduced oriented agricultural development without waste (zero waste) and produce 4 F (food, feed, fertilizer and fuel). The main activity Simantri is integrating the cultivation of crops and livestock, where the plant waste is processed for feed grade (fodder) and a backup feed during the dry season; livestock waste (faeces and urine) is processed to become bio-gas, bio urine, organic fertilizers and bio-pesticides (Wisnuardana, 2009). According to Rai Yasa, 2012, through integrated farming practices, agriculture has the potential to contribute from the economic, ecological, and social viewpoint because, in addition to earned income generation, integrated business efficiency is also potentially bringing new jobs, as well as becoming more environmentally friendly by integrating the cattle raising activities with other farming activities to achieve high efficiency production. Solid waste from plant material can be processed into organic fertilizer, or bio-gas, while liquid waste can be processed into bio urine, all of which will provide added value for farmers' income (Wisnuardhana, 2009). The village of Lukluk has a huge potential in the development of the agricultural sector, especially rice paddy, pulses and vegetables. Cows are artificially inseminated in this area, showing the seriousness of the government to help cattle farms in the area. The government policy is welcomed by farmers and this is reflected in the success of the herd (Simantri) which seized the championship title at the contest group ‘Simantri se Bali’.


Methodology This research was conducted in groups in the Village Lukluk Simantri Mengwi Badung. This Simantri group has developed since 2009 and in 2010 already elected to be the best Simantri group program in the province of Bali. Respondents are determined by census of the entire group. There were 45 respondents who believed thatimantri Lukluk was the best program. This study uses quantitative and qualitative data sourced from primary and secondary sources. The analysis was conducted as an introductory tabulation of data, processing the raw data from the field into the input data required for analysis. Descriptive analysis is undertaken to identify the obstacles encountered in the development effort of Simantri. Results and Discussion Village Lukluk Mengwi in Badung regency consists of seven hamlets, with an area of 512.98 hectares. Cows are artificially inseminated in this area, showing the seriousness of the government to assist dairy farms in both regions. Many waste food crops can be used as cattle feed, such as corn bran, rice bran, rice straw, corn straw, peanut straw, bark cocoa, coffee skin and much more. Plants are integrated with Simantri Integration program ‘Livestock and Foodstuffs’, showing crop productivity improving cattle production itself. 1. Rice Paddy fee per cropping season amounted to Rp. 4,905,000. The average use of local inputs in rice farming for one growing season by Simantri Lukluk Village Mengwi Badung regency in 2015 was Rp. 3,430,000 - with an area of farmland on average of 49 acres, or 70% of the total cost. 2. Cattle Total cost for the cattle business by Simantri for every female cow is Rp. 8,120,556. The use of local inputs was valued at Rp. 7,020,556 - or as much as 80.87%, a saving of Rp. 1,100,000. Future work It is expected that these activities will receive support from various parties, because Simantri is an activity that can meet the needs of vegetable and animal food. Cooperation can be undertaken by international organizations in the field of biosecurity as an example, UNESCO. References Wisnuardhana. 2009. Technical Guidelines Development Activity Integrated Farming Integrated Farming System. Department of Agriculture: Bali Province. Wisnuardhana, IB. 2009. Building a sustainable village with "Simantri" (integrated farming system. Department of Agriculture province of Bali, Denpasar. Distanprovinsibali.com/berita/simantri.doc. Yasa, IMR, 2012. Model Sustainable Development Bali Cattle in Dryland (Study case Gerokgak Buleleng district). Dissertation, Graduate School of Bogor Agricultural University.


COMMUNITY STRUCTURE, PROSPECTIVE TEACHER & SOCIETY PERCEPTION OF SEAGRASS IN SANUR BEACH Ida Bagus Ari Arjaya

Universitas Mahasaraswati Denpasar [email protected]

Abstract This study aims to analyze: 1) Community structure of seagrass beds in Sanur Beach, 2) Prospective teacher & Society Perception of seagrass in Sanur Beach. The method that will be used in this study is mixed method. Quantitatively, this study, will use quadratic method 2 x 2 m with Purposive Sampling. Qualitatively, the study will use descriptive and questionnaire, observation, and interview analysis. This study will use four observation stations with each of four crossshore squared transects. Based on the preliminary observational data, prospective teachers and society in Sanur Beach have a lack of knowledge of the ecological role of seagrass. Keywords: community structure, prospective teacher & society perception, seagrass

Abstrak

Penelitian ini bertujuan untuk menganalisis : 1) Struktur komunitas padang lamun di Pantai Sanur 2) Persepsi mahasiswa calon guru dan masyarakat mengenai padang lamun di Pantai Sanur. Metode penelitian yang dipergunakan dalam penelitian ini adalah Mixed Method. Secara kuantitatif penelitian ini menggunakan kuadrat 2x2 meter dengan teknik Purposive Sampling. Selanjutnya secara kualitatif penelitian ini menggunakan kuisioner, observasi, dan analisis interview. Terdapat 4 stasiun observasi dengan 4 transek yang membentang secara cross shore. Berdasarkan hasil penelitian pendahuluan, mahasiswa calon guru dan masyarakat tidak mengetahui peran penting padang lamun bagi ekosistem di Pantai Sanur. Kata Kunci: struktur komunitas, persepsi mahasiswa calon guru dan masyarakat, padang lamun

Introduction The wide range of biodiversity and sensitivity to changes in water quality inherent in seagrass communities makes seagrasses play a significant role in the overall health of the beach intertidal zone. Seagrass has several functions to support coastal ecosystems such as stabilizing the sea bottom, providing food and habitat for other marine organisms, maintaining water quality, and supporting local economies. Sanur is known as a famous beach for tourism and Balinese ceremony purposes. Threats to and loss of seagrass ecosystems globally, impact not only natural resources but also the lives of people who directly or indirectly depend on these systems (Mtwana, 2016) . Seagrass ecosystems play a multifunctional role in human well-being, for example, food through fisheries, control of erosion and protection against floods. The seagrass ecosystem in Bali has been much degraded as a result of community activities and development such as rock-taking, Serangan Island reclamation, and seaweed cultivation on the island of Nusa Penida and Lembongan, and tourism activity. Based on that, its very interesting to study about community structure of seagrass as a biological indicator to predict ecosystem degradation in Sanur Beach. Moreover, to measure the anthropogenic impact, this study also combine the prospective teacher and society perception about the ecological role of seagrass. Then, by use of all that data, this study will not only be helpful to inform about the condition of Sanur Beach but also the people’s perception of it (academic & society). Furthermore, the relationship of these data will show complex description about the condition of Sanur Beach. Based on this introduction the study aims to analyze: 1) Community structure of seagrass beds in Sanur Beach, 2) Prospective teacher & society perception of seagrass in Sanur Beach. Approach The method that will be used is a quadratic method 2 x 2 m by using Purposive Sampling Method. This study will use 4 observation stations with each of 4 cross-shore squared transects. Based on the preliminary observational data, there are seven species of seagrasses belonging to four genera: Enhalus acoroides, Cymodocea rotundata, Cymodocea serrulata, Halophila ovalis, Halodule uninervis, Halodule pinifolia and Syringodium isoetifolium. Moreover, this research also uses qualitative methods such as interview, observation, documentation and questionnaire to describe the perception of prospective teacher and society perception of the ecological role of seagrass in Sanur Beach by using a Likert Scale to measure agreement or disagreement with a particular statement. International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar 27

Discussion This study plays a significant role in biosecurity in Indonesia, especially in Bali. Information on the community structure of seagrass in Sanur will tell whether the ecosystem on the Sanur coast is degraded or not. If the H index is very low, the dominance (C Index) of some species index would be very high, and E index would be very high so it can be concluded that the ecosystem has been degraded. Furthermore, the low H index of some seagrass species gives a sign that the species should be catagorized as an endangered species in that region. The damage to the seagrass ecosystem will affect other ecosystems because the seagrass is a buffer ecosystem that supports other ecosystems such as coral reefs, mangroves, and estuaries. Biologically, the seagrass ecosystem has a significant role in spawning, feeding, and hosting many species of nekton, macrobentos and other microorganisms. Furthermore, the perspectives of students and society about seagrass become valuable in describing anthropogenic aspects and its relation to seagrass conservation. Future work The future work of this study will involve a collaboration with LIPI and Non Govermental Organizations related to marine issues in order to conduct a study in a more extensive scope in Bali. The genetic molecular research about all related seagrass species would be a good scientific contribution to plant biosecurity in Bali. References Mtwana N. L, Koch EW, Barbier EB, Creed JC. (2016).Seagrass Ecosystem Services and Their Variability across Genera and Geographical Regions. PLoS ONE 11(10): e0163091. https://doi.org/10.1371/journal.pone.0163091. Odum, E.P. (1993). Dasar-Dasar Ekologi. Edisi Ketiga. Universitas Gadjah Mada Press, Yogyakarta (Penerjemah Tjahjono Samingar).


STRENGTHENING THE ROLE OF SRI (SYSTEM OF RICE INTENSIFICATION) METHOD AS PADDY BIOSECURITY AND FOOD SECURITY IN INDONESIA Luh Putu Suciati

Agribusiness Department, Agriculture Faculty, Jember University [email protected]

Abstract

Paddy cultivation in Indonesia is characterized by the high cost of chemical fertilizer and pesticide input. The impact of excessive farm input utilization and less environmentally friendly practices in the long term will be an ecological threat to biosecurity and food security. The SRI method (System of Rice Intensification) is expected to solve the problem of paddy food security and bio insecurity, but only a few farmers apply the method. The constraints of SRI Method application are distinguished into environmental, technical, social and economic. Policy is required to strengthen the implementation of the SRI method related with multi stakeholder collaboration to reduce transaction cost and other technical barrier. For future policy, interventions are needed through farm insurance and environmental service schemes. Keywords: System of Rice Intensification/SRI, biosecurity, food security

Abstrak

Budidaya padi di Indonesia ditandai dengan tingginya biaya input pupuk dan pestisida kimia. Dampak pemanfaatan input pertanian yang berlebihan dan kurang ramah lingkungan dalam jangka panjang akan menjadi ancaman ekologis terhadap ketahanan pangan dan keamanan hayati. Metode SRI diharapkan bisa mengatasi masalah ketahanan pangan dan keamanan pangan padi, namun hanya sedikit petani yang menerapkan metode ini. Kendala penerapan Metode SRI terkait aspek teknis lingkungan, sosial dan ekonomi. Kebijakan penguatan peran metode SRI dilakukan melalui kolaborasi multipihak untuk mengurangi biaya transaksi dan hambatan teknis lainnya. Untuk kebijakan masa depan, perlu intervensi melalui skema asuransi pertanian dan jasa lingkungan. Kata kunci: Sistem Intensifikasi Padi / SRI, ketahanan pangan, keamanan hayati Introduction

The world’s food security and biosecurity is under threat because of pressure on productive capacity that stems from rapid demand in growth and a deteriorating natural resource base, which is increasingly unpredictable due to climate change. Paddy production still depends on many chemical inputs and water availability beside the other factors. Farmers have only focused on production as tangible benefits without considering the intangible benefits of improving environmental conditions. Going forward, the paddy production-based approach of the Green Revolution that sought cheap and abundant supplies of food is no longer comprehensive enough. The needed increases in food production must be brought about sustainably, using natural resources wisely to be able to ‘indefinitely meet the requirements for food, feed and fiber at socially acceptable economic and environmental cost’ Crosson, R. (1992). Most of the required growth in global production is going to have to come from intensification because land and water are finite assets already overused in many places. Increases in food production can come from agricultural intensification, the expansion of the agricultural frontier, or a combination of the two. One of the methods that could potentially improve the national rice production is the rice cultivation system called SRI (System of Rice Intensification). The practices of SRI are emphasizing the cultivation of land management, crop and water through the empowerment of indigenous groups and based on environmentally friendly activities. Since its introduction in 1997 until today, the development of SRI Paddy Cultivation in Indonesia in general feels slow, farmers have not fully adopted. The objectives of this paper were (1) to describe determinant factors to encourage application of SRI method (2) to construct the strategy of resource governance to strengthen the role of SRI method in paddy biosecurity and food security in Indonesia


Approach This study uses a mixed methods approach (social, economic institutional and environment methods) to investigate implementation and application of various constraints to SRI in Cianjur and Karawang regency both in West Java, and Jember Regency in East Java. Descriptive method aims to create a systematic, factual and accurate visualization and information about the facts, the nature and relationships among the phenomena investigated. Structured questionnaires are used to promote understanding of the role of the SRI method for paddy biosecurity and food security with the basic theory of agency and economic transaction cost. Agency relation is one of the institutional economic approaches to describe the role of Principal - Agent between resource owners and resource users. The Principal-Agent is part of the organizational economic theory, which seeks to recognize the problems that arise in the relationship between two or more individuals or groups and helps explain how related party relationships can be harmonized by minimizing transaction costs (Anwar A.1995). The analysis of economic transaction costs includes three categories: (1) information costs, (2) shared decision-making costs, and (3) operational costs. The first and second category is the transaction cost before the activity (ex ante), while the third category is the transaction cost after the activity (ex post). Logistic regression analysis is used to analyze the factors determining the application of the SRI method. Dynamic modeling analysis will predict three policy scenarios to increase implementation of SRI Methods: Incentive of Payments for Environmental Services (PES); financial credit Support (for example, agriculture insurance), and Contract Support: market and price guaranteed. Discussion The SRI method promotes environmentally friendly farming methods, returning to nature, and producing products that are free of harmful chemical elements. The quantity and quality of results is also better but unfortunately has not received a positive response from farmers, because although the results are very promising, they are very troublesome to farmers in practice. The SRI method requires less water and less agricultural inputs but provides a higher yield. Study of Suciati (2014) in West Java and Rosuli et al (2017) in East Java explains that the factors that influence smallholder farmer interest in SRI method application are paddy field distance to home location. The SRI method uses a natural way to eradicate pests or diseases, so the distance factor becomes important. The position of farmers in farmer groups and peasant status also influences the activity and sustainability of the SRI method. What is interesting is the high transaction cost factor before starting some application of SRI method activities (ex ante transaction cost). Studies by Suciati et al (2014) indicate that sustainability of the application of SRI method requires using a regulation and market incentives scenario. Therefore, a resource governance strategy to encourage rice intensification of SRI methods could be environmental service schemes (for example, through raw water transfers) between the stakeholders involved (farmers, agriculture, irrigation and industry). At the national level it is necessary to support agricultural insurance to subsidize the risks faced by farmers. Collaborative partnership is one way to expand the Application of SRI Method for paddy biosecurity and food security. Understanding of farmers’ influences is surprisingly weak, beyond general remarks that farmers tend to trust their agricultural extension worker. There is a need for better methodologies to fully appreciate how farmers’ practices are shaped.


