Biodiversity, pathogenicity, antifungal susceptibility

Biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives Mohammad Javad Najafzadeh 2011

Biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives

Mohammad Javad Najafzadeh

Biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives

Mohammad Javad Najafzadeh

ISBN 9789070351007 © Mohammad Javad Najafzadeh, 2011 All rights reserved. No part of this thesis may be reproduced or transmitted in any form or by any means without written permission of the author. Cover: Fonsecaea monophora Layout: K.F. Luijsterburg Printed at Ponsen & Looijen bv, Ede, The Netherlands

Biodiversity, pathogenicity, antifungal susceptibility and rapid identification of Fonsecaea and relatives

ACADEMISCH PROEFSCHRIFT ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof. Dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Agnietenkapel op woensdag 14 september 2011, te 10.00 uur door Mohammad Javad Najafzadeh geboren te Mashhad, Iran

Promotiecommissie

Promotores:

Prof. dr. G.S. de Hoog Prof. dr. S.B.J. Menken

Overige leden: Prof. dr. P.H. van Tienderen Prof. dr. M.J. Teixeira de Mattos Prof. dr. G. Haase dr. W. van de Sande dr. J.F.G.M. Meis Faculteit der Natuurwetenschappen, Wiskunde en Informatica.

Contents Chapter 1

General introduction: Fonsecaea and the black yeasts

7

Chapter 2

Genetic diversity and species delimitation in the opportunistic genus Fonsecaea

19

Chapter 3

Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data

33

Chapter 4

Fonsecaea multimorphosa sp. nov, a new opportunistic species of Chaetothyriales isolated from feline cerebral abscess

Chapter 5

Molecular epidemiology of Fonsecaea species

45

63

Chapter 6

Rapid detection of pathogenic fungi using loop-mediated isothermal amplification exemplified by Fonsecaea agents of chromoblastomycosis

77

Chapter 7

Rapid detection and identification of fungal pathogens by rolling circle amplification (RCA) using Fonsecaea as a model

89

Chapter 8

In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea species

99

Chapter 9

Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora 105

Chapter 10

Summary and discussion

111

Dedicated to Maryam and Sadra and my dear parents

Chapter

I General introduction: Fonsecaea and the black yeasts

7

Chapter 1

Fonsecaea and the black yeasts Black yeasts are classically defined as anamorphic fungi potentially able to produce melanized budding cell at least a part of their life cycle. This condition is known in phylogenetically highly diverse fungi, namely in some basidiomycetes and in members of the ascomycete orders Chaetothyriales, Capnodiales and Dothideales (de Hoog et al. 2000). Today, fungi are classified according to their phylogeny. Fonsecaea is a member of the order Chaetothyriales, which also contains the black yeast genus Exophiala. Cladophialophora, Cyphellophora, Fonsecaea, Phialophora and Rhinocladiella are related but do not produce yeast-like cells. The order Chaetothyriales is remarkable in the fungal Kingdom, for two reasons. First, a large number of the infections are observed in individuals without known immune disorder. Of the about 77 species confirmed to belong to the order by sequence data (Barr 1990; Gueidan et al. 2008), about 40 of them have been encountered as etiologic agents of infections in vertebrates (Badali et al. 2008; de Hoog et al. 2000; Zeng et al. 2007). This high percentage of species with an infective potential is only matched by the order Onygenales containing the dermatophytes and classical systemic fungi. Second, the diversity in clinical pictures caused by members of the Chaetothyriales is bewildering. Species of Onygenales are very consistent in their pathology, displaying a similar clinical course by members causing cutaneous or systemic infections, whereas those of Chaetothyriales encompass a wide diversity of diseases, which are nevertheless more or less characteristic within a single species (de Hoog et al. 2000). This pathogenic potential is particularly observed in the more derived parts of the order, comprising the ascomycete family Herpotrichiellaceae (Untereiner 2000). Several other, recurrent ecological trends in the Chaetothyriales are known; one of these is extremotolerance. Many species are found on exposed surfaces, having a competitive advantage at high temperature, dryness (Sterflinger 1998), or low nutrient availability (Satow et al. 2008). Phylogenetic trees published by Lutzoni et al. (2001) and Gueidan et al. (2008) indicate that some deep branches among the pathogenic black yeasts have a shared evolution with rock-inhabiting fungi, suggesting that this life style might be an ancestral condition. A meristematic growth form, morphologically similar to the muriform cells found in tissue of patients with chromoblastomycosis, in nature is expressed under adverse environmental conditions of nutrient depletion, high temperature and dryness. This suggests a functional change in the course of evolution, from an ancestral rock-inhabiting lifestyle to a derived strategy in which ultimately pathogenicity to vertebrate hosts enhances the fitness of species. Human associated black yeast and relatives have been known since the end of the 19th century as a taxonomically quite heterogeneous group, sharing melanized cell walls and the formation of daughter cells by polar budding, but they still are among the most difficult fungal groups to identify and therefore the knowledge of this group is still only fragmentary (de Hoog et al. 2000). The diagnostic confusion in the past is not surprising, since the taxonomy of black yeast is now known to be much more complicated than was anticipated. With the application of molecular methods great number of undescribed species is encountered. Knowledge of natural habitats and evolution is essential for a better understanding of 8

Introduction

Chromoblastomycosis Chromoblastomycosis is one of the most frequent diseases caused by melanized fungi. It concerns a chronic cutaneous and subcutaneous infection, characterized by slowly expanding skin lesions which eventually leads to emerging, cauliflower-like eruptions. The muriform cells are the invasive form of the fungus, provoking a granulomatous immune response at the site of a preceding transcutaneous trauma (Najafzadeh et al. 2009; QueirozTelles et al. 2009). Chromoblastomycosis is found worldwide, but most clinical reports are from tropical and subtropical climates (de Hoog et al. 2007; Najafzadeh et al. 2009). Infection occurs in immunocompetent individuals. To date seven species have been proven as recurrent causative agents of the disease, i.e., Fonsecaea pedrosoi (Lopez Martinez & Mendez Tovar 2007), F. monophora (de Hoog et al. 2004), F. nubica (Najafzadeh et al. 2010), Cladophialophora carrionii (Badali et al. 2008), C. samoensis (Badali et al. 2008), Phialophora verrucosa (Gugnani et al. 1978; Hofmann et al. 2005) and Rhinocladiella aquaspersa (Arango et al. 1998; Marques et al. 2004). Several Exophiala species have been reported as occasional agents of the disease (Padhye et al. 1996; Tomson et al. 2006). The etiologic agents are supposed to gain entrance through the skin by traumatic implantation of contaminated materials. The majority of lesions are observed on extremities of outdoor workers (de Hoog et al. 2007; Queiroz-Telles et al. 2009). Chromoblastomycosis is currently classified into six clinical types: nodular, tumorous, verrucose, cicatricial, plague and lymphatic (Carrion 1950; Queiroz-Telles et al. 2009). In addition, lesions can be graded according to their severity, as mild, moderate or severe (Queiroz-Telles et al. 2009). In advanced cases more than one type of lesion can be observed in the same patient. As yet it is unknown whether these types are associated with specific etiologic agents or are dependent on host responses. Treatment of chromoblastomycosis may be difficult because of the presence of the therapy-refractory muriform cells and because of differential susceptibilities between taxonomically closely related groups (Bonifaz et al. 2001). There is no drug of choice for treatment of the disorder and results may depend on the size and severity of the lesions (Queiroz-Telles et al. 2009), etiologic agent, patient status and clinical localization (Bonifaz et al. 2001). For that reason, in-depth study of the various agents and their virulence is mandatory. 9

Chapter I

pathogenicity and opportunism. Members of different fungal orders and families tend to be differentially involved in human mycoses. Natural habitats are dead plants materials, wood, biofiters, soil polluted with toxic hydrocarbons, rock and inter surface (Badali et al. 2008). For recovery of black yeast like fungi selective isolation methods are required, e.g., the use of high temperature (Sudhadham et al. 2008), a mouse vector (Gezuele et al. 1972), extraction via mineral oil (Vicente et al. 2008) or enrichment on volatile aromatic hydrocarbons (Zhao et al. 2010). The success of the latter method, enabling isolation of black yeasts where direct plating previously had failed, has supported the hypothesis that herpotrichiellaceous black yeasts are potent degraders of aromatic hydrocarbons. Previously, the alkylbenzene enrichment technique has been applied in the biofiltration of air polluted with volatile aromatic compounds (Cox et al. 1997; Kennes and Veiga 2004; Weber et al. 1995).

Chapter 1

Fonsecaea Fonsecaea is defined by absence of budding cells, sympodial conidiogenesis and conidia arranged in short chains. Cladophialophora is different by having very long conidial chains, but some species show intermediate morphology and are difficult to attribute to either one of the genera on morphological groups. A phialidic synanamorph may be produced on nutritionally poor media. Fonsecaea pedrosoi was first isolated in 1913 as an etiological agent of chromoblastomycosis by Pedroso and later described and named by Brumpt (1922) and Negroni (1936). On the basis of ribosomal DNA internal transcribed spacer (ITS) sequence data, two species were recently recognized within the genus, i.e., F. pedrosoi and F. monophora (de Hoog et al. 2004; Xi et al. 2009). Traditionally the genus included a third species, F. compacta (Carrión 1950). This taxon is now known to be one of the morphological mutants occurring in Fonsecaea species, but another, molecular sibling of F. pedrosoi, Fonsecaea nubica, was discovered in the course of our study. We also analyzed a Fonsecaea-like strain reported previously (Shinwari et al. 1985) as Cladophialophora bantiana from the left occipital lobe of the cerebrum of an 18-month-old spayed female cat in Australia (Najafzadeh et al. 2011). The study of biodiversity The first step in any biodiversity study is the establishment of species borderlines. Morphology in the Chaetothyriales is essential for the ecology and survival for the organism, but is often less significant to classify species. Therefore the development of a molecular species concept is necessary. This concept is primarily based on genealogical concordance of several gene trees made for the set of species under investigation. The result is then compared for consistency with other data sets, such as AFLP and morphology. Subsequently the geographic distribution of species is investigated, for which particularly AFLP is suitable. We then wish to develop rapid diagnostic techniques; to this aim we tested LAMP and RCA as novel approaches in species recognition. Sequencing In fungi, species previously diagnosed by morphological species recognition (MSR) frequently appear to be composed of more than one species when applying phylogenetic species recognition (PSR) (Taylor et al. 2000). In PSR, individuals are grouped objectively, but the decision on the exact delimitation of species remains arbitrary. To avoid the subjectivity of determining the limits of a species, Taylor and his coworkers applied multilocus sequence typing to recognize fungal species to establish the principle of GCPSR, genealogical concordance phylogenetic species recognition. The strength of GCPSR lies in a comparison of the congruency between several gene genealogies enabling the detection of recombination events (Taylor & Fisher 2003). Using GCPSR, multilocus sequence typing (MLST) schemes have been developed to investigate species delimitation in human or animal pathogenic fungi. In this thesis distinction of species is determined by morphological and multilocus sequences of the ribosomal internal transcribed spacers (ITS) and partial sequences of the 10

