216 Ni et al
World J Emerg Med, Vol 1, No 3, 2010
Original Article
Autophagy inhibitor 3-methyladenine regulates the expression of LC3, Beclin-1 and ZnTs in rat cerebral cortex following recurrent neonatal seizures Hong Ni, Yong Gong, Jian-zhen Yan, Le-ling Zhang Neurology Laboratory, Soochow University Affiliated Children's Hospital; Laboratory of Aging and Nervous Diseases, Soochow University, Suzhou 215003, China Corresponding Author: Hong Ni, Email:
[email protected];
[email protected]
BACKGROUND: Autophagy is a homeostatic process for intracellular recycling of bulk proteins and aging organelles. Increased autophagy has now been reported in experimental models of traumatic brain injury, stroke and excitotoxicity, and in patients with Alzheimer's disease and critical illness. The role of autophagy in developmental epilepsy, however, is unknown. The present study was to investigate the effects of recurrent neonatal seizure, in the presence and absence of autophagy inhibitor 3-methyladenine (3-MA), on the acute phase gene expression of ZnTs, LC3 and Beclin-1 in rat cerebral cortex and the interaction among them. METHODS: Thirty-six Sprague-Dawley neonatal rats at postnatal day 6(P6) were randomly divided into three groups: a recurrent-seizures group (RS, n=12), a 3-MA treated-seizure group (3MA group, each rat pretreated with 3-methyladenine before seizures, 100nmol/μl/day, i.p., n=12) and a control group (n=12). At 1.5 and 6 hours after the last seizures, the mRNA levels of ZnT1-ZnT3, microtubule-associated protein 1A/1B light chain 3 (LC3) and beclin-1 were detected using the real-time RT-PCR method. The LC3 protein level was examined by Western blotting. RESULTS: The levels of LC3, beclin-1 and ZnT-2 transcripts in the RS group elevated significantly at 1.5 and 6 hours after the last seizures compared with those in the control and 3-MA groups. At the interval of 1.5 hours, the mRNA level of ZnT-1 increased significantly after the last seizure compared with that in the control group. There was no significant difference in the transcript levels of ZnT-3 among the three groups. Linear correlation analysis showed that the expression of the five genes in the control group exhibited a significant inter-relationship. In the 3-MA group, however, the inter-relationship was only found between beclin-1 and ZnT-1. In the RS group, the inter-relationship was not observed. CONCLUSIONS: The autophagy/lysosomal pathway is immediately activated along with the elevated expression of ZnT1 and ZnT2 in the cerebral cortex after recurrent seizures. 3-MA is involved in the regulation of the autophagy/lysosomal pathway and ZnTs by down-regulating the expression of LC3 and beclin-1. KEY WORDS: Zinc transporter 1; Zinc transporter 3; LC3; Beclin-1; Seizure World J Emerg Med 2010;1(3):216-223
INTRODUCTION Developmental seizure-induced excitotoxicity has been a subject of intensive study since it plays a general role in the pathogenesis of regenerative mossy fiber www.wjem.org © 2010 World Journal of Emergency Medicine
sprouting in the hippocampus and subsequent cognitive deficit when studied as adults.[1-3] It has been indicated that Zn 2+ dyshomeostasis in the hippocampal Zincrich mossy fiber pathway is responsible for mossy
World J Emerg Med, Vol 1, No 3, 2010
fiber sprouting in the hippocampus, [4-6] which may be involved in cognition and learning. [7-9] Zn 2+ is an essential catalytic element of many proteins[10,11] and is also a potent toxic agent in the neuronal loss observed in a variety of excitotoxic neurological conditions, such as epilepsy and ischemia. [12] For example, status epilepticus induces both Zn 2+ depletion from mossy fiber toutons and injurious intracellular Zn 2+ accumulation in adjacent post-synaptic hilar neurons. Hence it has been established that Zn2+ is a "killing ion", and is as injurious as Ca2+.[13] The regulation of cellular zinc homeostasis in neurons is controlled tightly through zinc transporters (ZnTs).[14,15] ZnTs are encoded by the Slc30A genes and are involved in intracellular traffic and/or excretion. It has been established that ZnT1 is responsible for the transport of zinc out of neurons, and thus acts as a "defensive maneuver" against Zn 2+ toxicity. ZnT-2 could protect neurons from zinc toxicity by facilitating zinc transport into endosomes and lysosomes. ZnT3 is responsible for the transport of zinc into synaptic vesicles in mossy fiber boutons.[16] We h a v e p r e v i o u s l y d e t e c t e d t h e d i s t u r b e d expression pattern of ZnT-1 and ZnT-3 following r e c u r r e n t n e o n a t a l s e i z u r e s . [ 1 7 - 1 9 ] H o w e v e r, t h e regulation of ZnTs is seldom investigated. Our recent studies showed that KA brought about an increase in the formation of autophagosomes and autolysosomes in the cytoplasm of striatal cells following overstimulation of KA receptors.[20] We thus speculate that autophagy may be activated by recurrent neonatal seizures. Such activation of autophagy contributes to Zn2+ dyshomeostasis. Autophagy is a homeostatic process for intracellular recycling of bulk proteins and aging organelles. Increased autophagy has been found in experimental models of traumatic brain injury, stroke and excitotoxicity, and in patients with Alzheimer's disease and critical illness. The role[21] of autophagy in developmental epilepsy, however, is unknown. The present study was designed to determine the effects of recurrent neonatal seizure, in the presence or absence of autophagy inhibitor 3-methyladenine (3-MA), on the acute phase gene expression of ZnTs, LC3 and Beclin-1 in rat cerebral cortex and the interaction among them.