Future work Several activities will be undertaken to strengthen the application of environmentally friendly farming systems for paddy food security and biosecurity. I. II.

Stakeholder mapping for building stronger partnerships with industry and all levels of government. Other purposes are increased understanding of the social factors leading to adoption of good biosecurity practices and minimizing social consequences during an incursion. Developing research models related to risk management assessment and uncertainty factors.

For future work, an interdisciplinary method will be used to design adaptive management strategies and mitigations of smallholder farmers for increase the application of the SRI method. References Crosson, R., 1992. Sustainable agriculture, Quarterly Newsletter. Resources of the Future. Rosuli, EM, Suciati, LP, Sunartomo, AF. 2017. Pengambilan Keputusan Petani Dalam Penerapan Metode Sri (System of Rice Intensification) Di Kabupaten Jember. Skripsi. Jember: Universitas Jember. See URI: http://repository.unej.ac.id/handle/123456789/79748 Suciati, LP. 2014. Peran Kelembagaan Perdesaan untuk Keberlanjutan Penerapan SRI di Kabupaten Karawang (Rural Institution Role for SRI Application Sustainability in Karawang). Jurnal Ekonomi dan Pembangunan Indonesia Volume 14 No. 2 Januari 2014 Suciati, Juanda, Fauzi and Rustiadi. 2014. Developing for Water Resources Incentives to Support System of Rice Intensification (SRI) in Jatiluhur Irrigation Area. IOSR Journal of Humanities and Social Sciences Volume 19 Issues 11, November 2014


THE ‘BIOCHAR’ APPLICATION IN PADDY FARMING TO MITIGATE THE INCURSION OF PESTS AND DISEASES Maria Maghdalena Diana Widiastuti

Musamus University Merauke Jl. Kamizaun Mopah Lama Merauke Papua 99616 [email protected]

Abstract Biochar is an active charcoal which comes from burning biomass with minimal oxygen. Biochar as a soil enhancer could increase soil nutrients and rice production. Biochar also has an effect on reducing global warming due to carbon trapping. The application of biochar is one of the efforts in building the biosecurity mechanism, as it mitigates incursions of pests and diseases and reduces the use of pesticides and chemical fertilizers. Biochar can be made from agricultural waste. Benefit and cost ratio of biochar application is lower than without biochar, but residual study showed significant increased yields. Keywords: biosecurity, biochar, Merauke, pesticide.

Abstrak

Biochar merupakan arang aktif yang berasal dari pembakaran biomassa dengan oksigen minim. Biochar merupakan pembenah tanah yang dapat meningkatkan unsur hara dalam tanah dan meningkatkan produksi padi. Biochar juga berpengaruh mengurangi pemanasan global karena dapat menyimpan karbon dalam tanah. Penggunaan biochar merupakan salah satu upaya dalam membangun ketahanan hayati pangan, karena penggunaannya dapat mengurangi serangan hama dan penyakit dan mengurangi pemakaian pestisida dan pupuk kimia. Biochar dapat dibuat dari limbah pertanian. Nilai ratio manfaat dan biaya pemakaian biochar lebih rendah dibandingkan tanpa biochar, namun penelitian residu menunjukkan terjadinya peningkatan hasil yang signifikan. Kata kunci: ketahanan pangan, biochar, Merauke, pestisida Introduction Biosecurity is implemented to insure plants, animals and humans against incursions by pests and diseases. If not addressed immediately the presence of pest and disease attacks on rice crops will result in loss. Losses due to delays or ignorance in overcoming pests and diseases may result in a decline in farm profits, land nutrient and environmental damage. Furthermore, there are social effects when incursions impact on food security. Pests and diseases can easily attack when agricultural management is not running properly, for example the use of a lot of pesticides with excessive doses, the absence of crop rotation, or inappropriate irrigation management. The application of biochar on rice farming is one of the alternatives for reducing pest and plant diseases, because biochar application uses organic fertilizer that is environmentally friendly and resistant to plant pests and diseases. Biochar is an active charcoal derived from biomass by using a minimum of oxygen. Biochar is made from agricultural waste such as rice husk, coconut shell or wooden branches. The process of making biochar is also a relatively easy and simple technology for farmers. Biochar serves as a soil enhancer and bonds organic matter in the soil, so it can save the use of fertilizers and pesticides. Approach The introduction of biochar to farmers has been done since 2013 through the training of biochar production from agricultural waste rice husk and coconut shell. The dissemination of research results on the analysis of biochar production efforts was also done to provide knowledge for obtaining alternative income from biochar production. The approach taken for biochar dissemination has been through analysis of rice farming systems with and without biochar. Farming analysis covers the costs incurred for one growing season, and the amount of rice production and the selling price. The benefit cost ratio is compared between the land with biochar and without biochar. A higher benefit cost ratio means higher farmer profit. Making biochar to meet market demand is conducted with business feasibility methodology. The principle is the same as to estimate the amount of costs incurred to produce biochar, and production produced within one land. The results of these studies are continuously socialized with a wider scope of territory to reach many farmers.


Discussion Biosecurity is a very important concept for economics, ecology, social and health in various dimensions (Heikkila, 2011). Through biosecurity we can secure the production, ecosystem, health and social infrastructure from external threats caused by pests, diseases and pathogens in various forms. Biosecurity is a framework to anticipate the risk of entry of living things that can interfere with the preservation of ecosystems. One farmer activity which destroys the ecosystem is the excessive use of pesticides. Almost all farmers use pesticides to eradicate plant pests and diseases with one purpose, to increase yields. Farmers often ignore the healthy food, ecosystems, environment and even their own health. Widiastuti (2016) states that biochar application in the soil can reduce the use of chemical fertilizers and pesticides, reducing the cost of farming by as much as 20%. The average cost of pesticides, chemical fertilizers and labour for spraying is between Rp. 500,000 – 1,000,000 per hectare depending on the intensity and number of pest attacks. The biggest cost in the farming system is planting, around 25%. The third cost is for land preparation (17%) and the fourth largest cost is for harvesting (14%). The components of farming analysis for pesticides varies greatly each season depending on the season, the water condition, the presence or absence of pest / disease attack and the intensity of pest / disease attack. Usually for the rendeng season (rainy season), farmers spend more on pesticides than in the growing season of gadu (dry season). Farmers have used more pesticides in the last 5 years. From 3-5 types of pesticides become 5-9 type of pesticides in each growing seasons. Farmers claim to often mix some brands of pesticides to achieve quicker control of pests/diseases. Pesticides include herbicides, rodenticides and insecticides. The average farmer applies pesticides 7-11 times during the rice growing season. When applying pesticides, farmers often mix pesticide materials that will be sprayed on the ground with no self-protection. Many farmers claim they never use because they are accustomed to do that. Where used, usually farmers only use boots, hats and sometimes the mouthpiece. Other protective devices such as gloves, and glasses are used rarely. Similarly, around 81% of farmers in Magelang do not use complete protective equipment (Yuantari, 2009). The use of biochar is also able to increase the yield by almost 1 ton/ha. However, farmers’ analysis results show that the use of biochar incurs higher cost with R / C ratio of 1.46 or 0.09 higher than control. This poses a challenge to the adoption of innovation. However, residual rice production increases yield twice over. Given the benefits of biochar applications on paddy farms, it can be one of the mitigations that farmers can undertake to reduce pest and disease attacks more severely. Future work Given the importance of biochar as part of biosecurity, the introduction of biosecurity concepts to farmers, local and national governments is important to undertake. Since biochar introduction, only a few farmers are willing to apply biochar on their farms. Behavior of farmers to adopt biochar innovation is influenced by many factors - the level of education of farmers, the capital held for one planting season, or institutions that do not support. To know the things that influence the decision of farmers and the relationship between the factors that influence it is done by using multiple linear regression method. The concept of biosecurity also needs to be introduced to farmers. So far, farmers only take action against pests and diseases of plants using pesticides compared to prevention of pests and plant diseases. The costs incurred to cope are often greater than preventing. There is a need for a study on risk analysis and response by farmers in overcoming pests and diseases.


FOOD SECURITY BASED ON URBAN COMMUNITY BY VERTICULTURE Putu Eka Pasmidi Ariati

Department of Agriculture, Mahasaraswati University, Denpasar - Bali [email protected]

Abstract

The purpose of this study is to know the type of vegetable crops suitable to be cultivated in a verticulture system in urban yards. The research will be conducted in the region of Tegal Harum at the city of Denpasar, involving 20 households. Plants will be cultivated in polybags with 60% cropping medium soil mixed with 30% organic fertilizer, chemical fertilizers will not be used. They will be placed in such a way that the position is vertical or storied. The results of this research are expected to find suitable plants to be used in a verticulture system and to find an alternative for narrow garden yards with verticulture systems. Keywords: verticulture, organic, yard, polybag

Abstrak

Tujuan penelitian ini adalah untuk mengetahui jenis tanaman sayuran yang cocok dibudidayakan dengan sistem vertikultur di lahan pekarangan perkotaan . Penelitian akan dilaksanakan di wilayah Tegal Harum kota Denpasar , melibatkan 20 rumah tangga. Tanaman dibudidayakan dalam polibag dengan media tanam 60 % tanah dicampur dengan 30 % pupuk organik, tidak menggunakan pupuk kimia. Ditempatkan sedemikian rupa, sehingga berposisi vertikal atau bertingkat. Hasil penelitian diharapkan dapat menemukan tanaman yang cocok dijadikan sebagai tanaman dengan menggunakan sistem vertikultur dan sebagai salah satu alternatif dalam menjaga kestersediaan sayuan untuk lahan pekarangan sempit di perkotaan. Kata kunci: vertikultur, organik, lahan pekarangan kota, polibag Introduction Indonesia has very rich site-specific biological potential for many types of food crops, but this huge potential stands in contrast to the low public consumption of vegetables. Nutritional advice and the efforts of diversification programs promoted by the government for a long time has had limited impact on resolving this problem. The size of the yard areas are around 10.3 million ha or 14 % of the total agricultural land area and they are one of the potential sources of food that are of high nutritional and economic value. Nowadays the utilization of backyards is very common in urban farming for medicinal plants, food crops, horticulture crops, livestock, fish and others. If designed and planned well, backyards also meet the needs of their own families and have the potential to be an added source of household income. In Indonesia most of the community lives in cities that have very narrow backyards but people still need plants to support a good life. In many cases, backyard gardens support food security programs in cities. One of the strategic programs involves verticulture to utilize shared spaces around urban houses. Planting vegetables in the yard is a strategy to overcome nutritional deficiencies and provide nutritious food, because vegetables are sources of vitamins and minerals. A number of studies have concluded that the yard can be used to produce vegetables, so household nutrition will improve. In the future, the issue of food prices that tend to fluctuate as they depend on market conditions may be resolved. The President urges the Indonesian people to build Sustainable Food Houses, at the family, village and district levels, as well as in cities, so that their daily food needs can be fulfilled. Methods The purpose of the research is to know the type of vegetable crops suitable to be cultivated in backyard verticulture systems. The research will be conducted in the region of Tegal Harum, at the city of Denpasar and target backyards to improve food security. This research will involve 20 households participating in a food security program. The research will be carried out by a group involving technical experts (researchers and their support staff), as well as agricultural extensionists and farmers. The cultivation of cropswill be adjusted to fit the land that residents have, namely the use of verticulture systems in narrow yards. Plants will be grown in polybags with 60% cropping media mixed with 30% organic fertilizer. No chemical fertilizers will be used. Plants will be placed in a vertical or stratified way. To identify the plants best suited for being planted in poly bags in a verticulture system, the plants used will be compared with the same plants grown in 1 x 3m plots. The types of cultivated plants that will be used in this study are mustard greens, spinach, tomatoes, water spinach, eggplant and local chillis.


Further study According to the limited agricultural land and the existence of family food security issues, further research is needed to understand how the empty spaces around the houses could be better utilized through the use of verticulture technology. In addition, the utilization of household waste as a source of organic fertilizer can be supportive of sustainable agriculture. The outcomes that such research could achieve include improved health by strengthening the nutritional value of the communities’ diets as well as strengthening their incomes to support their prosperity. Organic farming systems enable reduced fertilizer cost and can improve the quality of food products.