Introduction

AFLP The distribution of species defined by sequencing and phenetic characters can be studied by AFLP (Amplified Fragment Length Polymorphism), a relatively new technique which has a high discriminatory power and high reproducibility that makes it suitable for species identification as well as for strain typing (Savelkoul et al. 1999; Vos et al. 1995). The technique has emerged as a major epidemiological tool with broad application in ecology, population genetics, pathotyping, DNA fingerprinting and quantitative trait loci (QTL) mapping (Mueller & Wolfenbarger 1999). AFLP fingerprinting has been shown to be useful for the molecular characterization of microorganisms with relatively large genomes including various fungal species (Ball et al. 2004; Boekhout et al. 2001; Gupta et al. 2004; Theelen et al. 2001; Warris et al. 2003). The AFLP protocol includes four steps: 1) the digestion of genomic DNA with two restriction endonucleases, 2) the ligation of digested DNA to double-stranded nucleotide adaptors, 3) pre-selective amplification of genomic fragments containing an adaptor at each end, and 4) selective amplification using primers with selective base extensions (Fig. 1). Only those fragments with complementary nucleotides extending beyond the restriction site will be amplified by the selective primers under stringent annealing conditions. This reduces the complexity of the mixture (Groenewald 2009). The number of fragments that will be generated can be modulated by extending the amplification primer(s) at the 3´ site with one or more selective nucleotides. LAMP Loop-mediated Isothermal Amplification (LAMP) is a powerful innovative gene amplification technique for early detection and identification of microbial diseases (Abliz et al. 2008). It was firstly described and initially evaluated for detection of hepatitis B virus DNA (Notomi et al. 2000) and was further developed by Eiken Chemical Co. (http://loopamp.eiken.co.jp). Nucleic acid amplification takes place with high specificity, efficiency and rapidity under isothermal conditions. It is characterized by the use of four specially designed primers that recognize a total of six distinct sequences on the target DNA. An inner primer containing sequences of the sense and anti sense strands of the target DNA initiates LAMP. Strand displacement DNA synthesis is primed by an outer primer releasing single-stranded DNA. This serves as template for DNA synthesis primed by the second inner and outer primers that hybridize to the other end of the target, which produces a stem–loop DNA structure. In subsequent LAMP cycling one inner primer hybridizes to the loop on the product and initiates displacement DNA synthesis, yielding the original stem–loop DNA and a new 11

Chapter I

β-tubulin (BT2), actin (ACT1), and cell division cycle (cdc42) genes. A subsequent step is the identification of strains and their attribution to the species defined above. We used novel methods for detection and identification of isolates such as AFLP, LAMP and RCA.

Chapter 1

stem–loop DNA with a stem twice as long (Notomi et al. 2000; Tomita et al. 2008) (Fig. 2). Amplification and detection of genes can be completed in a single step, by incubating the mixture of samples, primers, DNA polymerase with strand displacement activity and substrates at a constant temperature (about 65°C). It provides high amplification efficiency, with DNA being amplified 109–1010 times in less than an hour. The amplification products can be easily detected by visual assessment of turbidity, electrophoresis or by the naked eye. RCA Rolling circle amplification (RCA) is a sensitive, specific and reproducible isothermal DNA amplification technique for rapid molecular identification of microorganisms, the process discovered in the mid 1990s (Fire & Xu 1995; Liu 1996). RCA-based diagnostics are characterized by good reproducibility, with less amplification errors compared to PCR

Fig. 1. Flowchart of steps required for an AFLP assay (www.biocompare.com).

12

Introduction

Chapter I Fig. 2. Primer design of the LAMP reaction. For ease of explanation, six distinct regions are designated on the target DNA, labeled F3, F2, F1, B1c, B2c and B3 from the 5´ end. As c represents a complementary sequence, the F1c sequence is complementary to the F1 sequence. Two inner primers (FIP and BIP) and outer primers (F3 and B3) are used in the LAMP method. FIP (BIP) is a hybrid primer consisting of the F1c (B1c) sequence and the F2 (B2) sequence. (b) Starting structure producing step. DNA synthesis initiated from FIP proceeds as follows. The F2 region anneals to the F2c region on the target DNA and initiates the elongation. DNA amplification proceeds with BIP in a similar manner. The F3 primer anneals to the F3c region on the target DNA, and strand displacement DNA synthesis takes place. The DNA strand elongated from FIP is replaced and released. The released single strand forms a loop structure at its 3´ end (structure 3). DNA synthesis proceeds with the single-strand DNA as the template, and BIP and B3 primer, in the same manner as described earlier, to generate structure 5, which possesses the loop structure at both ends (dumbbell-like structure). (c) Cycling amplification step. Using selfstructure as the template, self-primed DNA synthesis is initiated from the 3´ end F1 region, and the elongation starts from FIP annealing to the single strand of the F2c region in the loop structure. Passing through several steps, structure 7 is generated, which is complementary to structure 5, and structure 5 is produced from structure 8 in a reaction similar to that which led from structures 5–7. Structures 9 and 10 are produced from structures 6 and 8, respectively, and more elongated structures (11, 12) are also produced. (Nature Protocols 3: 877–882, 2008).

13

Chapter 1

Fig. 3. (A) Typical design of a circularizable padlock probe as exemplified by the Fonsecaea pedrosoi specific (FOP) probe. The probe comprises (i) a 5´-phosphorylated end, (ii) a “backbone” containing binding sites for the RCA primers (RCA primers 1 and 2, respectively; designated by bold uppercase letters) as well as the nonspecific linker regions (designated by bold lowercase letters), and (iii) a 3´end. The 5´ and 3´ ends of the probe are complementary to the 5´and 3´ termini of the target sequence in reverse, in this example to the F. pedrosoi sequence. Abbreviations: 5´-P, 5´-phosphorylated binding arm; 3´, 3´ binding arm. (B) Pictorial representation of the RCA method. Step 1, hybridization. Hybridization of padlock probe, containing targetcomplementary segments, to a target DNA sequence. Step 2, ligation. The probe is circularized by DNA ligase. Step 3, RCA and primer extension I. Ligated probe and binding of RCA primer 1 for RCA. Tandem repeat sequences complementary to the circular probe are generated by RCA. The reverse primer (RCA primer 2) binds to each tandem repeat generated by the rolling circle. Step 4, RCA and primer extension II. As the original RCA strand elongates, further priming events are initiated by primer 2, generating displaced DNA strands. As a result, new priming sites for the first primer (primer 1) are generated. The two primers thus function to generate a self-propagating pattern of DNA fragment release events. Step 5, detection of amplified product. RCA may be monitored using real-time PCR or agarose gel electrophoresis. ssDNA, single-stranded DNA (Zhou et al. 2008; Najafzadeh et al. 2011).

14

Introduction

Antifungal susceptibility testing Much has been written on the emerging incidence of fungal infections during the last decades related to the growing number of patients at risk, such as persons with AIDS, recipients of solid organ or hematopoietic stem cell transplants, persons with hematological malignancies, and other individuals receiving immunosuppressive treatment. Chromoblastomycosis, however, is a disease that occurs in otherwise healthy individuals, and its incidence is related to social conditions of the humans populating endemic area, for example profession, hygiene, and access to medical care. Therefore its incidence is not likely to increase. However, the disease is regionally very common, and difficult to treat due to the therapy-refractory nature of the invasive form, the muriform cell, and the frequent relapses. With growing economic standards a mutilating disease as chromoblastomycosis will no longer be accepted, and we thus have to develop timely, effective and low-cost therapy. With orphan diseases like chromoblastomycosis there is still a long way to go. The problem may be aggravated by the advent of resistance to antifungal agents. Determination of an efficient strategy for treatment of the disease is an important issue in clinical mycology (Clark & Hajjeh 2002; Najafzadeh et al. 2009). Therapy for chromoblastomycosis is challenging because there is no consensus regarding the treatment of choice. Several treatment options have been applied, but these tend to result in protracted disease, low cure rates, and frequent relapses (Bonifaz et al. 2004; Esterre & Queiroz-Telles 2006; Garnica et al. 2009; Queiroz-Telles et al. 2009). The therapeutic outcomes are variable and are allegedly dependent on the site of infection, lesion size, and the patient´s general condition (Bonifaz et al. 2001), and perhaps also on the etiological agent. In order to improve antifungal therapy, we first need to acquire more information on the in vitro antifungal susceptibility of Fonsecaea species against various antifungal agents. These are determined according to the Clinical and Laboratory Standards Institute (CLSI) Reference method for broth dilution antifungal susceptibility testing of filamentous fungi (CLSI 2008). In this method, isolates are cultured on potato dextrose agar (35°C) for up to 7 days, and inocula are prepared by gently scraping the surface of the fungal colonies with sterile cotton swab moistened with sterile physiological saline containing 0.05% Tween 40. Large particles in the cell suspensions were allowed to settle for 3 to 5 min at room temperature, and then the concentration of spores in the supernatant is adjusted spectrophotometrically at 530 nm to a percent transmission in the range 68 to 71, corresponding to 1.5 × 104 to 4 × 104 CFU/ml, as controlled by quantitative colony counts on SGA. Antifungal drugs are obtained as reagentgrade powders and dissolved as prescribed by CLSI; stock solutions are prepared in DMSO

15

Chapter I

(Demidov 2002). The method uses a padlock probe, a circularizable oligonucleotide consisting of two segments complementary to the 3´ and 5´ ends of the target and a linker sequence (Nilsson et al. 1994). When the 3´ and 5´ terminal regions of the oligonucleotide probes are juxtaposed to the sequence of interest, the probe ends can be joined by a DNA ligase to form a circular DNA molecule that can be amplified by RCA (Fig. 3).

Chapter 1

or water. Antimycotics are diluted in RPMI 1640 medium, buffered to pH 7.0 with 0.165 morpholinepropanesulfonic acid and dispensed into 96-well microdilution trays at different concentration ranges (dependent on the drugs used) and stored at –70°C prior to use. After inoculation of conidial suspensions to microdilution trays, they are incubated at 35°C for 72 h. Minimum inhibitory concentrations (MICs) are determined visually by comparison of the growth in the wells containing the drug with the drug-free control. Minimum effective concentrations (MECs) are determined microscopically as the lowest concentration of drug promoting the growth of small, round, compact hyphae relative to the appearance of the filamentous forms seen in the control wells. Aim of the thesis The research presented in this thesis provides taxonomic, morphological and ecological aspects of the genus Fonsecaea. A multilocus DNA sequence data set is established to study the biodiversity and phylogenetic relationship among the Fonsecaea species. A first aim is to redefine taxonomic entities on the basis of molecular data and compare these with classical taxonomy. With newly defined entities, the molecular epidemiology of Fonsecaea species is to be analyzed by AFLP. In addition we aim to develop a sensitive, specific and rapid method for the detection of members of the genus Fonsecaea, in the laboratory as well as on nonsterile adhesive tape widely used for environmental screening. We also describe a rapid and sensitive assay for identification of Fonsecaea species without sequencing using rolling circle amplification (RCA) by designing three specific padlock probes using informative nucleotide polymorphisms in the Fonsecaea ITS database. Additionally we provide the data for appropriate antifungal therapy of chromoblastomycosis that is caused by Fonsecaea. These data will help defining treatment recommendations and establishing guidelines for antifungal therapy. Because of the presence of therapy-refractory muriform cells and differential susceptibilities between taxonomically closely related groups, cure rate is low and there is frequent relapse. In Chapter 9 we report an example with a case of chromoblastomycosis that relapsed after treatment with itraconazole for 4 months. References Ajello L, Hay, R. J., 1988. Topley & Wilson´s microbiology and microbial infections. Volume 4: Medical mycology., 9 ed. Georgina Bentliff. CSLI, 2008 Approved Standard M38-A2 C, Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi. Clinical and Laboratory Standards Institute, Wayne, PA, USA. Arango M, Jaramillo C, Cortes A, Restrepo A, 1998. Auricular chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 36, 43-45. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHG, de Hoog GS, 2008. Biodiversity of the genus Cladophialophora. Stud Mycol 61, 175-191. Ball LM, Bes MA, Theelen B, Boekhout T, Egeler RM, Kuijper EJ, 2004. Significance of amplified fragment length polymorphism in identification and epidemiological examination of Candida species colonization in children undergoing allogeneic stem cell transplantation. J Clin Microbiol 42, 1673-1679. Barr M, 1990. Prodromus to nonlichenized, pyrenomycetous members of class Hymenoascomycetes. Mycotaxon 39, 16