METHODS Animal preparation Thirty-six Sprague-Dawley neonatal rats at
217
postnatal day 6(P6) were randomly divided into three groups: a recurrent-seizures group (RS, n=12), a 3-MA treated-seizure group (3-MA group, each rat was pretreated with 3-methyladenine before seizures were induced, 100 nmol/μl/day, i.p., n=12) and a control group (n=12). The procedure of seizure induction has been described in detail previously. [22] Briefly, seizures were induced in the neonatal rats with volatile flurothyl (bis-2, 2, 2-triflurothyl ether, AldrichSigma Chemical, WI, USA), a potent and rapidly acting central nervous system stimulant that produces seizures within minutes of exposure. The pups were put into a transparent plastic airtight box and liquid flurothyl was delivered through a syringe and dripped at a rate of three drops/min onto filter paper in the center of the container where the agent evaporates. The experimental rats were exposed to flurothyl until tonic extension of both the forelimbs and hindlimbs was observed. The rats were then quickly removed from the chamber and allowed to recover in room air until the animals returned to their baseline activity level. The control rats were placed into the container for an equal amount of time without exposure to flurothyl and were separated from their dam for the same duration as the rats were exposed to flurothyl. The experimental rats had 45 induced seizures during the nine consecutive days from P6 to P14. The rats had 5 seizures per day for nine consecutive days, with a minimum of 30 minutes between seizures.
Real-time RT-PCR study At 1.5 and 6 hours after the last seizure, rats (n=36) from the flurothyl-treated RS group (n=12), 3-MA group (n=12) and control group (n=12) were sacrificed. The cerebral cortex in every time point from each group (n=6) were rapidly removed and immediately frozen in dry ice. Total cerebral cortex RNAs from the right hemisphere (the left hemisphere was used for western blot analysis) were extracted with Trizol reagent (Sangon Inc., China) and stored at -80 °C . The concentration, purity and amount of total isolated RNA were determined by ultraviolet spectrophotometry. By these standards, the RNA samples used for assay were of high quality and purity by measuring OD at 260 nm and 280 nm (Abs260/Abs280>1.8). Two micrograms of total RNA were reverse transcribed into cDNA by using random primers, 200U of MMLV reverse www.wjem.org
218 Ni et al
World J Emerg Med, Vol 1, No 3, 2010
transcriptase (InVitrogen, USA), 0.5 mmol dNTPs, 10 mmol dithiothreitol, and 25 U of Rnase inhibitor (InVitrogen). Forty microliter RT reaction was performed at 37 °C for 60 minutes, then at 95 °C for 5 minutes. RT products were stored in -20 °C until being assayed. RT-PCR was carried out using TaqMan probebased chemistry (Applied Biosystems, Foster City, CA, USA). The primers and probes of the five genes were designed against GenBank-published sequences with the software Primer Express 2.0 (Applied Biosystems), of which the sequences were listed in Table 1. The amplification reactions (25µl) were performed with 1×buffer, final concentrations of 4 mmol MgCl 2 , 0.2 mmol dNTPs, 0.3µmol primers, 1UTaq DNA polymerase, 200 nmol TaqMan probe, and 50 ng cDNA template on an ABI Prism 5700 Sequence Detector (Applied Biosystems) in a universal two-step procedure. The closed tubes were incubated at 94 °C for 5 minutes, and then followed by denaturing at 94 °C , annealing and elongation at 60 °C for 45 cycles. Real-time fluorescent data were collected and analyzed with SDS 1.3 software. The ΔCT method of relative quantification was used to determine the fold change in expression. This was done at first by determining the real-time PCR threshold cycle (CT) of the target mRNAs and the internal control β-actin. Then the ratio target genes: β-actin were calculated as follows: target genes: β-actin =2 CT (target)-CT (β-actin) (ΔCT=CT Target – CT β-actin). At last the fold change in expression was obtained (2–ΔCT –method).[23]