DEVELOPMENT COMMUNITY BASED TOURISM TO SUPPORT FOOD SECURITY ISSUES: CASE STUDY of PETANG VILLAGE Robinardus Jampur

Agriculture Faculty, Mahasaraswati University Denpasar Agribusiness, Mahasaraswati University Denpasar Kampus Pusat, Jl. Kamboja No.11A Denpasar [email protected]

Abstract

The purpose of this study is to analyze the development of community based tourism to support food issues. The methodology used is participatory rural appraisal, in which data are collected through interviews, observation and documentation, focus group discussions with an interactive analysis and SWOT. The research showed that the village officials have not been able to manage an organization; marketing; promotion; business; development of a business unit and partnership, which are required for an integrated marketing communications model through empowerment agrowisata (agro-tourism) based food security. Keywords: Community Based Tourism, food security, empowerment

Abstrak

Tujuan studi ini untuk menganalisis Pengembangan Pariwisata Kerakyatan (Community Based Tourism) dalam Rangka Mendukung Isu Ketahanan Pangan. Metode penelitian yang digunakan yakni Participatory Rural Apprasial, yang mana data dikumpulkan melalui wawancara, observasi, pendokumentasian dan focus group discussion, dengan analisis secara interaktif dan SWOT. Hasil penelitian menunjukkan bahwa upaya aparat desa belum mampu mengelola organisasi, pemasaran, promosi, pengembangan unit-unit bisnis dan kemitraan, sehingga membutuhkan model komunikasi pemasaran terintegrasi melalui pemberdayaan agrowisata berbasis ketahanan pangan Kata kunci: Pariwisata Berbasis Komunitas, Ketahanan Pangan, Pemberdayaan

Introduction Bali establishes tourism as a leading sector because it has proved able to boost the economy of Bali, becoming the main contributor to local budgets. As a commodity, tourism covers a long cycle of activity and is able to move across other economic sectors giving it a very wide reach (Pujaastawa, 2005). Tourism development policies are currently much in favor of parties who have capital. The community, as the rightful owner of local resources, has often experienced marginalization with a decreasing quality of life in respect of community local culture. The role of society is undervalued, with community initiatives largely overlooked. Development in social learning and development in a society must start from the bottom up, where community empowerment provides many of the opportunities for local people to participate actively in activities of development. This means giving authority or power to the local people to mobilise their own abilities in managing local resources. This provides a supporting role of making decisions and the roles affecting their lives (Ardika, 2003). The position of the local community in managing agrotourism based on food security helps to promote an understanding of the phenomena of nature and culture. This concept is the future power to make society have a sense of responsibility in developing local tourism. The success of tourism will not only help to reach the main target, attracting foreign tourists to come, but more efforts to improve the management of the community through organization and marketing, promoting the development of business units and partnership are required. Approach Research methodology in a participatory rural appraisal emphasizes local knowledge and the capacity of society to make judgments, analyse and plan what is needed in respect of information sharing (information sharing analysis and activity between stakeholders; Syahyuti, 2006). Data collection will be from descriptive analysis, with direct observations, survey, interview, and through focus group discussion. The research area was selected in Petang Village, Badung Regency which has actual and potential agrotourism based food security. The informants of purposively sampling are BUMDes (regional owned enterprises and agrotourism), business groups, and farmer groups. Use of the data analysis interactive model from (Miles and Huberman, 2007) consists of three stages, namely data reduction, presentation of data, and the imposition of a conclusion or verification. Then strategy is made using a SWOT analysis.


Discussion The community of Petang Village has local knowledge, such as: (1) Crops tradition utilizing the land lots for horticulture which is able to meet daily needs and local food security in an economic crisis or failure of the harvest; (2) Agriculture marketing of horticulture products still depends on forward sellers who have long been established, forming solidarity so that farmers would not be betrayed by selling produce to others. The marketing communications with forward sellers has a positive impact in that the community is involved in selling, it does not have to distribute outside the village with the risk of additional spending. The potential adverse impact on crop prices determined by forward sellers is that the community is bound to forward sellers and cannot sell to other parties. Petang village is agrotourism based and is focused on horticulture, the natural environment, tourist destinations, vegetable and fruit shops, playgrounds and outward bound training camps, and for scientific research. Future work Local food security based agrotourism development potential and prospects are favorable to open jobs, increased revenue, and village community welfare. But there is the potential of competition and conflict which can degrade local wisdom due to the dominance of management agrotourism and bumdes (village-owned enterprises) which lack maximal management stewardship, tourist destinations, promotion, marketing, public services, the development of business units and financial management. Then, the people residing in locations far from their agrotourism have less access and equal opportunities to participate in agrotourism. The strategy of marketing integrated communications in the Agrotourism Petang Village is namely the open forum of dialogue or seminar participatory communication involving all parties or stakeholders including the business groups and farmers groups, the village administration, local government, educational institutions and governmental organization. The Prospect is to continue to build and provide training to the community in developing farmers capabilities through biosecurity activities so as to support increased food security in their region. References Ardika, I Wayan (ed.) 2003. Sustainable tourism culture, reflection and hope in the global development. Denpasar: course magister (s2) tourism study. Pujaastawa dkk, 2005. Tourism Alternative Integrated Model of Tourism Central Bali. Syahyuti, 2006 .30 the concept of important in rural development and agriculture Jakarta: bina am rena pariwara. Miles, Matthew B and A. Michael Huberman 2007. Qualitative Data Analysis: A Sourcebook of New Methods. Translation tjetjep rohendi rohisi Jakarta: University of Indonesia.


GREENHOUSE BIOSECURITY MEASURES FOR INDONESIAN HORTICULTURAL FARMERS Sri Ita Tarigan1, Peter Juma Ochieng2

Christian University of Wira Wacana Sumba Jl. R. Soeprapto No.35 Waingapu, Sumba, Indonesia 2 Jomo Kenyatta University of Agriculture and Technology, P.O. Box 62000-00200 Nairobi, Kenya 1

Abstract Biosecurity is an essential element for high crop yield in greenhouses. This study aims to provide effective biosecurity measures for greenhouses. The proposed approaches include: Checking all equipment for living organisms; Cleaning and washing all equipment with tap water; Drying and exposing to light all equipment and clothing to expel some species that might survive for several days in dark and damp conditions. Keywords: biosecurity, invasive species, pest and diseases

Abstrak

”Biosecurity” merupakan elemen penting untuk menghasilkan hasil panen yang tinggi di rumah kaca. Penelitian ini bertujuan untuk memberikan langkah-langkah “biosecurity” yang efektif untuk rumah kaca. Pendekatan yang dapat dilakukan meliputi; Mengecek, membersihkan, mengeringkan dan memaparkan semua peralatan yang digunakan termasuk pakaian dengan pencahayaan, air yang mengalir untuk mengusir beberapa spesies yang hidup. Keywords: biosecurity, invasif spesies, hama dan penyakit Introduction

Horticultural export and domestic consumption contribute nearly 10% of the Indonesian gross domestic product (GDP). Biosecurity implies taking action to minimize the introduction or spread of invasive non-native species and diseases. Invasive non-native species (INNS) are those that have been transported outside of their natural range and that can damage our environment, plants, the economy, human health and lifestyle. Impacts of INNS are so significant, they are considered to be one of the greatest threats to biodiversity not only in Indonesia but worldwide. INNS and diseases threaten the survival of rare native species, damage sensitive ecosystems and habitats and cost the Indonesian economy approximately 1 Rp billion annually. For example an invasive non-native leafminer (Liriomyza sp; Diptera: Agromyzidae), a common polyphage insect with many host plants, is a clear demonstration of a biosecurity threat to greenhouses in Indonesia. It has been reported that more than 50 plant species belonging to 13 families of flowering and wild plants are hosting Liriomyza sp. Lopez et al. (2010) reported that Liriomyza sp invaded horticultural crops (French-beans, cucumbers, fruits and cowpeas) in several South Sumatra regions. In the process of conducting a number of activities, unwanted invasive non-native pest species and diseases often ‘hitchhike’ on farm equipment, footwear, clothing and boats. Hence these are transferred and become established in greenhouses causing devastating eﬀects. Thus, it is essential to prevent the introduction and spread of NNIS through training of local farmers and other stakeholders in greenhouse biosecurity measures. This will aid in preventing the destruction of horticultural crops associated with invasive non-native pest and diseases allowing the control of detrimental ecological consequences and high costs for control. Approach In the proposed approach greenhouse farmers will be required to check, clean, dry and expose to light all the equipment and clothing to be used in the greenhouse before being taken to the site unless it is newly purchased. I. Checking greenhouse equipment To screen for non-native invasive species and disease, farmers will be required to check all equipment for any living organisms. Paying particular attention to areas that are damp or hard to inspect will ensure the flushing out of any foreign species before being transferred to the greenhouse. II. Cleaning greenhouse equipment Greenhouse famers are expected to clean and wash all equipment with running tap water while ensuring that all washings are contained and disposed of onto a surface (such as gravel/hard-standing/grass) where it can be dried out and is not able to enter any watercourse or drainage system near greenhouse. Any large equipment (spraying machines and tractors) should be washed using a hosepipe/power washer. The washings must be contained and disposed of on gravel, hard standing or grass. 38 International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar

III. Drying equipment and clothing Equipment and clothing used in foreign fields/farms by the greenhouse farmers needs to be dried in light to expose some species which might survive several days in damp conditions.

Discussion In this study by implementing the proposed biosecurity measures, Indonesian greenhouse farmers are anticipated to minimise the risk of introduction or spread of invasive non-native species and diseases in their greenhouses, thereby minimizing the cost of managing and controlling non-native species and disease by government extension officers. Invasive non-native species (INNS) are those that have been transported outside of their natural range (greenhouse and its environs) and may cause detrimental damage to the greenhouse crops hence impacting on environment, the economy, famers’ health and lifestyle. In the event of conducting farm activities, Indonesian farmers in the Sumba district often pass through some high risk areas and they could accidentally transfer some environmentally damaging species. These species can be transferred through drops of water and plant fragments. They can have huge detrimental implications if they ‘hitchhike’ on equipment and, when transferred into the greenhouse, they can outcompete and kill native species, damage the horticultural crops and exacerbate the risks of etiology of contagious plant, animal and human diseases. In Indonesia greenhouses are regarded as a highly monitored environment thus farmers attending such environment are often required to possess vast knowledge of biosecurity measures to protect transfer of invasive nonnative species and diseases to the greenhouses. However this is not always the case. It is in this light that the proposed study recommends Indonesian farmers and government extension officers adopt the proposed biosecurity measures including checking, cleaning, drying and exposing equipment and clothing light to minimise the risk of spread or transfer of invasive non-native species and disease into the greenhouse and its environs. This study recommends setting up two parts to the cleaning stations for staff passing through the greenhouse and its surroundings: that is, one area to clean shoes and smaller equipment, the second for larger equipment such as spraying machines and ploughing tractors. Remember it only takes one invasive non-native species or disease to start a greenhouse invasion. Future work Based on the proposal, we anticipate in future to organize biosecurity events and training for local farmers through collaboration with the international organization CFINNS, Indonesian government agencies including ministries of agriculture and education and other interested NGO stakeholders.


THE STUDY OF CHARACTERISTICS AND CULTIVATION OF KATOKKON PEPPER FROM NORTH TORAJA Reisky Megawati Tammu

Biology Education Department, Faculty of Education, Pelita Harapan University [email protected]

Abstract Indonesia is widely known as one of the world’s megabiodiverse countries but there are still many unknown and undeveloped species. We have responsibility to manage biodiversity for bringing prosperity and security to people and ecosystems. The Katokkon pepper is a red pepper variety from North Toraja which has a unique shape and spicy taste. Not much information has been reported about its characteristics and cultivation. This study aims to describe the characters and cultivation of Katokkon pepper including pests and disease management. The proposed method in this study is qualitative through observation, interview, and experiment. Keywords: Katokkon pepper, characters, cultivation

Abstrak

Indonesia dikenal sebagai salah satu negara megabiodiversitas di dunia namun masih banyak spesies yang belum dikenali dan dikembangkan. Kita bertanggung jawab untuk mengelola keanekaragaman hayati untuk membawa kemakmuran dan keamanan bagi masyarakat dan ekosistem. Cabai Katokkon adalah varietas cabe merah dari Toraja Utara yang memiliki keunikan bentuk buah dan rasa yang pedas. Tidak banyak informasi yang dilaporkan tentang karakter dan budidayanya. Penelitian ini bertujuan untuk mendeskripsikan karakter dan budidaya cabai Katokkon termasuk pengelolaan hama dan penyakit. Metode yang diusulkan dalam penelitian ini adalah kualitatif melalui observasi, wawancara, dan eksperimen. Kata kunci: cabai Katokkon, karakter, budidaya Introduction Indonesia is widely known as one of most megabiodiverse countries in the world for its richness of species including plants, animals and fungi. We must manage our biodiversity responsibly to bring prosperity and security for the people and ecosystems in our country and worldwide (Poythress, 2013). Nowdays, we still have many unidentified, undeveloped and extinct species. According to Kusuma & Hikmat (2015), Indonesia has a high diversity of plant species, but only a few of them which are used commercially have been identified in their genetic form. In Indonesia, red pepper is a beneficial vegetable crop which fills daily needs in household and industry. Red pepper imports sometimes must be carried out to fulfill the high demand from the market. In fact, we have many undeveloped local pepper varieties around Indonesia. Katokkon pepper is a locally cultivated red pepper variety from North Toraja, South Sulawesi. It has a spicy flavor and unique shape like a small paprika (Figure 1). The price is quite expensive compared to other peppers in the local market because it is commonly used as ingredients in Toraja’s diet, especially for cultural events. The Katokkon pepper is only available in the local market and there isn’t much information or research reported about its character and cultivation including disease and pest management. This study aims to describe the characteristics and cultivation of the Katokkon pepper in order to contribute to biosecurity in Indonesia. The main biosecurity aspect of this study is sustaining and developing the productivity and quality of Katokkon pepper (food security) through deeper understanding of its characteristics along with pest and disease management.