Introduction

17

Chapter I

43-184. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, Dromer F, Meyer W, 2001. Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147, 891-907. Bonifaz A, Carrasco-Gerard E, Saul A, 2001. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 44, 1-7. Bonifaz A, Paredes-Solis V, Saul A, 2004. Treating chromoblastomycosis with systemic antifungals. Expert Opin Pharmacother 5, 247-254. Carrión AL, 1950. Chromoblastomycosis. Ann N Y Acad Sci 50, 1255-1282. Clark TA, Hajjeh RA, 2002. Recent trends in the epidemiology of invasive mycoses. Curr Opin Infect Dis 15, 569-574. Cox HH, Moerman RE, van Baalen S, van Heiningen WN, Doddema HJ, Harder W, 1997. Performance of a styrenedegrading biofilter containing the yeast Exophiala jeanselmei. Biotechnol Bioeng 53, 259-266. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits van den Ende AHG, Queiroz-Telles F, 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 42, 405-416. de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padin-Gonzalez C, Burger E, Badali H, Richard-Yegres N, Gerrits van den Ende AHG, 2007. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol 58, 219-234. de Hoog GS, Guarro J, Gené J, Figueras MJ., 2000. Atlas of clinical fungi, 2nd edn ed. Centraalbureau voor Schimmelcultures, Universitat Rovira i Virgilli., Utrecht. de Hoog GS, Queiroz-Telles F, Haase G, Fernandez-Zeppenfeldt G, Attili Angelis D, Gerrits Gerrits van den Ende AHG, Matos T, Peltroche-Llacsahuanga H, Pizzirani-Kleiner AA, Rainer J, Richard-Yegres N, Vicente V, Yegres F, 2000. Black fungi: clinical and pathogenic approaches. Med Mycol 38 Suppl 1, 243-250. Demidov VV, 2002. Rolling-circle amplification in DNA diagnostics: the power of simplicity. Expert Rev Mol Diagn 2, 542-548. Esterre P, Queiroz-Telles F, 2006. Management of chromoblastomycosis: novel perspectives. Curr Opin Infect Dis 19, 148-152. Fire A, Xu SQ, 1995. Rolling replication of short DNA circles. Proc Natl Acad Sci U S A 92, 4641-4645. Garnica M, Nucci M, Queiroz-Telles F, 2009. Difficult mycoses of the skin: advances in the epidemiology and management of eumycetoma, phaeohyphomycosis and chromoblastomycosis. Curr Opin Infect Dis 22, 559-563. Gezuele E, Mackinnon JE, Conti-Diaz IA, 1972. The frequent isolation of Phialophora verrucosa and Phialophora pedrosoi from natural sources. Sabouraudia 10, 266-273. Gueidan C, Villasenor CR, de Hoog GS, Gorbushina AA, Untereiner WA, Lutzoni F, 2008. A rock-inhabiting ancestor for mutualistic and pathogen-rich fungal lineages. Stud Mycol 61, 111-119. Gugnani HC, Egere JU, Suseelan AV, Okoro AN, Onuigbo WI, 1978. Chromomycosis caused by Philaphora pedrosoi in eastern Nigeria. J Trop Med Hyg 81, 208-210. Gupta AK, Boekhout T, Theelen B, Summerbell R, Batra R, 2004. Identification and typing of Malassezia species by amplified fragment length polymorphism and sequence analyses of the internal transcribed spacer and largesubunit regions of ribosomal DNA. J, Clin Microbiol 42, 4253-4260. Hofmann H, Choi SM, Wilsmann-Theis D, Horré R, de Hoog GS, Bieber T, 2005. Invasive chromoblastomycosis and sinusitis due to Phialophora verrucosa in a child from northern Africa. Mycoses 48, 456-461. Kennes C, Veiga MC, 2004. Fungal biocatalysts in the biofiltration of VOC-polluted air. J Biotechnol 113, 305-319. Liu D, Daubendiek SL, Zillman, MA, Ryan, K, Kool, ET, 1996. Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases. J. Am. Chem. Soc. 118, 1587-1594. Lopez Martinez R, Mendez Tovar LJ, 2007. Chromoblastomycosis. Clin Dermatol 25, 188-194. Lutzoni F, Pagel M, Reeb V, 2001. Major fungal lineages are derived from lichen symbiotic ancestors. Nature 411, 937-940. Marques SG, Pedrozo Silva CM, Resende MA, Andreata LS, Costa JM, 2004. Chromoblastomycosis caused by Rhinocladiella aquaspersa. Med Mycol 42, 261-265. Mueller UG, Wolfenbarger LL, 1999. AFLP genotyping and fingerprinting. Trends Ecol Evol 14, 389-394. Najafzadeh MJ, Falahati M, Pooshanga Bagheri K, Fata A. Fateh R, 2009. Flow cytometry susceptibility testing for conventional antifungal drugs and Comparison with the NCCLS Broth Macrodilution Test. DARU 17, 94-98. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS, 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47, 17-25. Najafzadeh MJ, Sun J, Vicente V, Xi L, Gerrits van den Ende AHG, de Hoog GS, 2010. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48, 800-806. Najafzadeh MJ Vicente V, Sun J, Meis JF, de Hoog GS., 2011. Fonsecaea multimorphosa sp. nov, a new species of Chaetothyriales isolated from feline cerebral abscess. Fungal Biology In press. Nilsson M, Malmgren H, Samiotaki M, Kwiatkowski M, Chowdhary BP, Landegren U, 1994. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science 265, 2085-2088. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T, 2000. Loop-mediated isothermal

amplification of DNA. Nucleic Acids Res 28, E63. Padhye AA, Hampton AA, Hampton MT, Hutton NW, Prevost-Smith E, Davis MS, 1996. Chromoblastomycosis caused by Exophiala spinifera. Clin Infect Dis 22, 331-335. Parida M, Sannarangaiah S, Dash PK, Rao PV, Morita K, 2008. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases. Rev Med Virol 18, 407-421. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A, 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 47, 3-15. Savelkoul PH, Aarts HJ, de Haas J, Dijkshoorn L, Duim B, Otsen M, Rademaker JL, Schouls L, Lenstra JA, 1999. Amplified-fragment length polymorphism analysis: the state of an art. J Clin Microbiol 37, 3083-3091. Shinwari MW, Thomas AD, Orr JS, 1985. Feline cerebral phaeohyphomycosis associated with Cladosporium bantianum. Aust Vet J 62, 383-384. Sterflinger K, 1998. Temperature and NaCl-tolerance of rock-inhabiting meristematic fungi. Antonie Van Leeuwenhoek 74, 271-281. Sudhadham M, Prakitsin S, Sivichai S, Chaiyarat R, Dorrestein GM, Menken SB, de Hoog GS, 2008. The neurotropic black yeast Exophiala dermatitidis has a possible origin in the tropical rain forest. Stud Mycol 61, 145-155. Taylor JW, Fisher MC, 2003. Fungal multilocus sequence typing-it´s not just for bacteria. Curr Opin Microbiol 6, 351-356. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC, 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genet Biol 31, 21-32. Theelen B, Silvestri M, Guého E, van Belkum A, Boekhout T, 2001. Identification and typing of Malassezia yeasts using amplified fragment length polymorphism (AFLP), random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE). FEMS Yeast Res 1, 79-86. Tomita N, Mori Y, Kanda H, Notomi T, 2008. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc 3, 877-882. Tomson N, Abdullah A, Maheshwari MB, 2006. Chromomycosis caused by Exophiala spinifera. Clin Exp Dermatol 31, 239-241. Untereiner W, 2000. Capronia and its anamorphs: exploring the value of morphological and molecular characters in the systematics of the Herpotrichiellaceae. Studies in Mycology 45, 141-149. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Zhao J, PizziraniKleiner A, 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 61, 137-144. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, et al. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23, 4407-4414. Warris A, Klaassen CH, Meis JF, de Ruiter MT, de Valk HA, Abrahamsen TG, Gaustad P, Verweij PE, 2003. Molecular epidemiology of Aspergillus fumigatus isolates recovered from water, air, and patients shows two clusters of genetically distinct strains. J Clin Microbiol 41, 4101-4106. Weber FJ, Hage KC, de Bont JA, 1995. Growth of the fungus Cladosporium sphaerospermum with toluene as the sole carbon and energy source. Appl Environ Microbiol 61, 3562-3566. Xi L, Lu C, Sun J, Li X, Liu H, Zhang J, Xie Z, de Hoog GS, 2009. Chromoblastomycosis caused by a meristematic mutant of Fonsecaea monophora. Med Mycol 47, 77-80. Zeng JS, Sutton DA, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog GS, 2007. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol 45, 3713-3720. Zhao J, Zeng J, de Hoog GS, Attili-Angelis D, Prenafeta-Boldú FX, 2010. Isolation and identification of black yeasts by enrichment on atmospheres of monoaromatic hydrocarbons. Microb Ecol 60, 149-156.

18

Chapter

2

Genetic diversity and species delimitation in the opportunistic genus Fonsecaea

M. J. Najafzadeh1,2,3, C. Gueidan1, H. Badali1,2, A. H. G. Gerrits van den Ende1, Lian Xi4 & G. S. de Hoog1,2* 1 Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands; 3Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran; 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China

*Correspondence: G. S. de Hoog, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Tel.: +31 30 2122 663; fax: +31 30 251 2097; E-mail: de.hoog@cbs. knaw.nl. Published in: Med Mycol. 2009;47 (special issue): 17-25

19

Chapter 2

Abstract Genetic diversity and species delimitation were investigated among 39 isolates recovered from clinical and environmental sources in Central and South America, Africa, East Asia and Europe. All had been morphologically identified as Fonsecaea spp. Molecular analyses were based on sequences of the ribosomal internal transcribed spacers (ITS), β-tubulin (BT2) and actin (ACT1) regions. A phylogenetic approach using haplotype networks was used to evaluate species delimitation and genetic diversity. The presence and the modes of reproductive isolation were tested by measuring the index of differentiation (ID) and the index of association (IA). Based on the sequence data, 39 Fonsecaea strains were classified into three major entities: (i) a group representing Fonsecaea pedrosoi, (ii) a second composed of F. monophora, and (iii) a third group including mostly strains from South America. The two major, clinically relevant Fonsecaea species, F. monophora and F. pedrosoi, also differed in the pathological symptoms found in patients. Moreover, F. pedrosoi is mostly recovered in clinical settings, whereas F. monophora is commonly isolated from the environment. One environmental strain with Fonsecaea-like appearance was shown to belong to a different species, only distantly related to the core-group of Fonsecaea. Keywords: Chromoblastomycosis, Fonsecaea pedrosoi, Fonsecaea monophora, molecular phylogenetics.