Western blotting The left hemisphere in every time point from each group (n=6) was used for western blot analysis as described by Wang. [20] Tissue samples taken from the cerebral cortex were homogenized in Western blot lysis buffer containing 10mmol TrisHCl (pH 7.4), 150 mmol NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 5 mmol EDTA, 1 mmol PMSF, 0.28 ku/L aprotinin, 50 mg /L leupeptin, 1 mmol benzamidine, and 7 mg/L pepstain A. The homogenate was then centrifuged at 10 600 ×g for 10 minutes at 4 °C and the supernatant was preserved at -70 °C for last use. Protein concentration was determined using a BCA kit (Pierce). Thirty micrograms of protein from each sample were subjected to electrophoresis on 10% SDS-PAGE gel using a constant current. Proteins were electrotransferred onto polyvinylidene fluoride membranes. After blocking with a blocking solution TBS-T containing 20 mmol Tris base, 137 mmol sodium chloride, 5% non-fat milk powder and 0.05% Tween 20 overnight at 4 °C, blots were then incubated with rabbit anti-PRG-1 polyclonal antibody (1:1000, GenScript) in Tris buffered saline containing 0.2% Tween-20 (TBST) and 3% nonfat dry milk for 3 hours. The blot was washed several times with TBS-T and then incubated with the secondary antibody, horseradish peroxidase-conjugated anti-rabbit IgG dilution (1:10 000, Santa Cruz). Specific bands were visualized on a film Kodak X-Omat LS using the ECL detection system Amersham. The relative changes of the intensity of each immunoreactive band were evaluated with Sigma Scan Pro 5 and were normalized to a
Table 1. Oligonucleotide primers for real-time RT-PCR analysis Gene Genbank accession number Primer sequence LC-3
Beclin-1
ZnT-1
ZnT-2
ZnT-3
NM_012823
NM_001034117
NM_022853
RNU50927
NM_001013243
www.wjem.org
No.of cycles
F: 5'-CCTGCTGCTGGCCGTAGT-3' R: 5'-TGATGAAGTCTTCCTGCCAAAA-3' probe:- 5'-FAM-CGCTGTACGAGGAACACCCCAGCT-TAMRA-3'
45
F: 5'-AGCACGCCATGTATAGCAAAGA-3' R: 5'-GGAAGAGGGAAAGGACAGCAT-3' probe:- 5'-FAM-CCCTGCCGTAGTTTGGCTCAACCC-TAMRA-3'
45
F: 5'- CGTTGTTGTGAATGCCTTGGT-3' R:5'-GGGTTCACACAAAAGTCGTCTTC-3' probe::5'-FAM-TTCTACTTTTCCTGGAAGGGTTGTA-TAMRAM-3'
45
F: 5'- GGCTGGATCCTGGACTAATGTT -3' R: 5'- ACACCCCAAAATCCCTTTCTG -3' probe:5'-FAM-CTCACACCACAGCTGGAGAGACACTGAGG-TAMRA-3'
45
F:5'- TGGGCGCTGACGCTTACT-3' R: 5'- GTCAGCCGTGGAGTCAATAGC-3' probe::5'-FAM-ACCACGTTGCCTCCGCACACCT-TAMRAM-3'
45
World J Emerg Med, Vol 1, No 3, 2010
219
RESULTS Real-time RT-PCR The levels of LC3, beclin-1 and ZnT-2 transcripts
r value
B
r value
C
r value
D
1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
Control group Recurrent seizure group B-MA group **
** LC-3
# Beclin-1
ZnT-1
ZnT-3
0.00018 0.00016 0.00014 0.00012 0.00010 0.00008 0.00006 0.00004 0.00002 0
**
ZnT-2
r value
**
P value
*
**
Becl-LC3 Becl-ZnT1 Becl-ZnT2 Becl-ZnT3 LC3-ZnT1 LC3-ZnT2 LC3-ZnT3 ZnT1-ZnT2 ZnT1-ZnT3 ZnT2-ZnT3
r value
P value
Becl-LC3 Becl-ZnT1 Becl-ZnT2 Becl-ZnT3 LC3-ZnT1 LC3-ZnT2 LC3-ZnT3 ZnT1-ZnT2 ZnT1-ZnT3 ZnT2-ZnT3
1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0
1.2 r value
P value
1.0 0.8 0.6 0.4
P value
0.16 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0
2–ΔCT
2–ΔCT
A
P value
Statistical analysis The protein and the gene expression levels (2 – ΔCT ) were compared by the nonparametric KruskalWallis test using SAS 8.0 statistical software. Data were presented as the mean (SD ) and as P