Figure 1. The shape of Katokkon pepper


Approach The method proposed to be used in this study is qualitative research extended with quantitative data analysis. There are three techniques to obtain and analyse data: (a) observation to collect photos and data about Katokkon pepper cultivation and morphological characteristics in the field; (b) interviews to gain information from the farmers about cultivation which includes the process before planting, germination, fertilizing, pests and diseases, harvest and postharvest management; (c) experiment to analyse the biochemical component in Katokkon’s fruit through High Performance Liquid Chromotography (HPLC) and genetic characteristics by kariotype. Discussion This study makes a significant contribution to the development of understanding biosecurity as one of the main issues in Indonesia. As mentioned above, we still need a lot of work to identify the characteristics and potency of Indonesia’s biodiversity. The Katokkon pepper is a beneficial agricultural crop for Toraja’s farmers because of its spicy taste and unique fruits shape. Not only the farmers, but also Toraja society always used this pepper as an ingredients in their cuisine, especially in their cultural events. One biosecurity issue is whether the crop can be grown elsewhere without creating biosecurity issues. Biosecurity is related to sustaining agriculture's natural resource base. This work is a preliminary step to sustain our local variety of red pepper in Indonesia. As we try to sustain the local variety, we first need to know in depth more about its characteristics and potential. Today, there isn’t much information about Katokkon pepper reported in journals or theses. One publication related to Katokkon pepper is about isolation of endofit fungi which produces antimicrobial compounds from Katokkon fruit for medical use (Rante et al., 2013). Tammu et al. (2016) also reported about the phenotypic and genotypic characters of Katokkon pepper which are induced by colchicine for polyploidy as plant breeding technique. Therefore, we need to know deeper about Katokkon pepper and develop it responsibly. The next step is to improve its quality and productivity with a good understanding of cultivation including management of pests, diseases, and post-harvest products. By doing this work we have already supported our local farmers, society, consumers and the government of Indonesia in economic and other biodiversity related aspects. Future work In order to reach the goal of this study, we need to work together with multidisciplinary parties. Collaboration with many researchers, especially in botany, will give the best result in identifying the characters of Katokkon pepper. We can explore many aspects of this pepper, e.g. morphological, genetics, biochemistry, etc. International collaboration also necessary for information exchange in biology, facilities for research, recent technology in farming for biosecurity, scholarship and training which relate to this work. References Kusuma, C., & Hikmat, A. (2015). Keanekaragaman hayati flora di Indonesia. Jurnal Pengelolaan Sumberdaya Alam dan Lingkungan, 5 (2):187-198. DOI: 10.19081/jpsl.5.2.187 Poythrees, V.S. (2013). Menebus sains: Pendekatan yang berpusat kepada Allah. Surabaya: Momentum. Rante, H., Taebe, B. & Seondaria, I. (2013). Isolasi fungi endofit penghasil senyawa antimikroba dari buah cabai katokkon (Capsicum annuum L. var. chinensis) dan profil klt-bioautografi. Majalah Farmasi dan Farmakologi, 17 (2): 39 – 46. Tammu, R. M., Daryono, B.S. & Nuringtyas, T.R. (2016). Karakter fenotip dan genotip cabai Katokkon (Capsicum annuum L.) hasil poliploidisasi dengan kolkhisin. Thesis. Fakultas Biologi. Yogyakarta: Universitas Gadjah Mada.


THE ROLE OF ENDOPHYTIC FUNGI Verticillium lecanii AND Nigrospora oryzae AS BIOLOGICAL CONTROL AGAINST BLAST DISEASES ON RICE CROP Ni Luh Putu Emayanti Graduate Study Program of Biology, State University of Malang Jalan Semarang, No.5, Sumbersari, Lowokwaru District, Malang City, East Java Corresponding author: [email protected]

Abstract There are more rice paddies in Asian countries than anywhere else because the entire population uses rice as a staple food. Some diseases in rice plants have resulted in a decrease in rice yields in Southeast Asia of between 30-50% and resulted in large losses. This study will be conducted to control Homoptera and Hemiptera that cause blast disease in rice plants by endophytic fungi Verticillium lecanii and Nigrospora oryzae. The method used is the inoculation of endophytic fungi on PDA medium and then applied to the suspension. Use of endophytic antagonists as an alternative to controls capable of controlling the progression of the disease in an effective, efficient and environmentally friendly way. Keywords: blast disease, blast disease, friendly environment, paddy plant.

Abstrak

Tanaman padi yang terluas terdapat di negara-negara Asia karena seluruh penduduknya menjadikan beras sebagai makanan pokok. Beberapa penyakit pada tanaman padi mengakibatkan penurunan hasil panen padi di Asia Tenggara mencapai 30-50% dan mengakibatkan kerugian yang besar. Penelitian ini bertujuan untuk mengendalikan Homoptera dan Hemiptera yang mengakibatkan penyakit blas pada tanaman padi dengan menggunakan jamur endofit Verticillium lecanii dan Nigrospora oryzae. Metode yang digunakan adalah inokulasi jamur endofit pada medium PDA kemudian diaplikasikan ke dalam suspensi. Penggunaan endofitik antagonis sebagai alternatif pengendalian yang mampu mengendalikan perkembangan penyakit secara efektif, efisien dan ramah lingkungan. Kata kunci: jamur endofit, penyakit blas, ramah lingkungan, tanaman padi.

Introduction There are more rice paddies in Asian countries than anywhere else in the world. Production of rice in the world ranks third, after corn and wheat. The entire population has rice as its staple food. Some of the diseases that attack paddy crops include blast disease, brown spots on the leaves, root knot and rot at the base of the stem. This disease has reduced rice yields in Southeast Asia by 30-50% and resulted in large losses. In Indonesia, disease on rice plants reached an area of 1,285 million ha or 12% of the total area of rice crops in Indonesia (Balai Besar Penelitian Tanaman Padi, 2010). As an environmentally friendly agent, endophytic fungi is the ideal candidate to become a biological control agent. Indonesia has a tropical climate which is suitable for a number of species of living fungi including endophytic fungi contained in the plant tissue. Research Methods Tools and materials The tools used are the autoclave, Petri dish, Erlenmeyer flask (Pyrex), beaker (Pyrex), Incubator (Yenaco), a loopful, spray place, haemocytometer, LAF (laminar airflow), oven (Yenaco), tray measuring 30 cm x 21 cm x 5 cm, Tweezers, knife, micropipette 100, Centrifuge, and reaction tube (Pyrex). The materials used are rice seeds, Potato Dextrose Agar (PDA), water, four endophytic have been formulated, and soil contains NPK, filter paper, sugar, transparent plastic, spirits, distilled water. Propagation Verticillium lecanii Rice seed put in a plastic bag and then sterilized by autoclave. Furthermore, the fungi Verticillium lecanii isolate were inoculated on the medium. Colonies of fungi will grow at two weeks after inoculation. Cultured fungi are then diluted with water and then filtered with gauze pads. Conidia suspension of fungi was calculated using haemocytometer of fungi culture lifespan of two weeks after inoculation in 5 liters of water. Furthermore, the fungi is ready to apply. Propagation of Nigrospora oryzae Weight of 10 g paddy seeds soaked for 24 hours. The seeds were drowned and then put into a petri dish and sprinkled with four endophytes, which is derived from rice plants that have been formulated. Seeds were sown and germinated in trays measuring 30 cm x 21 cm x 5 cm of soil that had been given basic NPK fertilizer as much as 2g. Seed of paddy that has been aged 21 days after sowing can be used for experiment. 42 International Master Class in Plant Biosecurity | 14–26 January 2018, Denpasar

Preparation of Verticillium lecanii and Nigrospora oryzae • Take cultured Verticillium lecanii and Nigrospora oryzae fungi (1kg) mixed with water as much as one liter. • Squeeze and stir the suspension until the conidia is released all then filtered. • Add as much as 15-30 liters of clean water. • Add 10 tablespoons sugar. • Add adhesive and stir until blended. • Enter the solution into the syringe. • Ready for application as bio-insecticide Implementation of spraying Implementation of the spraying is done by spraying a solution of the Verticillium lecanii and Nigrospora oryzae fungi on target pests or leaves that are still muddy. Doses of spraying are 50-70 liters / ha. Application times should be after 15:00 in the afternoon. Discussion Endophytic fungi are known to increase the resistance of plants through its host plant defense induction. In general, endophytic fungi produce secondary metabolites, compounds that influence a variety of pests and diseases (Schulz et al., 2002). The effectiveness of endophytic fungi are also influenced by the time of application. Time to consider applications for endophytic fungi are very vulnerable to sunlight, especially ultraviolet light (Cloyd, 2003). When exposed to sunlight within 4 hours, the Verticillium lecanii fungi will lose viability by 16% and when exposed to sunlight 8 hours, viability was reduced by over 50%. Future work This study is very important to save the farmers from crop failure and increase the productivity of rice crop yields. It is expected that all parties can help and support this research; if successful it is not only farmers in Indonesia who can be assisted, but farmers around the world. The role of endophytic fungi as biological control can answer the challenges of the future. To support the success of this study, the researchers also plan to create a factsheet to farmers in order to facilitate understanding of biological controls using endophytic fungi Verticillium lecanii and Nigrospora oryzae. References Cloyd, R. 2003. The entomopathogen Verticillium lecanii. Midwest Biological Control News. University of Illinois. Schulz B, Boyle C, Draeger S, Römmert AK, Krohn K. 2002. Endophytic fungi: a source of novel biologically active secondary metabolites. Mycological Research 106:996-1004. doi: http:// dx.doi.org/10.1017/S0953756202006342.


TOWARDS FOOD SOVEREIGNTY: INCREASING FOOD PRODUCTION THROUGH COMMUNITY-BASED PESTS AND DISEASES CONTROL SYSTEM Widhi Handayani

Graduate Faculty for Interdisciplinary Studies, Universitas Kristen Satya Wacana Jl. Diponegoro 52-60 Salatiga 50711, Central Java-Indonesia [email protected]

Abstract The Government of Indonesia is committed to achieving food sovereignty in order to meet the food needs of the growing population. Controlling pests and diseases according to sustainable agriculture principles is required to increase crop production in order to ensure adequate food provision. This study is proposed to explore issues faced by farmers in controlling pests and diseases, to explain the role of local wisdom in pest and disease control, and to develop communitybased pest and disease control models. It will be conducted in Central Java by the combination of qualitative and quantitative approaches, and is expected to provide a contribution to policy makers primarily related to improving agricultural productivity in order to achieve food sovereignty. Keywords: Food sovereignty, sustainable agriculture, pests and diseases, local knowledge

Abstrak

Pemerintah Indonesia berkomitmen mencapai kedaulatan pangan untuk memenuhi kebutuhan pangan penduduk Indonesia yang semakin bertambah. Pengendalian hama dan penyakit sesuai prinsip pertanian berkelanjutan diperlukan untuk meningkatkan produksi pertanian guna menjamin kecukupan pangan. Studi ini dilakukan mengeksplorasi persoalan-persoalan yang dihadapi petani dalam mengendalikan hama dan penyakit, menjelaskan peran kearifan lokal dalam pengendalian hama dan penyakit, dan mengembangkan model pengendalian hama dan penyakit berbasis masyarakat. Studi ini akan dilaksanakan di Jawa Tengah dengan pendekatan kuantitatif dan kualitatif. Hasil studi diharapkan memberikan kontribusi bagi penentu kebijakan terutama berkaitan dengan peningkatan produktivitas pertanian dalam rangka mencapai kedaulatan pangan. Kata kunci: Kedaulatan pangan, pertanian berkelanjutan, hama & penyakit, kearifan lokal

Introduction Indonesia is an archipelago that consists of 34 provinces spread across about 17,000 islands. Indonesia’s 265 million population in 2015 is estimated to increase to 295 million in 2030. This indicates a requirement for adequate food provision for all the people. Agriculture being an important basis to this concern, and sustainable agriculture is promoted by the Indonesia’s government to achieve food sovereignty (Priyono, 2016). There are ten principles of a sustainable agricultural model, namely (1) increase crop productivity; (2) conservation of soil and water; (3) zero waste; (4) conservation of biological diversity; (5) control of pesticide residues and heavy metals; (6) utilize local natural resource; (7) adaptive to climate change; (8) integration between crop and livestock; (9) low heavy metal pollutants; and (10) low greenhouse gas emissions (Setyanto, 2015). The principles indicate that a farming system which excludes the use of chemical pesticides to control pests and weeds is encouraged, with a purpose to reduce crop losses. Core to this purpose is the knowledge of farmers in controlling pests and diseases that attack planted crops. Hence, this research aims to explore issues faced by farmers in controlling pests and diseases, to explain the role of local wisdom in controlling pests and diseases, and to develop a model of communitybased pest and disease control. Approach Java is a very important island for Indonesia’s farming production since it is highly fertile and suitable land for crop production (Syuaib, 2016). The Java island is divided into three provinces, West Java, Central Java, and East Java, and two autonomous regions of Yogyakarta and Jakarta. Among those provinces, Central Java faces severe problems regarding paddy production. Wright et al (2017) reported that during late June to early July 2017, humid field conditions during the dry season accompanied by limited crop rotations have resulted in the growth and spread of brown hoppers throughout Java and southern Sumatra (Wright et al. 2017).


The lowest percentage of the total affected area compared to planted area was found in East Java with values of 2.06% in 2016 and 3.36% in 2017. While the most severe pest and diseases attack seem to occur in Central Java, as indicated by the highest percentage of percentage of total affected area to planted area, with a value of 4.09% and 5.28% respectively (Wright et al. 2017). Based on this situation, the study will be focused in Central Java province. The study consists of both qualitative and quantitative methods. More detailed information on the study will be described below. 1. Quantitative research The quantitative research will conduct surveillance of pests by using survey methods followed by direct observation and sampling. The survey will be conducted of 98 of 130 farmer groups in Central Java, and 30 people per farmer groups will be the informants who will share the kind of pests and diseases and how to control the pests. The farmers can also take part to collect the samples of pests, which will be identified. The results will be analyzed descriptively, and the output of this research will be used for the next activities. 2. Qualitative research The qualitative research will be conducted using Focus Group Discussion and case study to explore the local knowledge (if any) of communities in controlling pests and diseases and problems faced by the farmers in controlling pests and diseases. Therefore, during the survey, researchers will need to explore special cases in order to do the case study research. The results will be analyzed qualitatively to develop a model on community-based pests and diseases management. Discussion and Future work This research is designed in the frame of policy of Indonesia’s Government which committed to integrate the Sustainable Development Goals (SDGs) into the development plan in 2016. Two of 17 Sustainable Development Goals (SDG) that will be of concern are poverty alleviation and hunger eradication (Yusuf, 2016). The policy direction of Indonesia’s Ministry of Agriculture in relation to SDG 2 is focused on achieving food sovereignty, while policy on increasing farmer’s welfare is formulated in order to alleviate poverty as indicated by SDG 1 (Priyono, 2016). Food provision is critical if hunger eradication will be achieved. Therefore, agriculture, in particular sustainable agriculture, is an important basis to this concern. A shift to sustainable agriculture will require knowledge regarding the concept, and practices. Collaboration with foreign experts in relevant fields is important in order to share knowledge and relevant practices to the farmers. Moreover, local knowledge in agricultural practices, mainly on pest control, should be explored as they will give benefit to develop the suitable model. Finally, the proposed model could bring contributions to the stakeholders in relation to policy. References Priyono, H. 2016. Agriculture’s Role in Achieving Sustainable Development Goals. Paper presented in policy analysis workshop “Transition toward Sustainable Development in the context of the 2030-Agenda for Sustainable Development, Strategic Implementation, Follow Up, and Review”. Center for Alleviation of Poverty through Sustainable Agriculture (CAPSA). Bogor, 15th November 2016. Setyanto, P. 2015. Indonesian Environmental Challenges toward Sustainable Agriculture. Paper presented in MARCO Symposium “Next Challenges in Agro-environmental Research in Monsoon Asia”. Tsukuba, 26th-28th August 2015. Syuaib, M.F. 2016. Sustainable Agriculture in Indonesia: Fact and Challenges to Keep Growing in Harmony with Environment. Agric. Eng. Int. 18(2): 170-184. Wright, T., Sugiarti, Meylina. 2017. Global Agricultural Information Network (GAIN) Report: Indonesia Grain and Feed Update July 2017. USDA Foreign Agricultural Service. Jakarta.