Introduction Human chromoblastomycosis is a chronic cutaneous and subcutaneous infection caused by melanized moulds and characterized by verrucose skin lesions which eventually lead to emerging, cauliflower like eruptions that consist of muriform cells. The latter are produced in human skin and represent the supposed pathogenic invasive form of the fungi causing the disease. Chromoblastomycosis is found worldwide, but most clinical reports are from tropical and subtropical climates [1-4]. Proven causative agents include Fonsecaea pedrosoi [5], F. monophora [6-8], Cladophialophora carrionii [5], Phialophora verrucosa [9,10] and Rhinocladiella aquaspersa [11,12]. All these fungi are anamorphs of ascomycetes that belong to the family Herpotrichiellaceae (order Chaetothyriales). Cases of chromoblastomycosis caused by species outside the Chaetothyriales, such as Chaetomium funicola reported from western Panama in Central America [13] and Catenulostroma chromoblastomycosum from Zaire in Africa [14] have to be re-evaluated due to the fact that the characteristic muriform cells and host response with acanthosis were not conclusively established. The current hypothesis of infections caused by Fonsecaea species is that patients suffering from chromoblastomycosis are mainly rural workers that acquire the infection after being pricked by contaminated thorns or wood splinters. Recently, with the development of molecular tools for species identification, doubt has arisen about the correctness of this supposed route of infection [3]. The genus Fonsecaea is currently composed of two species, F. pedrosoi and F. monophora, based on the analysis of the ITS rDNA region. Morphologically, these species are very similar, but their pathology may be somewhat different from each other. F. 20

Genetic diversity and species delimitation in Fonsecaea

Material and methods Fungal strains Strains studied are listed in Table 1, which includes reference strains from the CBS collection as well as fresh isolates recovered from patients and environmental samples. Stock cultures were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24°C. Physiology Cardinal growth temperatures of all strains were determined on 2% MEA. Plates were incubated in the dark for 3 weeks at temperatures ranging at 3°C intervals from 21–36°C. In addition, growth was also recorded at 37°C and at 40°C. DNA extraction Approximately 1 cm2 of 14 to 21-day-old cultures was transferred to a 2 ml Eppendorf tube containing 400 ml TEx buffer (pH 9.0) and glass beads (Sigma G9143). The fungal material was homogenized with MoBio vortex for 1 min. Subsequently 120 ml SDS 10% and 10 ml proteinase K were added and incubated for 30 min at 55°C, the mixture was vortexed for 3 min. After addition of 120 ml of 5M NaCl and 1/10 vol CTAB 10% (cetyltrimethylammoniumbromide) solution, the material was incubated for 60 min at 55°C. 21

Chapter 2

pedrosoi is strictly associated with chromoblastomycosis, while F. monophora may also cause other types of infections [7]. Previously, an additional species was recognized, F. compacta, which was also described as an agent of chromoblastomycosis. This species is now, on the basis of sequence data, regarded to be a dysplastic mutant of F. pedrosoi [7], illustrating the limitations of traditional morphological species recognition (MSR). Biological species recognition (BSR) is widely applied to sexually reproducing organisms, including animals and plants, but cannot be used with Fonsecaea species because they seem to lack a sexual stage. In fungi, species previously diagnosed by MSR frequently appear to be composed of more than one species when applying phylogenetic species recognition (PSR) [15]. In PSR, individuals are grouped objectively, but the decision on the exact delimitation of species remains arbitrary. To avoid the subjectivity of determining the limits of a species, Taylor and his coworkers applied multilocus sequence typing to recognize fungal species to establish the priniciple of GCPSR, genealogical concordance phylogenetic species recognition [15,16]. The strength of GCPSR lies in a comparison of the congruency between several gene genealogies enabling the detection of recombination events [15]. Using GCPSR, multilocus sequence typing (MLST) schemes have been developed to investigate species delimitation in human or animal pathogenic fungi, such as Coccidioides immitis [17,18], Coccidioides posadasii [19], Histoplasma capsulatum [20], Cryptococcus neoformans [21], Candida albicans [22] and Candida glabrata [23], as well as in plant pathogenic fungi such as Fusarium graminearum [24,25] and Mycosphaerella graminicola [26]. In this study, we evaluate the genetic diversity and species delimitation in the genus Fonsecaea on the basis of three loci and temperature tests.

22

dH 11612=FP77II

dH 16142

102247

659.76 *

SUMS0322

dH 15663

SUMS0324

273,66

SUMS0300

dH 16157

dH 15828

397,48

670,66

dH 15691

289,93

dH 15523

dH 13130=UTHSC-R3486

117238

dH 11610=FP63I

dH 14523=Marty 2005226

117542

201,31

dH 15330=UTHSC 04-2904

117236

102245

dH 11613

102248

dH 15665

dH 11606=FP26III

102242

274,66

dH 12978

115830

dH 16159

dH 12659= Bonifaz 150-89

269,37

671,66

EU285268, EU938558, EU938612

dH 11602=1PLE

102238

dH 15659

EU285270, EU938557, EU938611

dH 11590=8DPIRA

102229

271,37

EU285273, EU938556, EU938610

dH 15331=UTHSC 04-2631

117237

(A) F. pedrosoi

EU938585, EU938555, EU938609

dH 11611

102246

AY366920, EU938567, EU938621

AY366919, EU938566, EU938620

AY366916, EU938565, EU938619

EU938588, EU938564, EU938618

AY366913, EU938563, EU938617

AY366918, EU938562, EU938616

EU938587, EU938561, EU938615

EU938586, EU938560, EU938614

AY366914, EU938559, EU938613

AY366925, EU938554, EU938608

AB240949, EU938553, EU938607

EU938584, EU938552, EU938606

AB240948, EU938551, EU938605

AY366926, EU938550, EU938604

EU938583, EU938549, EU938603

EU938582, EU938548, EU938602

AY366906, EU938547, EU938601

AY366927, EU938546, EU938600

EU938581, EU938545, EU938599

EU938580, EU938544, EU938598

AY366928, EU938543, EU938597

EU938579, EU938542, EU938596

ITS, BT2, ACT1

dH 11607=FP31I

102243

(B) F. monophora

GenBank

CBS number

Name

Other reference(s)

Chromoblastomycosis

Chromoblastomycosis

Mouse passage

Mouse passage

Auditory canal

Chromoblastomycosis

Mouse passage

Mouse passage

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Lymphnode, aspiration-biopsy

Brain

Brain, biopsy

Brain abscess

Chromoblastomycosis

Chromoblastomycosis

Brain

Chromoblastomycosis

Soil

Decaying vegetable cover

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Source

Table 1. Isolate and GenBank numbers and specimen information for the Fonsecaea strains investigated.

Human

Human

Soil

Soil

gazelle

Human

Soil

Soil

Human

Human

Human

Human

Man

Seabear

Human

Human

Human

Human

Human

Human

Human

Soil

Plant

Human

Human

Human

Host

Argentina

Brazil

Venezuela

Venezuela

Libiya

Brazil

Venezuela

Venezuela

South America

China (Shanghai)

China (Shanghai)

China (Nanjing)

South America

Netherlands (zoo)

UK

USA

USA

Brazil

Brazil

Brazil

South America

Brazil

Brazil

USA

Brazil

Brazil

Geography

Chapter 2

23

Cladophialophora

(C) F. species

Name

dH 15549

dH 15773

212.77 *

342,34

dH 11584

102224

306,94

556,83

Outgroup

173,52

dH 16013=ATCC 52853

dH 11601

ATCC 18658=IMI 134458

271,33

102237

ATCC 28174

dH 15668

557,76

277,29

dH 15886

dH 15680

285.47 *

444,62

dH 18430=Bonifaz 002200

122740

dH 15656

dH 15620

253,49

269,64

dH 18431=Bonifaz 02300

122741

dH 14477=UNEFM-0002-04

Other reference(s)

CBS number

AY251087

AY366929

EU938595

AB114127, EU938578, EU938632

EU938594, EU938577, EU938631

EU938593, EU938576, EU938630

AY366931, EU938575, EU938629

EU938592, EU938574, EU938628

EU938591, EU938573, EU938627

EU938590, EU938572, EU938626

AY366921, EU938571, EU938625

EU938589, EU938570, EU938624

AY366915, EU938569, EU938623

AY366912, EU938568, EU938622

ITS, BT2, ACT1

GenBank

Tracheal abscess

Decaying wood

Brain abscess

Decaying cover vegetable

Wood, Grevillea

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis, foot

Chromoblastomycosis

Chromoblastomycosis, foot

Chromoblastomycosis, hand

Chromoblastomycosis

Chromoblastomycosis

Source

Human

Plant

Human

Plant

Plant

Human

Human

Unknown

Human

Human

Human

Human

Human

Human

Human

Human

Human

Host

Germany

Japan

USA

Brazil

Brazil

South America

Brazil

Unknown

Surinam

Cameroon

Puerto Rico

Mexico

Uruguay

Mexico

Venezuela

Puerto Rico

Netherlands

Geography

Chapter 2

Table 1. (Continued)

Genetic diversity and species delimitation in Fonsecaea

Chapter 2

Then the mixture was vortexed for 3 min. Subsequently 700 ml SEVAG (24:1, chloroform: isoamylalcohol) was mixed carefully by hand and centrifuged for 5 min at 4°C at 20400 g force value. The supernatant was transferred to a new Eppendorf tube with 225 ml 5 M NH4acetate, mixed carefully by inverting, incubated for 30 min on ice water, and centrifuged again for 5 min at 4°C at 20400 g force value. The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20400 g force value. Finally, the pellet was washed with 1000 mL ice cold 70% ethanol. After drying at room temperature, it was re-suspended in 100 mL TE buffer (Tris 0.12% w/v, Na-EDTA 0.04% w/v). For some strains, DNA was prepared with Ultra CleanTM Microbial DNA Isolation Kit (MoBio Laboratories). DNA amplification and sequencing Three gene regions were chosen for the multilocus sequence typing, i.e., rDNA Internal Transcribed Spacers (ITS), partial genes and introns of actin (ACT1) and ß-tubulin (BT2) genes (primers are listed in Table 2). PCR was performed in a 25 ml volume of a reaction mixture containing 7 ml GoTaq Green master mix (Promega) containing dNTPs, MgCl2, reaction buffer, 1 ml of each primer (10 pmol) and 1 ml rDNA. If no amplicons were obtained, other primer combinations were tried. Amplification was performed in an ABI PRISM 2720 (Applied Biosystems, Foster City, USA) thermocycler as follows: 95°C for 4 min, followed by 35 cycles consisting of 95°C for 45 sec, 52°C for 30 sec and 72°C for 2 min, and a delay at 72°C for 7 min. Annealing temperature was changed to 58°C for the BT2 gene. Amplicons were cleaned with GFX PCR DNA and Gel Band Purification kit (GE Healthcare, Buckinghamshire, U.K.). Concentrations of amplicons were estimated on gel, photographed and analyzed by the Gel Doc XR system (Biorad), with SmartLadder (Eurogentec, Seraing, Belgium) as size and concentration marker. Amplicons were then subjected to direct sequencing using ABI prism BigDyeTM terminator cycle sequencing kit (Applied Biosystems, Foster City, USA) and analysed on an ABI Prism 3730XL Sequencer. Alignment and phylogenetic reconstruction Sequences were edited using Seq Man II in the Lasergene software (DNASTAR, Wisconsin, USA). Iterative alignment was performed by hand with MacClade 4.01. A phylogenetic Table 2. List of the various primers used for amplification and sequencing. locus

Primer

Primer sequence (5´->3´)

ITS

ITS1

TCCGTAGGTGAACCTGCGG

[27]

ITS4

TCCTCCGCTTATTGATATGC

[27]

BT2

ACT1

Reference

ITS5

GGAAGTAAAAGTCGTAACAAGG

[27]

V9G

TTACGTCCCTGCCCTTTGTA

[28]

LS266

GCATTCCCAAACAACTCGACTC

[29]

BT-2a

GGTAACCAAATCGGTGCTGCTT

[30]

T2

TAGTGACCCTTGGCCCAGTTG

[31]

Esp ACT fw

CACGTTGTCCCCATCTAC

[32]

Esp ACT bw

ATGAAGGTCAAGATTATC (T) GC

[32]

24

Genetic diversity and species delimitation in Fonsecaea

Results Physiology Cardinal growth temperatures of voucher strains showed optimal development at 27-33°C (Fig. 1), while growth was observed in the entire range between 21-37°C. The maximum

Fig. 1 Colony diameters at various temperatures with 38C increments ranging from 21- 40°C, measured after 3 weeks on 2% MEA were calculated for Fonsecaea pedrosoi, F. monophora and Fonsecaea spp.

25

Chapter 2

approach was used to investigate relationships among the 39 strains of Fonsecaea and two related species of Cladophialophora (C. bantiana and C. immunda). For this approach, the three genes ITS, BT2 and ACT1 were first analyzed separately. Conflicts were estimated using the partition homogeneity test [33] and by comparing topologies. As the three gene partitions were congruent (no supported conflicts), they were combined and analyzed using maximum parsimony (MP) as implemented in PAUP* v.4.0b10 [33]. A tree search of 100 random addition sequences (RAS) and a bootstrap analysis of 1000 replicates and two RAS were conducted after assessing congruence between the three genes. Two species of Cladophialophora (C. arxii and C. minourae) were chosen as members of an outgroup. Haplotype networks were also reconstructed for each gene in order to assess genetic variation within Fonsecaea. The networks were obtained using MP (tree search and bootstrap analysis as described above), and drawn by hand in PowerPoint. To detect recombination in each population, the index of association (IA, measure of multilocus linkage disequilibrium) was calculated with Multilocus 1.2.2 (http://www.bio.ic.ac.uk). The null hypothesis for this analysis is complete panmixia (rejected when P70 are shown at the branches in bold). CBS 306.94 was taken as outgroup (A = F. pedrosoi, B = F. monophora, C = F. nubica).

39

Chapter 3

(bootstrap = 99% and 100%, respectively), F. monophora with ITS, cdc42 and ACT1 (bootstrap = 78%, 91% and 75.5%, respectively) and for F. nubica with cdc42 and BT2(bootstrap = 86% and 74%, respectively). Partition-homogeneity test with heuristic search of four genes with 100 replicates and 167 parsimony-informative characters of 2254 total characters revealed conflict (significant heterogeneity) among the four genes ( P = 0.01). The trees (ITS, cdc42, BT2 and ACT1 ) were therefore not combined and are shown separately in Fig. 1. The isolates grouped into three major clades (Fig. 1) are as follows; group A representing F. pedrosoi, group B representing F. monophora, and an unnamed group C. Some variable sites supported a relationship A/B, while others supported A/C. Synapomorphy study showed that group C had 23 unique positions in the four genes investigated. Standardized index of association showed that the groups did not recombine (IAS = 0.3397, P < 0.01). When the four loci were analyzed for the three groups separately, the phylogenetic structure proved to be robust, but the index of association (IAS ) to establish the degree of clonality could not be applied because of the small sample size of each population. An AFLP analysis of the same strains of Fonsecaea as

Chapter 3

Fig. 3. Colony diameters at various temperatures with 3°C increments ranging from 21 to 40°C, measured after 3 weeks on 2% MEA were calculated for F. nubica strains.

Fig. 2. Clustering of AFLP banding pattern of isolates of Fonsecaea by unweighted pair group method with arithmetic means (UPGMA). (A = F. pedrosoi, B = F. monophora, C = F. nubica).

noted above showed a division into three main groups that were congruent with groups A, B and C above in that A and B represented F. pedrosoi and F. monophora, respectively, and group C was the unnamed group (Fig. 2). Cardinal growth temperatures of F. nubica voucher strains showed optimal development at 27−33°C (Fig. 3), while growth was observed over the entire range between 21 – 37°C. The maximum growth temperature of all strains analyzed was found to be 37°C, with no growth observed at 40°C. Strains analyzed and attributed to either groups A, B or C (CBS data, n =103) showed differential predilection to the mammal host. Strains of groups A (n = 46) and C (n= 14) were mainly isolated from humans, occasionally from warm-blooded animals (n = 1), or from the environment using a rodent bait (n= 4). Isolates from the environment in the Americas using direct isolation oil flotation technique according to Satow et al . [23], yielded F. monophora (n = 4) more often than F. pedrosoi, while, in contrast F. pedrosoi was significantly more frequently isolated from chromoblastomycosis [11]. Given the consistent separation of cluster C, and its distance to A and B, we propose to recognize it as a new species with the following description: Fonsecaea nubica Najafzadeh, Sun, Vicente, Gerrits van den Ende & de Hoog, sp. nov . Figs 4 and 5. Mycobank MB 515151 - CBS 269.64. Etym.: named after the dull appearance of lesions on the body. Coloniae fere lente crescentes, olivaceo-brunneum, reversum olivaceo-nigrum. Cellulae gemmantes absentes. Hyphae leves, hyalinae vel pallide brunneae, 2.0–2.5 μm latae, 10–25 μm septata. Conidiophora semi-macronemata, septata, lateralia vel terminalia; stipites et ramoconidia denticulata. Conidia holoblastica, dilute olivacea, late clavata, unicellularia, levia, catenas brevias ramosas cohaerentes formantia, cicatricibus dilute brunneis, 3–4 × 2–3 μm. 40

Fonsecaea nubica sp. nov.

Phialidae absentes. Synanamorphe non vista. Chlamydosporae absentes. Teleomorphosis ignota. Temperatura maxima 370C. Holotypus: CBS-H 20321 in herbariorum CBS. Colonies on PDA at 30 0C, slowly growing, flat to heaped, velvety to downy, olivaceous

Chapter 3 Fig. 4. Macroscopic and microscopic morphology of Fonsecaea nubica (A, B, F, G, H and I) Type strain CBS 269.64, (C and D) CBS 125198, (E) CBS 444.62. Scale bar = 10 µm.

41

Chapter 3

Fig. 5. Line drawing of microscopic morphology of Fonsecaea nubica, strain CBS 125198, slide culture on MEA after 14 days.

brown; reverse olivaceous black. Germinating cells absent. Hyphae smooth-walled, pale olivaceous brown, 2.0–2.5 μm wide, regularly septate every 10–25 μm. Conidiophores slightly differentiated, olivaceous brown, branched or unbranched, terminal or intercalary; conidiogenous cells pale olivaceous with prominent denticles and dark scars. Conidia pale olivaceous, broadly clavate, in short chains containing 1–3(−4) conidia, with brown scars, about 3–4 × 2–3 μm. Phialides absent. Chlamydospores absent. Teleomorph unknown. Optimal growth at 27–330C, scant growth at 37 0C, no growth at 400C. Holotype: dried culture in CBS-H 20321; ex-type strain CBS 269.64. Discussion In the present study we document the existence of an undescribed species of Fonsecaea, based on AFLP profiles and on sequences of ITS, cdc42, BT2 and ACT1 genes. Morphologically the genus Fonsecaea is defined by poorly differentiated, melanized conidiophores with clusters of cylindrical denticles bearing initially non-catenate conidia that eventually produce 1–2 smaller conidia [7]. In all partitions analyzed, Fonsecaea contained the following three major clades, which were supported by high bootstrap values (Fig. 1): group A, which contains the ex-type strain of F. pedrosoi, group B, which contains the ex-type strain of F. monophora, and group C, which did not include any type strain and was introduced as a new species of Fonsecaea, F. nubica. Based on standardized index of association (IAs), no recombination was detected between the three inferred groups and hence they were interpreted to be individual species. Teleomorphs are unknown in the Fonsecaea clade. Morphological distinction of Fonsecaea species is difficult, but their separation on the basis of multilocus data is unambiguous. Groups A–C were recognized in four genes, and also in AFLP patterns 42

Fonsecaea nubica sp. nov.

Acknowledgements We thank S. B. J. Menken for useful suggestions. We also thank A. Bonifaz for providing some isolates. The work of Mohammad Javad Najafzadeh was financially supported by the Ministry of Health and Medical Education of Iran and faculty of medicine, Mashhad University of medical sciences, Mashhad, Iran and the work of Vania A. Vicente was supported by Brazilian Government fellowship from Coordenação de Pessoal de Nível Superior (CAPES). Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. 43

Chapter 3

[unpublished data]. Clinically their distinction is relevant, since the species differ in pathology and virulence, despite absence of differences in the temperature relations between F. nubica and the remaining species (our data and those of Najafzadeh et al. [3]). Fonsecaea pedrosoi and F. nubica thus far are strictly associated with chromoblastomycosis, whereas F. monophora, in addition to causing chromoblastomycosis, also affects other organs such as brain, bile and cervical lymph nodes [2, 24–26]. Out of 103 Fonsecaea strains available in the CBS culture collection and confirmed by sequencing, all clinical isolates of F. pedrosoi and F. nubica originated from chromoblastomycosis. However, 81.4% of F. monophora isolates came from chromoblastomycosis, while 9.3% were involved in brain infection and 9.3% were isolated from the environment without the use of a mammal bait. Environmental strains, when isolated without mammal bait, were more often F. monophora . Geographical distribution patterns also differ between species with 47.8% of F. pedrosoi originating from Central America, 47.8% from South America and 4.3% from other countries. In contrast, 27.9% of the isolates of F. monophora came from South America, 58.1% from China and 13.9% from other countries. Finally, 21.4% of the strains of F. nubica originated from South America, 57.1% from China and 21.4% from other countries. The origins of some strains (e.g., CBS 212.77 from the Netherlands, CBS 117236 from the USA and CBS 270.37 from France) are doubtful, as patients might have been infected while traveling abroad. Fonsecaea pedrosoi has never been proven to occur in China and is prevalent in Central and South America. Efforts to isolate environmental strains by direct methods (i.e., without rodent vector) have mainly been performed in South America [23,27]. Strains isolated (n = 4) were more often F. monophora or hitherto undescribed sibling Fonsecaea- or Cladophialophora-like species [19,23], rather than F. pedrosoi which is significantly more frequently isolated from humans in the same region. This result does not match with expectations on the basis of the ratio of environmental/clinical strains (1/21.5; Table 1 and supplementary data from CBS collection). Chromoblastomycosis may be caused by traumatic inoculation of fungi from the environment, but not all species are equally efficient in causing disease. Similar differences in virulence and predilection were noted elsewhere in Chaetothyriales, e.g., in Cladophialophora [15] and Exophiala [28].