ANALYSIS OF HOUSEHOLD FOOD CONSUMPTION PATTERNS ON INDIGENOUS PEOPLE OF BAYAN VILLAGE Baiq Santi Rengganis

Agribusiness Department, Faculty of Agriculture Islamic University of Al-Azhar Mataram, Jln. Unizar No.20 Turida, Mataram [email protected]

Abstract

The purpose of this study is to analyze the pattern of food consumption and eating habits of Indigenous peoples and their influence in the fulfillment of individual nutritional needs. One variable of eating habits is the frequency of household meals which has a significant effect on the adequacy of household nutritional intake; food security indicates that households can meet food needs based on food availability. Other household socioeconomic aspects include the number of households, per capita income, and the availability of rice in the rice barn, the socio-cultural aspects of food covering the way of storing the food and eating habits that affect the individual nutritional intake. Keywords: Food consumption patterns, Food Security, Culture

Abstrak

Penelitian ini bertajuk “Analisis Pola Konsumsi Pangan Rumah Tangga Pada Masyarakat Adat Desa Bayan”, yang bertujuan untuk menganalisis pola konsumsi pangan dan kebiasaan makan masyarakat adat serta pengaruhnya dalam pemenuhan kebutuhan gizi individu. Salah satu variabel kebiasaan makan yaitu frekuensi makan rumah tangga berpengaruh signifikan terhadap kecukupan asupan gizi rumah tangga, ketahanan pangan mengindikasikan bahwa rumah tangga dapat memenuhi kebutuhan pangan berdasarkan ketersediaan pangan. Aspek sosial ekonomi rumah tangga lainnya meliputi jumlah keluarga, pendapatan perkapita, dan jumlah ketersediaan padi di dalam lumbung padi, aspek sosio budaya pangan meliputi cara menyimpan makanan masyarakat dan kebiasaan makan yang berpengaruh terhadap asupan gizi individu. Kata Kunci: Pola Konsumsi, Ketahanan Pangan, Masyarakat Adat Introduction The pattern of public consumption is basically influenced by socio-cultural factors, lifestyle, and demography of a region. Community food consumption patterns are also significantly related to conditions of insecurity or security. Related to this, the calculation of food consumption patterns is one method that can be used to determine the adequacy of food and nutrition for a community. Assessment of food intake and nutrition for the community can be seen from the pattern of food consumption in a qualitative way that can reflect whether the community consumes adequate food and nutrition or not. Coverage of food security is food availability which includes production, reserves and income, distribution or accessibility includes physical (accessible) and economy (affordable purchasing power); and consumption includes the quality and safety and nutritional adequacy of individuals. Food sufficiency for the community is very important. To consider the intake of food and nutrition we can measure the extent of community welfare. The availability of food in households used in measurement refers to sufficient food and is available in quantities that can meet the needs of household consumption. The traditional village of Bayan is one of the traditional village communities in West Nusa Tenggara that still maintains cultural heritage and traditional farming systems. Interestingly, the Indigenous villagers of Bayan have a unique way of storing food, have unique eating habits and consumption patterns that are capable of fulfilling the needs and food sufficiency. Approach The problem is approached using a survey method and cross sectional study design. The population in this study is all households in Bayan village. The aspect of food consumption and nutrient fulfillment is determined based on consumption intake data from recalling consumption for the previous 2 x 24 hours. The socioeconomic aspect was analyzed by using linear regression to known variables that influence household food security. The nutritional intake value was calculated using dietary energy density (DED) comparing the amount of energy intake with total food weight (kcal / g / day).


Discussion After doing this research, we will know the consumption patterns of Indigenous villages of Bayan, including the frequency of eating per day and household food consumption. It is known that the Indigenous people of Bayan village have a unique way to meet their consumption needs, to keep food security without eliminated their local wisdom, so it is interesting to be studied more deeply. One of the socio-cultural aspects of food that is still believed and practised by the Indigenous villagers of Bayan is to store rice and also some other food needs for a period of one year. The frequency of eating is also not the normal pattern but able to meet the needs of individual foods. Basically, food security begins with how a person meets his/her food needs. One of the things that must be taken into account in food security is the consumption of individual meals. The fulfillment of household food consumption is also influenced by several factors such as the number of family members, per capita income, adequate food availability, and access to food. Future work There will be no food security without biosecurity. The quality of one's life comes from the intake of daily food consumed. The availability of staple food in an area, especially in the customary area is generally fulfilled from the amount of stored rice. The availability of food indicates the condition of food security. The ideal frequency of eating in different communities and societies should be offset by more diverse local food consumption and contain enough nutrients so the quality and quantity of the community's food can be better. This prompted the government to continue to promote the diversity of food for the creation of food sufficiency for the community, especially rural communities. Better understanding of other types of food with better nutrient intake is needed, to provide this understanding. It is necessary to establish a central communications center for food communications (Food Communications Learning Centre) in order to facilitate communication between villagers and stakeholders (NGOs, Government and Academics).


SPATIAL DISTRIBUTION OF SAGO (Metroxylon Spp.) USING VEGETATION INDICES: A CASE STUDY of LUWU RAYA, SOUTH SULAWESI PROVINCE Afandi Ahmad1 2

Faculty of Forestry, Andi Djemma University Center for Social Ecology and Biodiversity Andi Djemma University Kampus Agrokompleks, Jl. Anggrek Blok CC, Palopo City [email protected]

1 2

Abstract Sago distribution is throughout Luwu including the East Luwu Regency and has potential to be utilized as local food. However, there is no specific data regarding the spatial distribution and potential area of sago plants. Remote sensing and geographic information systems (GIS) technology have advantages in the analysis of distribution, location and area of stands or a specific area. This study aims to analyze the distribution of sago at Luwu Raya Regency by using remote sensing technology especially vegetation indices. This study will use survey and quantitative approaches focusing on the spatial analysis method. Spatial analysis uses red and NIR bands of Landsat 8 imagery to create NDVI (Normalized Difference Vegetation Index) imagery and Google Earth™ data for validation. Classification of NDVI imagery can be used to determine the distribution area of sago plantations. Results of this study will present data and information regarding distribution, amount of area and potential of sagu plantations at Luwu Raya Regency. Keywords: Sago, Landsat 8, spatial analyze, NDVI

Abstrak Tanaman sagu tersebar dari Kabupaten Luwu hingga Luwu Timur dan tanaman ini sangat berpotensi untuk dikembangkan sebagai panganan lokal. Namun, belum ada data spesifik terkait sebaran spasial dan luas potensi tanaman sagu. Teknologi penginderaan jauh dan sistem informasi geografi (SIG) memiliki keunggulan dalam analisis sebaran, lokasi dan luas tegakan atau suatu area tertentu. Penelitian ini bertujuan menganalisis sebaran tanaman sagu di Luwu Raya menggunakan teknologi penginderaan jauh dan SIG. Metode yang digunakan adalah survey dan pendekatan kuantitatif khusunya metode analisis spasial. Analisis spasial menggunakan band merah dan inframerah dekat untuk membuat citra NDVI (normalized difference vegetation index) dan data Google Earth™ untuk validasi. Klasifikasi citra NDVI dapat digunakan untuk mengetahui sebaran tanaman sagu melalui klasifikasi nilai piksel citra. Hasil penelitian ini diharapkan memberikan informasi yang tepat mengenai sebaran spasial potensi tanaman sagu. Kata Kunci: Sagu, Landsat 8, analisis spasial, NDVI Introduction Food security has become a very important issue and a serious concern for the world. Indonesia is no exception. One of the strategies in dealing with these problems is through food diversification programs utilizing alternative food sources. Indonesia is a hot spot of global biodiversity and has a variety of food alternatives, for example sago, tubers, nuts and corn (Rauf and Lestari, 2009). One of the potential raw materials for a food diversity program is the sago plant. The potential of sago in Indonesia is very high and sago has many benefits for local people. Luwu Raya is an area in South Sulawesi Province that has a large area of sago. Some local dishes made from sago are kapurung, dange, bagea and sinole. Other parts of the sago palm are also utilized by people. For example, the leaf is the material for traditional roofs. The stems of sago are usually used for fences or floors. Sago has great potential to be improved and become an alternative food. Unfortunately, the potential of the sago area is not fully known because there is no information about its distribution nor the amount of area of sago plantations. Based on the above facts, there is an urgent need to know the spatial distribution and species diversity of sago. A spatial analysis technique could contribute the necessary information about the distribution and area of sago at Luwu Raya. Remote sensing imagery is widely used for spatial analysis or species distribution. Goeslana (2010) used remote sensing and GIS technique to analyze distribution of sago at Seram Island, Maluku. One approach usually used for spatial analysis is vegetation indices. Several vegetation indices methods are simple ratio vegetation index (SRVI), enhanced vegetation index (EVI) and normalized difference vegetation index (NDVI). However, NDVI is the most used method of spatial analysis. NDVI is derived from dividing the difference between near infra red (NIR) and Red bands.


Approach This study will use survey and quantitative approaches. The first step is a field survey of sago plantations to get coordinate points of several sago areas. After that, coordinate data will be used to recognize areas of sago from satellite imagery. Image Processing This study will use Landsat 8 imagery as primary data. Landsat 8 imagery has 11 bands consist of 4 visual band spectrum, 3 infra red bands, 2 thermal bands and 1 band for cloud detection (cirrus) and panchromatic respectively (Table 1). Table 1. Landsat 8 OLI bands Band description Band 1 - blue Band 2 - blue Band 3 - green Band 4 - red Band 5 - near infrared Band 6 - shortwave infrared Band 7 - shortwave infrared Band 7 - shortwave infrared Band 8 - panchromatic (15 m) Band 9 - cirrus Band 10 - thermal Infrared (100 m) Band 11 - thermal Infrared (100 m) Source: (Roy et al., 2014)

Wavelength (µm) 0.43-0.45 0.45-0.51 0.53-0.59 0.64–0.67 0.85–0.88 1.57–1.65 2.11–2.29 2.09–2.35 0.50–0.68 1.36–1.38 10.60–11.19 11.50–12.51

From those data, two bands of Landsat imagery will be used to make an NDVI image. Normalized difference vegetation index (NDVI) is an algorithm commonly used in remote sensing techniques that identifies vegetation and measures a plant’s overall health. NDVI equations are below:

NDVI =

(NIR ) − (RED ) (NIR ) + (RED )

According to this equation, two bands near infrared (NIR) and red band (RED) are needed as the input of the algorithm. After NDVI imagery is completed, the next step is to classify the NDVI value of sago plantation. Discussion A former study mentioned that range of NDVI value of sago at Seram Island is -0.25 to 0.25 (Goeslana, 2012). It means that we could develop a model to predict the distribution of sago as well as suitable areas for sago cultivation. Spatial modeling can also be used for monitoring sago changes due to harvesting or land conversion. The use of this model is expected to assist in the monitoring and assessment of habitat quality sago. Sago has the potential to become an alternative food as one way to overcome food security problems. This research addresses two aspects related to food security. First, to know the potential of sago plants and their distribution in Luwu Raya. As well, it can also help understand the potential areas suitable for sago cultivation. Secondly, this study provides input related to food commodity monitoring techniques using remote sensing technology and GIS.


Future Work This research is the first step for further research in establishing monitoring methods of sago plant area. Further research can be done to assess the health of sago plants, the distribution of pests and diseases, as well as habitat suitability studies for planning for sago cultivation. Certainly, further research to build an integrated monitoring system cannot be done only with one scientific point of view. Collaborative research with other fields of science such as social, economics, management, pests and diseases and technology is needed so that the solution to the problem of food security and biosecurity in Indonesia can be realized. References Goeslana, S. (2012). Pemodelan Spasial Kesesuaian Habitat Sagu (Metroxylon Spp.) di Pulau Seram, Maluku. Institut Pertanian Bogor, Bogor. Rauf, A. W., & Lestari, M. S. (2009). Pemanfaatan Komoditas Pangan Lokal Sebagai Sumber Pangan Alternatif di Papua. Jurnal Litbang Pertanian, 28(2), 54–62. Roy, D. P., Wulder, M. A., Loveland, T. R., C.E, W., Allen, R. G., Anderson, M. C., Zhu, Z. (2014). Landsat-8: Science and product vision for terrestrial global change research. Remote Sensing of Environment, 145, 154–172. https://doi.org/10.1016/j.rse.2014.02.001


SECURING THE RIGHT TO ACCESS BIODIVERSITY FOR PROTECTING BIOSECURITY Wahyu Yun Santoso

Department of Environmental Law, Faculty of Law, Universitas Gadjah Mada, Jl. Sosio Yustisia No. 1 Yogyakarta, Indonesia [email protected]

Abstract

Conflict between environmental needs and human rights happens all the time. So while some people may defend their right to reduce the biodiversity of their environment by referring to their right to feed themselves, others defend their right to retain their diverse environment on the same grounds. Thus, right to access biodiversity is a major portion of biosecurity itself, and vice versa. As biodiversity depends on the community that live in its surroundings, so the sustainable protection and preservation of biodiversity and its livelihood is significant for securing biosecurity in Indonesia. Keywords: biosecurity, environmental rights, Indigenous people, conservation

Abstrak

Konflik antara lingkungan dan hak asasi manusia terjadi setiap saat, seperti misalnya saat pembukaan hutan untuk perluasan lahan tanam yang bersinggungan dengan kepentingan konservasi keanekaragaman hayati dalam hutan tersebut. Keanekaragaman hayati memiliki sifat saling ketergantungan dengan komunitas masyarakat yang hidup di sekitarnya. Demikian, pengakuan dan perlindungan berkelanjutan terhadap hak akses masyarakat atas keanekaragaman hayati signifikan untuk mewujudkan ketahanan hayati di Indonesia. Kata kunci: ketahanan hayati, hak akses, keanekaragaman hayati, konservasi Introduction Threats to biodiversity are imminent nowadays, while humans are the guardians of it. It is urgent to address this threat to biodiversity. Biodiversity protection and conservation is significant in maintaining biosecurity. Indonesia's biodiversity potential is followed by threats to the extinction or degradation of biodiversity itself. The potential of terrestrial biodiversity through the value of forest wood products reaches USD 6.5 billion, wildlife value of USD 1.57 billion, and seaweed for USD 16 million. But in reality the richness of biodiversity is under threat of scarcity resulting from over exploitation, illegal logging, land conversion, poaching and illegal trade. This fact shows that weak regulatory and biodiversity governance systems tend to stimulate unsustainable use of biological resources. Unclear responsibilities and overlapping authorities among government agencies and responsibilities are often inconsistent with their capacity to be one of the proponents of biodiversity conservation governance. Therefore, good governance must contain at least three key components, namely participation, transparency and accountability. Meanwhile, objectives aimed at maintaining biodiversity according to the Convention on Biological Diversity (CBD) regime include: conservation of biodiversity; sustainable use of the components of biodiversity; as well as fair and equitable sharing of the benefits arising out of the utilization of genetic resources. The CBD has set out principles and obligations of Parties related to access to genetic resources and the fair and equitable sharing of benefits arising out of the utilization of genetic resources, on the basis of prior informed consent and mutually agreed terms. Consequently, the fulfilment and protection of the right of Indigenous and local communities to access the biodiversity is urgent as the emerging of bio-prospecting might cause imminent risks to the biodiversity itself. As biodiversity depends on the community that live in its surrounding, thus the sustainable protection and preservation of the livelihood of Indigenous and local communities is also significant for securing biosecurity in Indonesia.


Approach The research is a normative study with a qualitative approach. The method used will be based on literature study, and using a socio-legal approach in its analysis which will be enriched by case studies. Several cases will be chosen among cases of biodiversity conflict in National Park as a protected conservation area, mostly on the limited access of local communities to the biodiversity once it is regulated as protected area. Most of the conservation areas in Indonesia have been experiencing strong pressure from the damage that makes the conservation area an example of biodiversity degradation, in the name of bio-prospecting or development. Genetic resources, whether from plant, animal or micro-organisms, are used for a variety of purposes ranging from basic research to the development of products. As the genetic resources are related to traditional knowledge that comes from Indigenous and local communities, it is necessary to focus the analysis of the study on the fulfilment of the right to access of biodiversity for Indigenous and local communities. The classical problem of natural resources’ conflict existed between fulfilment of access rights for local communities and enactment of protected conservation areas by government. Accordingly, the scope of the study will be the enactment of the CBD Regime as the legal framework of conservation. The study will analyze the legal concept and implementation of biodiversity protection under CBD at the national level, which will be elaborated with the recognition of the Indigenous and local community rights based on Indonesia’s Constitution post 2002 amendment. The main expected finding is to develop a legal certainty that fulfilment and protection of fair rights to access biodiversity is a major portion of biosecurity, and vice versa. Discussion The Government of Indonesia recognizes 1,128 ethnic groups. The Ministry of Social Affairs identifies some communities as “komunitas adat terpencil” (geographically isolated Indigenous communities). However, there are many more groups, beyond those identified by the Ministry; AMAN (Indonesia Alliance of Adat Communities) has estimated that the population of Indigenous peoples in Indonesia is between 50 and 70 million. With the decentralized environmental management regime along with the initiation of Regional Autonomy Act and Environmental Protection and Management Act, the protection of Indigenous communities and their biodiversity is dealing with challenges as well as opportunities for its effective protection. Discussing protection of biodiversity from the Indigenous people’s perspective, along with the regulatory framework, will be significant to learning about the comprehensive aspects of biosecurity. In 2010 the CBD regime was advanced with initiation of The Nagoya Protocol on Access and Benefit-Sharing. Its objective is the fair and equitable sharing of benefits arising from the utilization of genetic resources, thereby contributing to the conservation and sustainable use of biodiversity and implementing the three objectives of the CBD mentioned above. The challenge for biodiversity rich countries like Indonesia is to maintain its biosecurity as well as to provide fair access to other countries in resourcing the benefits of biodiversity. Future work The sustainability of biodiversity is rooted in pure cultural systems that have been adopted by various Indigenous communities that inhabit forests in Indonesia, for example the Kasepuhan community in Mount Halimun, West Java and Kampung Naga Community in Garut. They consider the forest as a part of their lives that needs to be preserved and are wise in its management. As every province in Indonesia has its own local community with its own characteristics, the capacity for strengthening of related stakeholders is needed to achieving the preservation of biosecurity based on the management of biodiversity. Mutual collaboration with local stakeholders (universities, societies, and NGOs) as well as with international expertise both from academics or NGOs, can also be woven in for the same purpose.


References Lecthumanan, Raman, 2010, Environmental Issues and Challenges towards Sustainable Conservation in ASEAN, presentation on the Overview of The Blueprint for ASCC 2009-2015, Jakarta: ASEAN Secretariat. Makagon, Jael, Jonas, Harry, and Roe, Dilys, 2014, Human Rights Standard for Conservation, Discussion Paper July 2014. IIED-Natural Justice. Picolotti, Romina, and Taillant, Jorge Daniel (eds). 2003, Linking Human Rights and the Environment, Arizona: UA Press. Turner, Will R., Brandon, Katrina, Brooks, Thomas M., Gascon, Claude, Gibbs, Holly K., Lawrence, Keith S., Mittermeier, Russell A., and Selig, Elizabeth R. 2012, Global Biodiversity Conservation and the Alleviation of Poverty. BioScience, Vol. 62, No. 1 (January 2012) UK: Oxford University Press. United Nations Environment Programme, 2011. Strategic Plan for Biodiversity 2011–2020 and the Aichi Targets: Living in Harmony with Nature. Montreal: UN Convention on Biological Diversity. Widjaja, Elizabeth A., Rahayuningsih, Yayuk., Rahajoe, Joeni Setijo., Ubaidillah, Rosichon., Maryanto, Ibnu.. Walujo, Eko Baroto., and Semiadi, Gono. 2014, Status Kekinian Keanekaragaman Hayati Indonesia: 1st Edition, Jakarta: LIPI Press.


THE IMPORTANCE OF FAMILY POULTRY TO SUPPORT FOOD SECURITY AMONG INDIGENOUS AMMATOA KAJANG PEOPLE IN SOUTH SULAWESI, INDONESIA Nurbaya

Nutrition Department, Poltekkes Kemenkes Mamuju, West Sulawesi, Indonesia [email protected]

Abstract

The World Bank stated that Indigenous peoples are the most vulnerable to food insecurity in the world. A mixed methods design was applied to explore food security status among households of Ammatoa Kajang people in South Sulawesi. A structured household survey captured their food security status, food access, and children’s dietary diversity. A total of 142 households were surveyed. Food insecurity was highly prevalent (73.9%). Children’s diet demonstrated a lack of diversity. They experienced limited availability and access to diverse nutritious food. They cultivated family poultry in their home yard to cope with the food insecurity situation. Mostly they utilize it for family consumption. Family poultry was important to support food availability at home. Keywords: food security, food access, dietary diversity

Abstrak

Bank Dunia menyatakan bahwa masyarakat adat adalah kelompok yang paling rentan terhadap kerawanan pangan di dunia. Pendekatan mixed method diterapkan untuk mengeksplorasi status ketahanan pangan pada masyarakat adat Ammatoa Kajang di Sulawesi Selatan. Survei terstruktur pada rumah tangga untuk mendapatkan status ketahanan pangan, akses dan keragaman pangan pada anak-anak. Sebanyak 142 rumah tangga telah disurvei. Prevalensi kerawanan pangan sangat tinggi (73,9%). Pola makan anak kurang beragam. Mereka mengalami keterbatasan pada ketersediaan dan akses terhadap berbagai pangan bergizi. Mereka memelihara unggas di pekarangan rumah mereka untuk mengatasi situasi rawan pangan. Sebagian besar dimanfaatkan untuk memenuhi konsumsi keluarga. Pemeliharaan unggas sangat penting untuk mendukung ketersediaan pangan di rumah. Kata kunci: ketahanan pangan, akses makanan, keragaman makanan

Introduction Food security is defined as the physical, social and economic ability to access sufficient, nutritious food to meet people’s dietary needs and food preferences for an active and healthy life.1 The definition of food security also emphasizes that it includes nutrition security that refers to the access of food which could ensure the adequate macro and micronutrient intake.2 Food security has four key variables i.e. food availability (consistent, adequate quantity of food); food accessibility (both physical and economic access to food); food utilization (appropriate use-based knowledge regarding nutrition, water, and sanitation); and stability along these preceding three dimensions over time. Alternatively, food insecurity is defined when the availability of nutritionally adequate and safe foods, or the ability to acquire such foods in socially acceptable ways, is limited or uncertain. Food insecurity could have a tremendous impact on physical and mental health status. Food security and public health will be difficult to achieve and to sustain if the population at risk is undernourished and at risk of starvation. Indonesia has many Indigenous peoples, also known as Masyarakat Adat or Masyarakat Hukum Adat. Globally, the World Bank stated that Indigenous peoples are the most marginalized3 and most vulnerable to food insecurity. It is a complex condition especially those who live in the remote area and isolated communities. They experience a disproportionate burden of food insecurity. Therefore, studying Indigenous people is important. Approach The Ammatoa Kajang is one of the oldest Indigenous communities in South Sulawesi that still exist today. They live scattered within the customary forest known as Kawasan Ammatoa Kajang in Tana Toa Village, Bulukumba District. They have consistently rejected modernization. The economic life of Kajang people depends mostly on agriculture. Most of them are farmers to fulfill their daily needs and the customary ritual.


This study applied a mixed methods approach. The aim was to explore food security, food access, and children’s dietary diversity. A structured household survey captured their food security status, food access, and children’s dietary diversity. Food security status was measured by using US-HFSSM form. Children’s dietary diversity was captured by using 24 hour single recall. The qualitative approach was held after conducting the quantitative data. The informants were interviewed in relation to food access and how they cope with food insecurity. The respondents were mothers of children under five who were responsible for food preparation at home. Information was gathered such as the mother’s age, type of family, children’s age, sex, and children’s nutritional status. Therefore, nutritional status of their children was one of the variations needed. Informants were asked to sign the informed consent form if they agreed to be interviewed in this study. The interview process was started after getting their permission. The process was recorded by using voice recorder. Discussion A total of 142 households of Ammatoa Kajang people were surveyed and their food security status was assessed by using US-HFSSM. Most of them (73.9%) were classified as food insecure. Individuals in food insecure households are most likely to consume a less varied diet, which can negatively impact overall nutritional status. There were no traditional markets available around the forest where Kajang people live. It was restricted by the customary laws. Therefore, mothers experienced difficulties in accessing the market to fulfill their daily need. They must walk through the forest up to 5 kilometers to access a traditional market. To solve their food insecurity status, people would apply some coping strategies. Coping strategies are related to the idea of survival when individual or community are facing food insecurity. One of their coping strategies was by cultivating family poultry. Most of them (78.2%) cultivated family poultry. They use it for their own consumption (74,8%) and only 1.8% household sells their poultry. Some of them (23.4%) used for both. It provided households with a means of supplementing both food sources and income. Family poultry provides a valuable contribution to human nutrition and livelihood. A study by Bruyn (2014) stated that family poultry comprises up to 80% of poultry stocks in low-income food-deﬁcit countries. Meanwhile, the major constraint to family poultry was disease. Based on the observation during data collection, most households breed their chickens under part of their house or backyard house where it was too close to their kitchen. Bad poultry management could impact human health. Family poultry is small-scale, generated by households using family labor, mostly cared for by women and children and locally available feed resources. It may range freely in the household compound and find much of their own food. Family poultry provides protein source such as chicken and eggs and could become a source of family income. Family poultry was important to support food security of the household and in turn supports biosecurity. Future work Family poultry played an important role in fulfilling the food availability at household level. It is an inexpensive device for the household to generate highly nutritious and safe food at minimal cost as well as increasing food security status of the household. Therefore, it is important to give information and increase knowledge and awareness on biosecurity among Indigenous peoples especially related to family poultry. References 1. Charlton KE. Food Security, Food Systems and Food Sovereignty in the 21st Century: A New Paradigm Required to Meet Sustainable Development Goals. Nutr Diet. 2016;73 (1):3–12. 2. Thapa SK, Lawrence A, Anglezarke B, Frost B, Nolan P, Owen R, et al. The International Forestry Review. Special Issue: Forst, Biodiversity and Food Security. Int For Rev. 2011;13 (3). 3. Montenegro RA, Stephens C. Indigenous Health in Latin America and the Caribbean. Lancet. 2006;367 (9525):1859–69.