References 1. Ajello L, Hay, R. J. Agent of chromoblastomycosis and sporotrichosis. In: Topley & Wilson´s microbiology and microbial infections, Vol 4 Medical Mycology. Ninth edn. New York; Georgina Bentliff, 1988: 315-336 2. de Hoog GS, Attili-Angelis D, Vicente VA, et al. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42(5): 405-16. 3. Najafzadeh MJ, Gueidan C, Badali H, et al. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 2009; 47(1): 17-25. 4. Carrión A. Preliminary report on a new clinical type of the disease caused by Hormodendrum compactum, nov. sp. Puerto Rico J Publ Health Trop Med 1935; 10: 543-5. 5. Xi L, Sun J, Lu C, et al. Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol 2009; 47(1): 27-33. 6. Xi L, Lu C, Sun J, et al. Chromoblastomycosis caused by a meristematic mutant of Fonsecaea monophora. Med Mycol 2009; 47(1): 77-80. 7. de Hoog GS, Guarro J, Gené J, Figueras MJ. Atlas of Clinical Fungi, 2nd edn. Centraalbureau voor Schimmelcultures/Universitat Rovira i Virgili, Utrecht/Reus; 2000. 8. Badali H, Najafzadeh MJ, Van Esbroeck M, et al. The clinical spectrum of Exophiala jeanselmei, with a case report and in vitro antifungal susceptibility of the species. Med Mycol 2009. Med Mycol 2010; 48(2):318-27 9. Badali H, Gueidan C, Najafzadeh MJ, et al. Biodiversity of the genus Cladophialophora. Stud Mycol 2008; 61: 175-91. 10. Lopez Martinez R, Mendez Tovar LJ. Chromoblastomycosis. Clin Dermatol 2007; 25(2): 188-94. 11. Queiroz-Telles F, Esterre P, Perez-Blanco M, et al. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 2009; 47(1): 3-15. 12. Kawasaki M, Aoki M, Ishizaki H, et al. Molecular epidemiology of Fonsecaea pedrosoi using mitochondrial DNA analysis. Med Mycol 1999; 37(6): 435-40. 13. Tanabe H, Kawasaki M, Mochizuki T, et al. Species identification and strain typing of Fonsecaea pedrosoi using ribosomal RNA gene internal transcribed spacer regions. Nippon Ishinkin Gakkai Zasshi 2004; 45(2): 105-12. 14. Bonifaz A, Carrasco-Gerard E, Saul A. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 2001; 44(1-2): 1-7. 15. de Hoog GS, Nishikaku AS, Fernández-Zeppenfeldt G, et al. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol 2007; 58: 219-34. 16. de Hoog GS, Göttlich E, Platas G, et al. Evolution, taxonomy and ecology of the genus Thelebolus in Antarctica. Stud Mycol 2005; 51: 33-76. 17. de Hoog GS, Gerrits Gerrits van den Ende AHG. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 1998; 41(5-6): 183-9. 18. Masclaux F, Guého E, de Hoog GS, Christen R. Phylogenetic relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J Med Vet Mycol 1995; 33(5): 327-38. 19. Farris JS, Källersjö M, Kluge AG, Bult C. Testing the significance of incongruence. Cladistics 1994; 10: 315-319. 20. Swofford D. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods) v 4.Ob10. Sunderlan MA, U.S.A.; Sinauer Associates, 2002. 21. Tamura K, Dudley J, Nei M, et al. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24(8): 1596-9. 22. Hillis DM, Bull JJ. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. System Biol 1993; 42: 182-192. 23. Satow MM, Attili-Angelis D, de Hoog GS, et al. Selective factors involved in oil flotation isolation of black yeasts from the environment. Stud Mycol 2008; 61: 157-63. 24. Najafzadeh MJ, Rezusta A, Cameo MI, et al. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol 2009. Med Mycol 2010; 48(2):39-3 25. Surash S, Tyagi A, de Hoog GS, et al. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2005; 43(5): 465-72. 26. Yaguchi T, Tanaka R, Nishimura K, et al. Molecular phylogenetics of strains morphologically identified as Fonsecaea pedrosoi from clinical specimens. Mycoses 2007; 50(4): 255-60. 27. Vicente VA, Attili-Angelis D, Pie MR, et al. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 2008; 61: 137- 144. 28. Sudhadham M, de Hoog GS, Menken SBJ, et al. Rapid screening for genotypes as possible markers of virulence in the neurotropic black yeast Exophiala dermatitidis using PCR-RFLP. J Microbiol Meth 2010; 80(2);138-42.

44

Chapter

4

Fonsecaea multimorphosa sp. nov, a new opportunistic species of Chaetothyriales isolated from a feline cerebral abscess

M. J. Najafzadeh1,2,3, V. A. Vicente4, J. Sun5, J. F. Meis6 & G. S. de Hoog1,2,7* CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil, 5Department of Dermatology, The Second Affiliated Hospital, Sun YatSen University, Guangzhou, Guangdong, China, 6Department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen, The Netherlands, 7Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China. 1

*Correspondence: G. S. de Hoog, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Tel.: +31 30 2122 663; fax: +31 30 251 2097; E-mail: de.hoog@cbs. knaw.nl. In press in: Fungal biology (2011)

45

Chapter 4

Abstract A novel fungal species is described originating from the left occipital lobe of the cerebrum of an 18-month-old spayed female cat in Australia. Neurological disorder of the animal became apparent by circling movements and uncoordinated behavior. Sequencing of the SSU rRNA gene reveals this strain as belonging to the genus Fonsecaea in Chaetothyriales. This orders includes many black yeasts and relatives known as etiologic agents of disease in humans and animals, including several neurotropic species. Novelty of the species was corroborated by morphology and by multilocus sequencing of the ribosomal internal transcribed spacers (ITS) and partial sequences of the β-tubulin (BT2) and elongation factor (TEF1) genes. The strain is very similar to several strains recovered by a selective isolation technique from the natural environment in Brazil. Key words: neurotropic fungi, black yeasts, feline infection

Introduction Central nervous system infection by filamentous fungi is a very rare condition in humans and animals, but attention is growing because of its high mortality and a poor prognosis (Dixon et al. 1989; Li & de Hoog 2009; Horré& de Hoog 1999; Revankar et al. 2004). If the infection occurs in an otherwise apparently healthy individual, mostly a member of the ascomycete order Chaetothyriales is concerned; this order comprises the black yeasts and relatives (de Hoog et al. 2000). The dark pigmentation in hyphal elements in tissue results from the melanin in the cell wall; this compound offers protection against oxygenic action of phagocytes and is therefore regarded as one of the factors responsible for virulence and pathogenic potential in these fungi (Revankar et al. 2004). The main neurotropic agents in the Chaetothyriales are Cladophialophora bantiana (Abramo et al. 2002; Elies et al. 2003), Exophiala dermatitidis (Chang et al. 2000), Rhinocladiella mackenziei (Al-Abdely et al. 2000; Campbell et al. 1993; Sutton et al. 1998) and Fonsecaea monophora (Surash et al. 2005). The great majority of these cases were reported from humans, while reports from other mammals are extremely rare. In contrast, Ochroconis gallopava, a neurotrope with unknown phylogenetic affiliation, is nearly exclusively found in warm-blooded animals such as birds, poultry, dogs and cats, while the rare human cases by this species are limited to patients with severe underlying disease (Blalock et al. 1973; Shoham et al. 2008; Singh et al. 2006; Wong et al. 2010). Cerebral phaeohyphomycosis by black yeast-like fungi ultimately may lead to black, necrotic brain tissue, pus and sometimes black cerebrospinal fluid with numerous olive-brown, septate fungal hyphae (Li & de Hoog 2009). The exact origin of the disorder is unknown; it has been supposed that pathogens may gain access to the brain via the bloodstream or lymphatic fluid. First symptoms of the disease are therefore of neurological nature, and for this reason Horré & de Hoog (1999) described this disease as ‘primary cerebral abscess´. Secondary cerebral infections are mostly caused by members of Pleosporales comprising

46

Fonsecaea multimorphosa sp. nov

agents of brain infections which extend from a pre-existing, chronic sinusitis. The genus Fonsecaea presently contains three species, which all are potential etiologic agents of human chromoblastomycosis (Najafzadeh et al. 2009, 2010b). Fonsecaea monophora is a recurrent agent of cerebritis, with five cases reported to data (Koo et al. 2010; Najafzadeh et al. 2009, 2010b; Surash et al. 2005; Takei et al. 2007). In the present study we describe a fungus from a feline brain infection, which was reported more than 25 years ago as Cladophialophora bantiana (Shinwari et al. 1985). The strain had been deposited in the CBS culture collection as CBS 980.96. On the basis of multilocus sequence data it was concluded that a novel species was concerned, phylogenetically close to Fonsecaea. Several environmental strains from soil and rotten wood in Brazil, isolated in the framework of a search for the natural habitat of Fonsecaea pedrosoi, proved to be genetically similar. The feline strain is introduced here as a novel species, and compared with environmental and clinical Fonsecaea-like isolates.

Fungal strains Strains used in this study comprised 63 reference isolates from the Centraalbureau voor Schimmelcultures (CBS) Fungal Biodiversity Centre, Utrecht, The Netherlands (Table 1). Stock cultures were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24°C. For morphological studies, MEA and potato dextrose agar (PDA) slide cultures were prepared and mounted in aniline blue. Environmental strains were isolated from plant debris, and decaying wood and soil samples in southern Brazil. Approximately 20 g from each sample were processed for fungal isolation, with 10 replicates per sample. Each sample was incubated at room temperature for 30 min in 100 mL sterile saline solution containing 200 U penicillin, 200 µg/L streptomycin, 200 µg/L chloramphenicol and 500 µg/L cycloheximide. After initial incubation, 20 mL sterile mineral oil was added to the solution, followed by vigorous 5 min shaking and the flasks were left to settle for 20 min. The oil-water interphase was carefully collected, inoculated onto Mycosel agar (Difco) and incubated for 4 wks at 36°C (Dixon et al. 1980; Vicente et al. 2008). The dark colonies appearing on the plates were isolated on Mycosel agar. Physiology Cardinal growth temperatures of test strains (CBS 980.96, CBS 102240, CBS 102224, CBS 102235, CBS 102253 and CBS126716) were determined on 2% MEA plates that were incubated in the dark for 3 weeks at temperatures of 9–36°C at intervals of 3°C. In addition, growth was recorded at 37°C and at 40°C. DNA extraction DNA extraction and quality tests were performed using glass beads (Sigma G9143) according to protocols described previously (Najafzadeh et al. 2009).

47

Chapter 4

Material and methods

CBS

115144

114772

112222

112793

603,96

609,96

618,96

….

834.96 (T)

123977

109797

119710

120419

120418

147.84 (T)

118724

102228

109630

306.94 (T)

102461

556,83

987,96

444,62

125191

269.64 (T)

Name

Cladophialophora potulentorum

Cladophialophora potulentorum

Cladophialophora potulentorum

Cladophialophora australiensis

Capronia pilosella

capronia pulcherrima

Capronia acutiseta

Capronia acutiseta

Cladophialophora immunda

Cladophialophora immunda

Cladophialophora immunda

Cladophialophora devriesii

Cladophialophora devriesii

Cladophialophora devriesii

48

Cladophialophora devriesii

Cladophialophora saturnica

Cladophialophora saturnica

Cladophialophora saturnica

Cladophialophora arxii

Cladophialophora arxii

Cladophialophora minourae

Cladophialophora minourae

Fonsecaea nubica

Fonsecaea nubica

Fonsecaea nubica

dH 15656

dH20423

dH 15886

IFM 4701 = UAMH 5022

ATCC 52853; IMI 298056

dH 11524, CDC B-5887

…

dH 12335 = IHM 1733

dH 11589

dH 12939

ATCC 56280 = CDC 82-030890

dH 17406

dH 17407

dH 16818

dH 11474

….

CDC B-5680 = CBS H-20115

ATCC 56428

ATCC 76482 = G.J.S. 74-59 = WUC 94

WUC 64

dH16062 = DAOM 208453= WUC 29

FRR 3318 = CPC 1377

CPC 1376 = FRR 4946

CPC 1375 = FRR 4947

CPC 11048 = FRR3318

Other references

EU938592, …, EU938574

AY366931, …, EU938575

EU103988, EU140599

AY251087, EU140598

EU103986, EU140593

FJ385270

EU103984, EU140602

EU103985, EU140595

AF050241

EU035402

EU035409

EU035410

DQ008141

Gene Bank ITS, TEF1a, BT2

Table 1. Isolate and Genbank numbers and species information for the strains investigated.