GENUS Bactrocera IN SEVERAL COUNTRIES Muh. Adiwena

Laboratory of Plant Protection, Faculty of Agriculture, Universitas Borneo Tarakan, Jl. Amal Lama No. 1, Kota Tarakan, Kalimantan Utara, Indonesia Phone: 085341465647 [email protected]/[email protected]

Abstract Genus Bactrocera is the main pest in many countries. This pest can result in 100% yield loss. This pest can be managed through a process of surveying, identification and control consisting of the use of sticky trap, fruit cover, and application pesticides in the plant and post-harvest. Keywords: Bactrocera, management, status

Abstrak

Genus Bactrocera adalah hama utama di berbagai Negara. Hama ini dapat mengakibatkan kehilangan hasil 100 %. Hama ini dapat dikelola dengan melalui proses survei, identifikasi dan pengendalian yang terdiri atas penggunaan perangkap, penyarungan buah dan apikasi pestisida di pertanaman dan pascapanen. Kata kunci: Bactrocera, pengelolaan, status Introduction Genus Bactrocera (Tephritidae) contains >500 species which attack fruits and vegetables (Jose et al., 2013). Fruit fly is a major pest of several countries which can result in up to 100% yield loss. In Nepal, B. cucurbitae is one of the most important pests of cucurbits and squash (Sapkota et al., 2010). Fruit fly invasions have a high economic impact on mango trees. According to Plantwise, B. occipitalis is currently spread in several Southeast Asian countries such as Malaysia (Sabah), Brunei Darussalam and Philippines. B. occipitalis on oranges, which is OPTK A2, was found in 2017 in North Borneo Province by the Agricultural Quarantine Agency. This is reinforced by the results of molecular identification by Martiningsia et al. (2017) which said that B. occipitalis in Tarakan has a degree of similarity above 99% with the Philippines. Border areas such as North Borneo provide a door for the spread of pests into and out of the country. Nevertheless, the spread of pests is also important to establish. The distribution of these pests disrupts national and international markets of agricultural products. Approach and Discussion To prevent the spread of pests we need to do surveillance regularly. Pest surveillance should be applicable and reliable. Applicable means easy to do and do not take a long time. Surveillance results should be reliable and generally recognized. The method that can be used for monitoring the diversity and spread of pests is the use of traps and direct observation. Symptoms of an attack by fruit fly are the presence of necrosis in the ovipositor puncture hole in the fruit. The use of sticky traps is used as a control method, if the pest population exceeds the target. According to Said et al. (2016), the combination of colour and sticky trap size can affect the number of caught adult flies. Abdullah et al. (2017) said that the yellow, white and green traps set up at 25 and 50 cm above the ground are effective for capturing adult fruit flies. Sticky traps are generally equipped with methyl eugenol (4-allyl-1,2-dimethoxybenzene) which is useful in attracting adults. White and Elson-Harris (1994) said that USA (California and Florida) and New Zealand maintain a grid of methyl eugenol and cue lure traps to control Bactrocera spp. The other way to control the fruit fly is by using paper and plastic as a fruit cover. This feature works as a barrier to prevent oviposition and it must be done before the fruit is attacked. Chemical applications can still be done. Sapkota et al. (2010) uses locally made botanical pesticide 'Jholmal' to reduced fruit fly infestations. In some countries, such as the USA, imported fruits should be treated by exporters using techniques such as fumigation, heat treatment, cold treatments or insecticidal dipping before exported (Armstrong and Couey, 1989).


G

US Bact oce a

S

COU

O

C O

OU

O SU

O

OOD S CU

O G

DG

O US

O

J

G

O

SOU

SU

S,

DO

S

Future work What we need is multilocation testing of fruit fly control in different places with different climates and hosts. This is because fruit flies have a wide range of hosts, so the control methods are not applicable for all hosts. Improper implementation will affect the outcome. References Abdullah, T., Said, A. E., Ngatimin, S. N. A., & Nasruddin, A. (2017). Attractiveness of Trap Size and Direction to Adult Oriental Fruit Fly, Fruit fly dorsalis (Hendel) (Diptera: Tephritidae) in Chili Pepper. RESEARCH JOURNAL OF PHARMACEUTICAL BIOLOGICAL AND CHEMICAL SCIENCES, 8(2), 1082-1085. Jose, M. S., Leblanc, L., Geib, S. M., & Rubinoff, D. (2013). An evaluation of the species status of Fruit fly invadens and the systematics of the Fruit fly dorsalis (Diptera: Tephritidae) complex. Annals of the Entomological Society of America, 106 (6), 684-694. Martiningsia, D., Wijaya, I. N., & Sudiarta, I. P. KARAKTERISTIK MOLEKULER DAN FILOGENI LALAT BUAH Fruit fly occipitalis (Diptera: Tephritidae) DARI TARAKAN BERDASARKAN SEKUEN NUKLEOTIDA GEN COI. Said, A. E., & Nasruddin, A. (2016). Effect of Sticky Trap Color and Height on the Capture of Adult Oriental Fruit Fly, Fruit fly dorsalis (Hendel) (Diptera: Tephritidae) on Chili Pepper. Sapkota, R., Dahal, K., & Thapa, R. (2010). Damage assessment and management of cucurbit fruit flies in spring-summer squash. Journal of Entomology and Nematology, 2(1), 007-012.


CHANGING FARMERS’ HABITS IN USING EXCESSIVE CHEMICAL PESTICIDES Marcella Wayan Kartika Rini1 2

Agricultural Extension Worker Agricultural Agency of Denpasar City [email protected]

1 2

Abstract

Nowadays, farmers use excessive chemical pesticides. This can even cause lack of variety in soil biodiversity when farmers use excessive chemical pesticides. These soil conditions can result in not enough water and air being provided for the plants. Roots will be difficult to penetrate in the soil, plants will not grow healthily and may have soft membrane cells. This condition will attract pests to attack them. Pests breed fast in good conditions. When that happens, farmers will use excessive chemical pesticides which are easy to get, cheap and respond fast. The impact is dangerous for human health. How do we change this habit among farmers? Keywords: chemical pesticides, biodiversity, pests

Abstrak

Saat ini, petani menggunakan pestisida secara berlebihan. Ketika petani menggunakan pestisida secara berlebihan dapat menyebabkan semakin berkurangnya varietas keberagaman hayati. Keadaan tanah yang seperti ini menyebabkan tidak cukup air dan udara yang tersedia untuk tanaman. Akar akan kesulitan menembus tanah, tanaman akan tumbuh dengan tidak sehat dan lapisan sel akan menjadi lunak. Kondisi tersebut akan menarik hama dan penyakit untuk menyerang. Hama dan penyakit berkembang dengan cepat pada kondisi yang mendukung. Ketika hal ini terjadi, petani akan menggunakan pestisida kimia secara berlebihan karena mudah didapat, harganya relatif murah, dan memberikan hasil yang cepat. Dampaknya berbahaya bagi kesehatan manusia. Sekarang, bagaimana kita mengubah kebiasaan petani dalam menggunakan pestisida secara berlebihan? Kata Kunci: pestisida kimia, keberagaman hayati, hama dan penyakit

Introduction The use of excessive chemical pesticides by farmers is dangerous for soil biodiversity. Living organisms which live in the soil such as microbes (including bacteria and fungi), microfauna (such as protozoa and nematodes), mesofauna (such as microarthropods), and macrofauna (such as earthworms) will be harmed and/or killed by pesticides. One of the signs we can see, when soil biodiversity is starting to be harmed, is the soil structure and its density. Soil structure will be less porous and becomes dense, because of the four kinds of living things above that create a food web in the soil. As there are not enough microbes, the fermentation of organic matters are even stopped. Without fermented organic matter, there is no food for microfauna. If there is no more microfauna, there is no food for mesofauna. It is the same as macrofauna which is a predator for mesofauna. The biodiversity in the soil creates micro and macro pores in the soil. When soil has less pores and is dense, plants will not be healthy. It needs more nutrients which can be added by fertilizer. But if more fertilizer is applied, plant cells will grow abnormally and be too soft. This condition is like inviting pests to attack. When the weather promotes pests to breed – because of climate change – plants will be harmed in high intensity. Finally, farmers want to control the pest population with chemical pesticides when unhealthy plants increase. The hazardous particles from pesticides will remain in the body of the plant. If humans consume this plant in the long term, it will be dangerous for human cells which can cause degenerative illness and gene mutation for the next generation. Our task is how to prevent farmers applying pesticides in higher volume and dosage by adopting a ‘back to nature’ concept. This is a challenge for all of us to change farmers’ habits.


Approach The method we can use to understand the basis of farmers’ willingness to change is Participatory Rural Appraisal (PRA). It asks the participants (farmers) to take part as a subject. PRA is a unique method which is locally specific. We need to understand the main problem as to why the farmers’ use excessive chemical pesticides. One place to another can have different problems. For example, the farm around the housing complex and the farm which is far enough from it will have different main problems. Also communities where farmers live can influence the way they think. The influence can be good or bad. In order to choose the appropriate approach with PRA to change farmers’ habits, we must do some steps. First, we should identify the place of the farm. Second, observe the community habits around farmers. Third, build networks for all stakeholders, starting from input production providers to output receiver, including government rules to assure all of stakeholders to get a win-win solution. Fourth, maintain good relationships between stakeholders consistently and continually. After we finish with PRA, we continued by creating a Likert Scale. We use a 5 point scale: ‘strongly disagree’, ‘disagree’, ‘slightly disagree’, ‘agree’, and ‘strongly agree’. Some indicators that we used were based on technical and non-technical aspects. From the Likert Scale will be known the most important reasons why farmers use chemical pesticides. After we know them, we can give the recommendations about how to change farmers’ habits from using excessive chemical pesticides to using chemical pesticides wisely. Discussion Changing habits of humans is not easy. We need to understand the basic reasons why they choose those ways. For farmers in Indonesia, especially in Bali, there are some reasons why they use excessive chemical pesticides to control pest population: 1) Easy to get in many stores; 2) Price is cheaper than natural pesticides if they are also provided; 3) Fast response; once applied, pests die. Besides the reasons above, we should know why pests breed very fast today. The result is that farmers have no choice and are almost forced to use excessive chemical pesticides. Here are some of the reasons explained: 1. Climate change makes it difficult for farmers to choose the kinds of plants they can cultivate in each season. 2. Lack of water irrigation because irrigation channels break down and/or land is converted from farm to housing complex. 3. Farmers work on farms which are less than 2 Ha wide which won’t be enough for self-sufficiency. 4. Higher price for living day by day because of inflation. 5. Farmers tend to apply chemical pesticides themselves, almost at the same time as their neighbours. Future work As we start the PRA method to change farmers’ habits to reduce the use of pesticides, we have to work together. To help farmers change their habits, we need to support them with good quality input for their production. Some science technology research from around the world can join in this project. We need to maintain good relationships between all stakeholders and a steady system to get this. One of the examples, after harvest time, we provide markets for the product with a certain quality. For example, we can put a ‘Healthy Food’ label on it, because the production process has less pesticides.


EFFECT OF DIFFERENT CULTIVATION SYSTEMS WITH POPULATION ABUNDANCE OF ROOT-KNOT NEMATODE (Meloidogyne spp.) IN TOMATO PLANTS Ankardiansyah Pandu Pradana

Laboratory of Plant Protection, Faculty of Agriculture, Universitas Borneo Tarakan, North Kalimantan – Indonesia. [email protected]

Abstract Root-knot nematode (RKN, Meloidogyne spp.) is one of the serious problems for tomato farming. Yield losses caused by RKN infection may lead to yield loss up to 60% on tomato. The abundance of RKN in soil and roots of plants is affected by some factors i.e. biotic factors and abiotic factors. Earlier research also reported that the abundance of RKN may be affected by different cultivation systems. This study aims to observe the abundance of Meloidogyne spp. in Pasir Sarongge between two different cultivation systems (with crop rotation and without crop rotation). The result of this research showed that the RKN abundance was greater in non-crop rotated system field than in crop rotated system field. Keywords: crop rotation, monoculture, polyculture, roots

Abstrak

Nematoda puru akar (NPA, Meloidogyne spp.) adalah salah satu patogen yang dapat menyebabkan masalah serius pada tanaman tomat. Kehilangan hasil pada tanaman tomat akibat infeksi NPA dapat mencapai 60%. Kelimpahan NPA di tanah dan akar tanaman dipengaruhi oleh beberapa faktor seperti faktor biotik dan faktor abiotik. Penelitian sebelumnya juga melaporkan bahwa kelimpahan NPA dapat dipengaruhi oleh teknik budidaya yang berbeda. Penelitian ini bertujuan untuk mengobservasi kelimpahan Meloidogyne spp. di Desa Pasir Sarongge yang ditanam pada dua sistem yang berbeda (dengan rotasi tanam, dan tanpa rotasi tanam). Hasil penelitian menunjukkan kelimpahan NPA lebih tinggi pada lahan tanpa rotasi tanam dibandingkan dengan lahan yang dirotasi tanam. Kata kunci: akar, monokultur, polikultur, rotasi tanam Introduction

Pasir Sarongge village is one of the largest producers of fresh vegetables in West Java, Indonesia. A multiple cropping system is practiced, with up to 10 different vegetable crops grown in rotation. Tomato (Solanum lycopersicum), chili (Capsicum annuum and Capsicum frutescens), celery (Apium graveolens) and broccoli (Brassica oleracea var. italica) are the vegetables produced most frequently in this area. Based on our survey, tomatoes are grown throughout the growing season. Tomato is an important horticultural product in Indonesia, and is processed as raw material for food industries or freshly consumed. Infections from root-knot nematode (RKN) Meloidogyne spp. is a serious problem for tomato farming. Rootknot nematode have a significant negative impact in a tropical area because they have a wide host range, can interact with other pathogens and cause yield loss in some agricultural commodities. Infestation of Meloidogyne spp. can reduce production by up to 60% in tomato, 35% in potato, and 20% in bean. Symptoms caused by infestation with M. incognita are indicated by gall at the root. The existence of gall can disrupt water and minerals distribution systems from the soil through the roots to all parts of the plant which later disrupts the growth of new root, leads to plant wilting, slow growth, stunted growth and chlorosis (Moens et al., 2010). Meloidogyne spp. infestations can also increase the severity of wilt disease caused by Fusarium oxysporum and Ralstonia solanacearum in tomato (Son et al., 2009). The abundance of Meloidogyne spp. is predominantly determined by the host. Nevertheless the distribution of Meloidogyne spp. is also known to be affected by distribution of the host’s root, soil type, and environmental conditions. Earlier research also reported that the abundance of RKN depended on the cultivation system (crop rotation). Therefore this study was conducted to observe the abundance of Meloidogyne spp. in Pasir Sarongge between two different cultivation systems (with crop rotation and without crop rotation).


Approach The observation was taken in 2 different tomato plantations (with crop rotation system and without crop rotation system) in Pasir Sarongge village (Figure 1). The planted variety was Permata F1 (east west seed Indonesia). The soil samples were taken with structured sampling method. At each field, 10 plants and soil were sampled. The extraction of nematodes used Whitehead tray method, the Mistifier method was used for extraction of nematodes from root samples before sieving and decanting through a 40 μm sieve. The number of Meloidogyne spp. was counted in a counting dish under a stereo microscope. Population abundance was counted by multiplying the average number of RKN from 10 ml nematode suspensions (Mutala’liah et al., 2017).

Figure 1. Map showing the sampling location in Pasir Sarongge village, West Java, Indonesia Discussion Root-knot nematodes were detected in all soil and root samples. The nematodes sampled from crop rotated system field and without crop rotated system field were found in different numbers. In general, RKN abundance was greater in noncrop rotated system field than in crop rotated system field (Table 1). Table 1. The abundance of Meloidogyne spp. in soil and roots of tomato with different cultivation systems Population of Meloidogyne spp. Cultivation System Soil (200 ml) Root (50 g) Crop rotation 167 ± 9 48 ± 10 Without crop rotation 302 ± 6 77 ± 12 Although resistance to Meloidogyne species is available in the planted tomato cultivars, the results of this survey indicated that different cultivation systems can affect the number of Meloidogyne spp. in the soil and roots of tomato. The results showed that crop rotation is important in reducing the yield losses caused by RKN infection. Crop rotation involves growing different crops in systematic and recurring sequence on the same land, as compared to monoculture, in which a particular crop is planted repeatedly in the same field. Crop rotation is usually used to control soil-borne pathogens (bacteria, fungi, and nematodes). This system is known to effectively decrease the population of pathogens, interrupting pest life cycles, and interrupting pest habitats (Kremer, 2004).


Future work This research has been mainly focused on Root-Knot Nematode Meloidogyne spp. In the future, we would like to try to identify more nematode species associated with tomato and other important plants in Indonesia with different cultivation systems. The results of future work is expected to result in a recommendation in determining cultivation systems for farmers. References Kremer RJ. 2004. Weed control, in: Smith CW, Betran J, and Runge ECA, eds. Corn: Origin, History, Technology, and Production. John Wiley & Sons Inc. United States of America (USA). pp: 717-752. Moens M, Perry RN, and Starr JL. 2010. Meloidogyne species - a diverse group of novel and important plant species. in: Perry RN, Moens M, and Starr JL, eds. Root-Knot Nematodes. CABI: United Kingdom (UK). pp: 1-17. Mutala’liah, Indarti S, and Putra S. 2017. Relationship of soil abiotic factors with population abundance and vertical distribution of root lesion nematode in robusta coffee plantation. Pak J Nematol. 35(2):183-196. Doi: 10.18681/pjn.v35.i02.p183-196. Son SH, Khan Z, Kim SG, and Kim YH. 2009. Plant growth-promoting rhizobacteria, Paenibacillus polymyxa and Paenibacillus lentimorbus suppress disease complex caused by root-knot nematode and fusarium wilt fungus. J Appl Microbiol. 107(2):524-532. Doi: 10.1111/j.1365-2672.2009.04238.x.


EFFECT OF HEALTHY AND GEMINI VIRUS INFECTED Ageratum conyzoides ON SEED GERMINATION OF Zea mays Aditya Murtilaksono

Faculty of Agriculture, Borneo Tarakan University Jl. Amal Lama No 1, Tarakan City, North Borneo, Indonesia [email protected]

Abstract Ageratum conyzoides is classified as a wild weed that has potential as organic fertilizer. Nevertheless, A. conyzoides also can be an alternative host of the gemini virus. This experiment was conducted on January 15, 2018 to 22 January 2018 at the experimental laboratory of Borneo Tarakan University. The research method was experimental method with treatment of 0 ml, 2.5 ml, 5 ml, 10 ml, 20 ml and 40 ml. The results showed that germination and height of maize given healthy A. conyzoides was better than germination and height of zea maize crops given A. conyzoides which was attacked by gemini virus disease. Keywords: Zea mays, Ageratum conyzoides, organic fertilizer

Abstrak

Ageratum conyzoides merupakan gulma yang hidup secara liar dan sangat pontensi sebagai pupuk organik, akan tetapi Ageratum conyzoides sebagai inang dari virus gemini. Penelitian dilaksanakan pada tanggal 15 januari 2018 hingga 22 januari 2018 di Laboratorium percobaan Universitas Borneo Tarakan dengan metode penelitian adalah metode eksperimental dengan perlakuan 0 ml, 2.5 ml, 5 ml, 10 ml, 20 ml dan 40 ml. Hasil penelitian menunjukkan bahwa perkecambahan dan tinggi tanaman jagung yang diberikan Ageratum conyzoides yang tidak terserang gemini virus lebih baik dari perkecambahan dan tinggi tanaman jagung yang diberikan Ageratum conyzoides yang terserang penyakit virus gemini. Kata kunci: Zea mays, Ageratum conyzoides, pupuk organik Introduction Diversification of food is an important strategy to help overcome food problems in Indonesia. In addition to maintaining and improving national food security, food diversification is an effort to conserve and utilize germplasm of Indonesian food crops. Regarding conservation efforts and utilization, the government needs to develop and utilize alternative food crops that are diverse and have potential to be developed. Indonesia has enormous potential for the development of diverse sources of alternative carbohydrate (non-rice) crops to support food diversification, such as Zea mays. Zea mays is a seasonal crop with the family Poaceace. Efforts to increase corn production can be done through fertilizer application. The addition of fertilizer is expected to ensure the plant will get enough nutrient supply, so the plant can grow and develop well. Ageratum conyzoides is an Asteraceae plant which are classified as weeds. A. conyzoides is a plant with great potential to be developed as organic fertilizer because of its nutrient content. According to the nutrient content analysis from the Soil Science Laboratory of Borneo Tarakan University in 2017, the N content is as much as 0.17%, P content of 31.7%, and K content of 22.7%. This weed is one of the alternative hosts of the gemini virus. Initial symptoms of A. conyzoides which is attacked by gemini virus in which shoots and young leaves yellow the entire leaf. The process of spreading the gemini virus on A. conyzoides leaves is very fast. This problem needs to be controlled before the leaves of A. conyzoides found on Tarakan island cannot be used as organic fertilizer Approach The experiment was conducted from January 15, 2018 to 22 January 2018 at the experimental laboratory of Borneo Tarakan University. The research method was experimental method with treatment 0 ml, 2.5 ml, 5 ml, 10 ml, 20 ml and 40 ml. The tools used in this research were petri dish, ruler, stationery, filter paper, blender, plastic, and scissors. The materials used in this research are A. Conyzoides leaf, air, and Zea mays kernels brand red arrow stamp. The study was conducted in a petri dish with one replication and there were five plants per treatment. The germination observation was conducted for five days and the observation variable observed was germination of corn plant and maize plant height. Making A. Conyzoides extract is first to look for A. Conyzoides in the morning before applying time to petri dish. Prepare blender and A. Conyzoides then A. Conyzoides in blender. Mix 50 gr of A. Conyzoides with 250 ml of water, result to 100% pure A. Conyzoides extract. Apply to petri disc according to prescribed treatment. Include five corns for each petri dish and observe the germination of corn and Zea mays seeds.


Discussion Based on our research we found that the application of A. conyzoides affected the germination of corn seed in the different value (Fig. 1-5). Healthy A. conyzoides provide better germination rate.

4 3

Healhty A. Conyzoides

2 1

Unhealhty A. Conyzoides

0

0 2.5 5 10 20 40 ml ml ml ml ml ml

Figure 1. First observation of germination of Zea mays

5 4 3 2 1 0

Healthy A. Conyzoides Unhealthy A. Conyzoides

0 2.5 5 10 20 40 ml ml ml ml ml ml

5 4 3 2 1 0

Healhty A. Conyzoides Unhealhty A. Conyzoides

0 2.5 5 10 20 40 ml ml ml ml ml ml

Figure 2. Second observation of germination of Zea mays

5 4 3 2 1 0

Healthy A. Conyzoides Unhealthy A. Conyzoides

0 2.5 5 10 20 40 ml ml ml ml ml ml

Figure 3. Third observation of germination of Zea mays Figure 4. The Fourth observation of germination of Zea mays

5 4

Healthy A. Conyzoides

3 2

Unhealthy A. Conyzoides

1 0

0 2.5 5 10 20 40 ml ml ml ml ml ml

Figure 5. The fifth observation of germination of Zea mays


Table 1 Average to first observation of height plant of Zea mays Healthy A. Unhealthy A. Treatment Conyzoides Conyzoides 0 ml 0.22 0.54 2.5 ml 0.26 0.22 5 ml 0.04 0.08 10 ml 0.04 0.16 20 ml 0.34 0.04 40 ml 0 0 Table 3 Average to third observation of height plant of Zea mays Healthy A. Unhealthy A. Treatment Conyzoides Conyzoides 0 ml 1.24 1.52 2.5 ml 0.64 0.62 5 ml 0.54 0.38 10 ml 0.18 1.24 20 ml 1.78 0.12 40 ml 0 0

Table 2. Average to second observation of height plant of Zea mays Healthy A. Unhealthy A. Treatment Conyzoides Conyzoides 0 ml 0.62 0.66 2.5 ml 0.42 0.38 5 ml 0.24 0.18 10 ml 0.08 0.7 20 ml 0.74 0.08 40 ml 0 0 Table 4 Average to the four observation of height plant of Zea mays Healthy A. Unhealthy A. Treatment Conyzoides Conyzoides 0 ml 1.78 1.98 2.5 ml 2.88 0.88 5 ml 0.76 0.5 10 ml 0.32 1.92 20 ml 2.78 0.2 40 ml 0 0

Table 5. Average to the five observation of height plant of Zea mays Healthy A. Unhealthy A. Treatment Conyzoides Conyzoides 0 ml 2.22 2.4 2.5 ml 1.06 0.98 5 ml 0.94 0.66 10 ml 0.52 2.56 20 ml 3.32 0.26 40 ml 0 0

Figure 6. Treatment using a healthy A. Conydoizes on the fifth observation

Figure 7. Treatment using a A. Conizoides infected gemini virus disease on the fifth observation

Figure 1-5 shows the germination of Zea mays provided by A.conyzodes organic fertilizer is best in the treatment of 2.5 ml extract of healthy A.conyzodes and A conyzoides which is attacked by gemini virus, there is a decrease in germination power. Table 1-5 shows the height of the plants in Zea mays seeds provided by A.conyzodes organic fertilizer is best in the treatment of 20 ml A.conyzodes extract is healthy A.conyzodes and in the treatment of 40 ml no seed A.conyzodes can not grow.


Figure 1-5 shows that giving Healthy A.conyzoides extract and A. conyzoides with gemini virus can increase germination when compared with controls. Table 1-5 shows that given healthy A.conyzodes extract and A conyzoides infected gemini virus can increase height plants when compared with other treatments and on the treatment of 40 ml of A conyzoides extract of Zea mays seeds can not increase, caused by excessive giving of A conyzoides extracts so that the plant is not able to live. Giving healthy A. conyzoides has a higher average plant height than A conyzoides who is infected with the gemini virus disease. The use of A. conyzoides gemini virus disease is not recommended because it can move to Zea mays crops so that the Zea mays will be attacked by gemini virus disease and will cause crop failure. Future work Limitations in this study is where we can still control the research and can not influence from the environment. If we do research using pots in greenhouses or soil block in the field that are heavily influenced by the environment, perhaps the results of research will be unexpected. Future research suggested is how to move the research from the laboratory to the field so that the research results in the field can provide information to farmers showing that the use of healthy A conyzoides extract can improve the yield of Zea mays production.


Co-Sponsors and organisations providing in-kind support The Crawford Fund The Plant Biosecurity Cooperative Research Centre (PBCRC) Biosecurity Australia Australian Embassy, Jakarta CABI Pestpoint Centre of Excellence for Biosecurity Risk Analaysis (CEBRA), Melbourne University Australian Bureau of Agricultural and Resource Economics (ABARE) Harry Butler Institute, Murdoch University Queensland University of Technology (QUT) Lembaga Ilmu Pengetahuan Indonesia (Indonesian Institute of Sciences LIPI) Universitas Mahasaraswati Denpasar (UNMAS) Universitas Sam Ratulangi (UNSRAT) Pacific Institute Manado Universitas Kristen Satya Wacana (UKSW) Universitas Nusa Cendana (UNDANA) Universitas Andi Djemma (UNANDA) Bilateral Plant Biosecurity Initiative (BPBI) Indonesian Biosecurity Foundation (IBF) Acknowledgements: Leane Regan, Plant Biosecurity CRC Communications Tony Steeper, Plant Biosecurity CRC Communications


ISBN 978-0-6482770-0-2 018, Denpasar

67