Chromoblastomycosis

Chromoblastomycosis

Chromoblastomycosis

Rotting wood

Decaying wood

Brain abscess

Tracheal abscess

Neotandia membranacea, trunk, recently cut tree

Vegetable cover/soil

Skin

Mycotic granuloma

Crab

Crab

Crab

Gasstation

Sub cutaneous phaeohyphomycosis

Sub cutaneous ulcer

Unknown

Dacrydium cupressinum wood

Vitis (Vitaceae), fruit

Eutypa, stroma

Sports drink

Sports drink

Sports drink

Apple juice

Source

Human

Human

Human

Human

Human

Human

Human

Animal

Animal

Animal

Human

Host

Cameroon

China

Suriname

Japan

Japan

USA

Germany

Uruguay

Brazil

Brazil

USA

Brazil

Brazil

Brazil

Germany

unknown

USA

Unknown

New Zealand

Canada

Canada,

Australia

Australia

Australia

Australia

Geography

Chapter 4

49

CBS

271.37 (T)

102245

117236

100430

115830

117542

117238

269.37 (T)

102225

640.96 (T)

…

979,96

102594

173.52(T)

984,96

981,96

328,65

364,8

648,96

564,82

649,96

444,96

155,53

119719

102586

678,79

Name

Fonsecaea pedrosoi

Fonsecaea pedrosoi

Fonsecaea monophora

Fonsecaea monophora

Fonsecaea monophora

Fonsecaea monophora

Fonsecaea monophora

Fonsecaea monophora

Fonsecaea monophora

Cladophialophora emmonsii

Cladophialophora emmonsii

Cladophialophora emmonsii

Cladophialophora emmonsii

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

CDC B-3658 = UAMH 4992

dH 11331

dH 14515

CDC B-3393

….

W 262

ATCC 46715= NIH 4018

UAMH 3830

Ajello B-2283b

CDC B-3394

UAMH 6501= PLM 1951

J-1872

ATCC 10958= CDC B-1940

dH 11918 = CDC B-5420

dH16329

dH 13029 = UTHSC 03-70

dH 11585

dH 12659

dH 13130, UTHSC R-3486

dH 14523 = Marty 2005226

dH 12978 =

dH 15137

dH 15330 = UTHSC 04-2904

dH11610 = FP63I

dH 15659

Other references

EU103992, U140592

EU103994, EU140591

EU103993, EU140587

EU103989, U140585

EU103996, EU140583

AY857518, EU140582

EU103995, EU140584

AY366906, …, EU938547

AB240949, …, EU938553

EU938584, …, EU938552

EU938582, …, EU938548

AB240948, …, EU938551

AY366918, …, EU938562

AY366914, …, EU938559

Gene Bank ITS, TEF1a, BT2

Barbados

Dog Human Human Dog Human Human Human Cat

Liver Brain abscess lesion on leg Disseminated infection Brain abscess Skin infection Brain abscess Skin lesion in cat

USA

Brazil

Thailand

Belgium

South Africa

South Africa

USA

USA

Cat

Netherlands

South Africa

Brain abscess

Brain abscess

USA

Canada

Human

Brain abscess

Dog

Human

Brain abscess

USA

USA

liver

Human

Ulcer of left hand

USA?

unknown

Brazil

South America

UK

USA

Brazil

Africa

USA

Brazil

South America

Geography

Human

Human

…

Cat

Human

Human

Human

Human

Human

Human

Human

Human

Host

Subcutaneous lesion

Brain

Subcutaneous lesion

Decaying wood

Chromoblastomycosis

Brain abscess

Brain abscess

Brain abscess

Brain abscess

Brain abscess

Chromoblastomycosis

Chromoblastomycosis

Source

Chapter 4

Table 1.(continued)

Fonsecaea multimorphosa sp. nov

100429

117890

645,96

980.96 (T)

102240

102224

102235

102226

102253

126716

122637

454,82

Cladophialophora bantiana

Cladophialophora bantiana

Cladophialophora bantiana

Fonsecaea multimorphosa

Fonsecaea multimorphosa

Fonsecaea multimorphosa

Fonsecaea multimorphosa

Fonsecaea multimorphosa

Fonsecaea multimorphosa

Fonsecaea multimorphosa

Cladophialophora mycetomatis

Cladophialophora mycetomatis

dH 15898

dH 18906

dH 20510

dH 11618

dH 11587

dH 11597

dH 11584

dH 11604

UAMH 7249

IFM 4819

dH 14476

ATCC 24928

Other references

EU137293, EU137235, EU137176

FJ385276

EU938595

Gene Bank ITS, TEF1a, BT2

unknown

unknown

Babassu coconut

Decaying vegetable

Decaying trunk

Wood

Grevillia robusta, wood

Soil cover

Brain abscess

Disseminated

Chromoblastomycosis

Brain abscess

Source

unknown

unknown

Environment

Environment

Environment

Environment

Environment

Environment

Cat

Human

Human

Human

Host

unknown

unknown

Brazil

Brazil

Brazil

Brazil

Brazil

Brazil

Australia

Japan

Venezuela

unknown

Geography

Abbreviations: ATCC = American Type Culture Collection, Manassas, U.S.A.; CBS = Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, Utrecht, The Netherlands; dH = G.S. de Hoog working collection, Utrecht, The Netherlands; CDC = Centers for Disease Control and Prevention, Atlanta, U.S.A.; UAMH = The University of Alberta Microfungus Collection and Herbarium, Edmonton, Canada; UTHSC = The University of Texas Health Science Center collection, U.S.A.; IFM = Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan. T = ex-type culture.

CBS

Name

Table 1.(continued)

Chapter 4

50

Fonsecaea multimorphosa sp. nov

Alignment and phylogenetic reconstruction Sequences were edited using SeqMan in the Lasergene software (DNASTAR, Wisconsin, U.S.A.). Iterative alignment was performed automatically with manual adjustment in Bionumerics v. 4.61 (Applied Maths, Kortrijk, Belgium). A phylogenetic approach was used to investigate relationships between 61 strains of Cladophialophora and Fonsecaea, with Cladophialophora mycetomatis as outgroup. The genes ITS, BT2 and TEF1 were first analyzed separately. Conflicts were estimated using the partition homogeneity test available in PAUP* v. 4.Ob10 (Swofford 2003). Trees were constructed using the Maximum Likelihood implemented in RAxML version 7.0.4 with 100 bootstrap replicates and edited with MEGA 4 software (Tamura et al. 2007). Bootstrap values equal to or greater than 70% were considered significant (Hillis 1993). Alignments are available upon request. Antifungal susceptibility testing Minimal inhibitory concentrations (MICs) and minimum effective concentrations (MECs) for the cerebral and environmental isolates of the unknown species towards nine antifungal agents were determined according to Clinical and Laboratory Standards Institute guidelines M38-A2. Methods for sporulation and preparation of suspensions were according to Najafzadeh et al. (2010a). Amphotericin B (Bristol-Myers-Squib, Woerden, The Netherlands), fluconazole (Pfizer Central Research, Sandwich, U.K.), itraconazole (Janssen Research Foundation, Beerse, Belgium), voriconazole (Pfizer), posaconazole (ScheringPlough, Kenilworth, U.S.A.), isavuconazole (Basilea Pharmaceutica, Basel, Switzerland), caspofungin (Merck Sharp & Dohme, Haarlem, The Netherlands), micafungin (Astellas 51

Chapter 4

DNA amplification and sequencing Three gene regions were chosen for the phylogenetic analysis, i.e. rDNA internal transcribed spacers (ITS), partial translation elongation factor 1-α (TEF1) and partial β-tubulin (BT2). ITS amplicons were generated with primers V9G and LS266 and were sequenced with primers ITS1 and ITS4 (de Hoog & Gerrits van den Ende 1998; Masclaux et al. 1995). TEF1 amplification and sequencing was done with EF-728F and EF1-986R (Carbone & Kohn 1999), BT2 amplification and sequencing with BT2a and BT2b (Glass & Donaldson 1995). PCR was performed in a 25 μl volume reaction mixture with 7 μl Go Taq master mix (Promega) containing dNTPs, MgCl2, reaction buffer, 1 μl of each primer (10 pmol) and 1 μl DNA. Amplification was performed in an ABI PRISM 2720 (Applied Biosystems, Foster City, U.S.A.) thermocycler as follows: 95°C for 4 min, followed by 35 cycles consisting of 95°C for 45 sec, 52°C for 30 sec and 72°C for 2 min, with a delay at 72°C for 7 min. The annealing temperature was changed to 58°C for BT2. Amplicons were subjected to direct sequencing, with PCR regimen as follows: 95°C for 1 min followed by 30 cycles consisting of 95°C for 10 sec, 50°C for 5 sec and 60°C for 2 min. Reactions were purified with Sephadex G-50 fine (GE Healthcare Bio-Sciences AB, Uppsala, Sweden). Sequencing was done using ABI PRISM BigDyeTM terminator cycle sequencing kit (Applied Biosystems) and amplicons were analyzed on an ABI PRISM 3730XL Sequencer.

Chapter 4

Pharma) and terbinafin (Novartis Pharmaceuticals) were obtained as reagent-grade powders from their respective manufacturers. Antifungal agents were dissolved as prescribed by the CLSI; stock solutions of the experimental triazole isavuconazole were prepared in DMSO. Antimycotics were diluted in RPMI 1640 medium (GIBCO BRL, Life Technologies, Woerden, The Netherlands) buffered to pH 7.0 with 0.165 M morpholinepropanesulfonic acid (MOPS) (Sigma-Aldrich, Steinheim, Germany) and dispensed into 96-well microdilution trays at the following concentration ranges: amphotericin B, itraconazole, voriconazole, posaconazole, isavuconazole: 0.016−16 μg/ml; terbinafin 0.004−4 μg/ml; fluconazole: 0.063−64 μg/ml; caspofungin, micafungin: 0.008−8 μg/ml. Microdilution trays were stored at −80°C prior to use. Conidial suspensions in physiological saline containing Tween 20 (0.05%) were adjusted spectrophotometrically (530 nm) to optical densities in the range between 0.15−0.17, then diluted 1:50 in buffered RPMI 1640 medium; final inoculum suspensions contained 0.5 × 104 4 × 104 CFU/ml, as verified by colony counts on Sabouraud´s glucose agar (SGA). Microtiter plates inoculated with the fungus under study were incubated at 25°C. After 96−192 h the plates were examined visually and MICs and MECs determined. Candida parapsilosis (ATCC 22019), Candida krusei (ATCC 6258) and Paecilomyces variotii (ATCC 22319) were used for quality controls. Results Histological appearance of the brain lesion of the cat was characterized by massive hyphal invasion, inflammatory cells, reactive neuroglial cells and liquefactive necrosis (Shinwari et al. 1985). In a section stained by haematoxylin and eosin (HE) the fungus appeared with septate hyphae, sparsely branched at almost right angles, with thick dark brown to olive walls. Some budding yeast like cells with occasional hyphal extensions were also evident. Examination of potassium hydroxide mounts from the lesion revealed brownish hyphae. In culture the fungus exhibited yellow-brown, septate and freely branched conidiophores bearing long chains of yellow-brown, ovoidal to ellipsoidal conidia. PCR amplification of SSU rDNA yielded products of about 1700 bp with strains CBS 980.96 and CBS 102240. Using an SSU data set available at CBS, strain CBS 980.96 was located close to Fonsecaea pedrosoi, F. monophora, F. nubica, Cladophialophora bantiana, C. arxii, C. saturnica, C. emmonsii, C. minourae and C. eucalypti, though with low bootstrap support (data not shown). The majority of the species mentioned above have been reported from disorders in human and animals, with the exception of C. minourae and C. eucalypti which are strictly environmental. The Fonsecaea / Cladophialophora group was analyzed in detail with ITS, and a selection was studied with ITS, TEF1 and BT2. The rDNA ITS region was sequenced for 7 strains of the species under study, and 56 related strains in Cladophialophora and Fonsecaea as well as two Capronia isolates (Fig. 1). Trees were constructed using maximum likelihood implemented in RAxML v. 7.0.4, using GAMMA model of rate heterogeneity and GTR substitution matrix. Empirical base frequencies were pi(A): 0.223180, pi(C): 0.284699, pi(G): 0.241841, pi(T): 0.250280). A clade consisting of strains CBS 980.96, CBS 126716, 102253, 102226, 102235, 52

Fonsecaea multimorphosa sp. nov

Chapter 4 Fig. 1. Consensus tree of Fonsecaea multimorphosa and allied black fungi based on Internal Transcribed Spacer (ITS) ribosomal DNA of 63 strains, constructed using Maximum Parsimony Implemented in RAxML version 7.0.4 with 100 bootstrap replicates and edited with Mega 4 software (values > 70 are shown at the branches in bold). Cladophialophora mycetomatis was selected as outgroup.

53

Chapter 4

102224 and 102240 was well supported (99% bootstrap). Topologies of the trees generated with all three genes (ITS, BT2 and TEF1) were concordant. Result of Partition Homogeneity Test (PHT = 0.97) did not detect conflict between loci, and therefore three genes were combined to investigate species delimitation using PSR (Fig. 2). In RAxML v. 7.0.4 the GAMMA model of rate heterogeneity and GTR substitution matrix were used. Empirical base frequencies: pi(A): 0.232609, pi(C): 0.282307, pi(G): 0.231842, pi(T): 0.253242). The clade with seven strains above was supported with 96% bootstrap, but showed significant internal heterogeneity (Fig. 2). Cardinal temperatures of CBS 980.96 showed optimal development at 33ºC and a maximum at 40ºC (Fig. 3). The environmental strains had an optimum at 30°C and reached a maximum at 36ºC (Fig. 3). Growth velocity at 30°C of CBS 980.96 was significantly slower than environmental strains: 0.7 and 1.5 mm/day , respectively. Fonsecaea multimorphosa Najafzadeh, Vicente, Sun, Meis & de Hoog, sp. nov. Figs 4 and 5. Mycobank MB 519043. Coloniae in agaro tuberosum lente crescentes, velutinae, olivaceae vel griseo-brunneae; reversum olivaceo-nigrum et pigmentum brunneum exudens. Cellulae zymoideae adsunt. Conidium (1) sympodialiter producta, brunnea, ellipsoidea 1.9−2.5 × 3.0−5.2 µm, cellulae conidiogenae denticulatae. (2) Conidiorum catenae, conidia plerumque limoniforma vel fusiforma. (3) Chlamydospora globosa lateralia praesens. Temperatura maxima crescentiae 40°C. Teleomorphe ignota. Holotypus CBS-H 20464. Etymology: the name refers to the occurrence of synanamorphs in the ex-type strain. Description of CBS 980.96 after 3 week incubation on MEA and PDA at 25°C. Colonies restricted, compact, circular, olivaceous to brownish grey, velvety. Reverse olivaceous black. A brownish pigment is exuded into the agar. Conidium production of various types: (1) Sympodial conidiophores mainly on PDA, conidia produced apically or intercalarily on short rachids or in small clusters on small denticles with dark scars; conidia broadly ellipsoidal 1.9−2.5 × 3.0−5.2 µm, liberating reluctantly. (2) Long, branched chains of fusiform conidia mainly on MEA; conidia lemon-shaped to fusiform. (3) Chlamydospore-like cells sometimes present on both media. Cardinal temperatures: optimum 33°C, scant growth at 40°C. Holotype: dried culture in herbarium CBS-H 20464; ex-type strain CBS 980.96, isolated from brain of a cat, Australia, 1985 (Shinwari et al. 1985). MICs range for the strains of F. multimorphosa (n = 7) towards nine antifungal drugs surveyed were as follows: amphotericin B 0.25−1 μg/ml, fluconazole 16−64 μg/ml, itraconazole 0.016−0.063 μg/ml, posaconazole 0.016−0.031 μg/ml, isavuconazole 0.016−0.5 μg/ml, voriconazole 0.063−0.250 μg/ml, caspofungin 0.031−1 μg/ml, micafungin 0.008−0.125 μg/ ml, terbinafin 0.125−0.5 μg/ml. Posaconazole and itraconazole were the most active drugs, followed by micafungin, isavuconazole, voriconazole and amphotericin B.

54

Fonsecaea multimorphosa sp. nov

Chapter 4 Fig. 2. Maximum Likelihood tree based on the combined data of ITS and partial BT2 and TEF1 genes of 63 members of Fonsecaea multimorphosa and allied black fungi with RAxML version 7.0.4 with 100 bootstrap replicates and edited with Mega 4 software (values > 70 are shown at the branches in bold). Cladophialophora mycetomatis was selected as outgroup.

55

Chapter 4

Fig. 3. Colony diameters at various temperatures with 3ºC increments ranging from 9-36 ºC in addition 37 ºC and 40 ºC, measured after 3 weeks on 2% MEA were calculated for Fonsecaea multimorphosa from cat (CBS 980.96) (rhomboid) and Fonsecaea multimorphosa from environment (CBS 102240, CBS 102224, CBS 102235, CBS 102253 and CBS126716) (rectangular).

Discussion In the present study we document a new species of Fonsecaea isolated from the left occipital lobe of the cerebrum of an 18-month-old Australian spayed female cat that showed circling and incoordination. The etiologic agent had originally been identified as ‘Cladosporium bantianum´ by morphology. However, the voucher strain CBS 980.96 showed 12% ITS difference with type strain of C. bantiana, CBS 173.52 and thus clearly belongs to another taxon. On the basis of morphology and sequences the strain did not match with any known species. Several strains similar to CBS 980.96 had been recovered from the natural environment in Brazil by a selective isolation method using mineral oil. Locations of isolation were chosen on the basis of known records of chromoblastomycosis in the state of Paraná in Brazil (Vicente et al. 2008). The set of environmental strains showed slight deviation from CBS 980.96 in ITS, BT2 and TEF1 genes (Fig. 2). The clinical vs. environmental strains were also different in growth velocity. The neurotropic strain CBS 980.96 grew consistently slower on all media, and had a different profile of cardinal temperatures, being able to grow at 37oC and 40oC (Fig. 3). However, further subdivision of the clade comprising environmental and veterinary strains was not statistically supported. Differences in growth velocities an thermotolerance between isolates may be the result of prolonged stress of the veterinary strain living under non-optimal conditions. Variable expression of synanamorphs is a common feature in Chaetothyriales (e.g. de Hoog et al. 1994). For these reasons the environmental strains were preliminarily treated as being conspecific with CBS 980.96. Fonsecaea multimorphosa thus 56

Fonsecaea multimorphosa sp. nov

Chapter 4 Fig. 4. Macroscopic and microscopic morphology of Fonsecaea multimorphosa, ex-type strain CBS 980.96. a. Culture on MEA; b, c. Cladophialophora synanamorph and chlamydospores; d, e, l. Cladophialophora synanamorph; f−j, m. Fonsecaea synanamorph. Scale bar = 10 μm.

57

Chapter 4

Fig. 5. Line drawing of microscopic morphology of Fonsecaea multimorphosa, ex-type strain CBS 980.96, slide cultures on MEA and PDA after 14 days.

58

Fonsecaea multimorphosa sp. nov

Acknowledgements The work of Mohammad Javad Najafzadeh was financially supported by the Ministry of Health and Medical Education of Iran and the Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran.

59

Chapter 4

should be regarded as an environmental, opportunistic species. The infected cat received corticosteroid therapy after an arthroplastic surgery. Although a large share patients with primary cerebral phaeohyphomycosis are otherwise healthy individuals (Li & de Hoog 2009), the present cat´s chronic immunosuppression may have enhanced the infection. Infection in hosts where the body temperature is close to the maximum growth temperature of the etiologic agent is not uncommon in Chaetothyriales (e.g., Surash et al. 2005). The fungi treated in this paper have melanin in their cell walls. Although little is known about the pathogenic mechanism of these fungi, especially in immunocompetent hosts, the production of melanin is regarded to be a virulence factor (e.g. Ajello et al. 1974; Taborda et al. 2008). Melanins are pigments of high molecular weight formed by oxidative polymerization of phenolic compounds. Fungal melanins are supposed to function in virulence by protecting fungal cells against antimicrobial oxidants, by impairing the development of cell-mediated responses and by interfering with complement activation. They may also reduce susceptibility to antifungal agents (Badali et al. 2008; Jacobson 2000). Jacobson (2000) showed that laboratory-derived strains of Cryptococcus neoformans that lacked melanin had markedly reduced virulence in a mouse model of infection. Another putative virulence factor is thermotolerance. Cladophialophora species have different maximum growth temperatures and particularly species that cause systemic infection are able to grow at 40oC (de Hoog et al. 2000). In the present study the clinical strain of F. multimorphosa had an optimum development at 33oC and was still able to growth at 40oC, but environmental strains did not grow at 40oC. The number of isolates available is too limited to describe the specific borderline with certainty. The results of MIC testing was almost identical for clinical and environmental strains. Although melanized agents of central nervous system infections are susceptible to most antifungal agents in vitro, treatment is difficult because frequent relapses are observed (Revankar et al. 2004). The diagnosis of systemic mycosis of the brain is difficult because cerebral masses are usually thought to be neoplasms or abscesses of bacterial etiology. Hyphal elements should be visualized in biopsy specimens (Li & de Hoog 2009). Interpretation of colony and microscopic morphology is insufficient for specific identification, but reliable species identification in black fungi is generally achieved by sequencing the ITS region (Zeng et al. 2007). Recently loop-assisted isothermal amplification (LAMP) (Sun et al. 2009) and rolling circle amplification (RCA) (Najafzadeh et al. 2011) were introduced for rapid and specific identification of Fonsecaea species. These techniques could be extended to this present Fonsecaea species.

Chapter 4

Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. References Abramo F, Bastelli F, Nardoni S, Mancianti F, 2002. Feline cutaneous phaeohyphomycosis due to Cladophialophora bantiana. J Feline Med Surg 4: 157‒163. Ajello L, Georg LK, Steigbigel RT, Wang CJ, 1974. A case of phaeohyphomycosis caused by a new species of Phialophora. Mycologia 66: 490‒498. Al-Abdely HM, Najvar L, Bocanegra R, Fothergill A, Loebenberg D, Rinaldi MG, Graybill JR, 2000. SCH 56592, amphotericin B, or itraconazole therapy of experimental murine cerebral phaeohyphomycosis due to Ramichloridium obovoideum (“Ramichloridium mackenziei”). Antimicrob Agents Chemother 44: 1159‒1162. Anor S, Sturges BK, Lafranco L, Jang SS, Higgins RJ, Koblik PD, LeCouteur RA, 2001. Systemic phaeohyphomycosis (Cladophialophora bantiana) in a dog -- clinical diagnosis with stereotactic computed tomographic-guided brain biopsy. J Vet Intern Med 15: 257‒261. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits Gerrits van den Ende AHGG, de Hoog GS, 2008. Biodiversity of the genus Cladophialophora. Stud Mycol 61: 175‒191. Blalock HG, Georg LK, Derieux WT, 1973. Encephalitis in turkey poults due to Dactylaria (Diplorhinotrichum) gallopava ‒ a case report and its experimental reproduction. Avian Dis 17: 197‒204. Bouljihad M, Lindeman CJ, Hayden DW, 2002. Pyogranulomatous meningoencephalitis associated with dematiaceous fungal (Cladophialophora bantiana) infection in a domestic cat. J Vet Diagn Invest 14: 70‒72. Campbell CK Al-Hedaithy S, 1993. Phaeohyphomycosis of the brain caused by Ramichloridium mackenziei sp nov in Middle Eastern countries. J Med Vet Mycol 31: 325‒332. Carbone I, Kohn LM, 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553‒556. de Hoog GS, Gerrits Gerrits van den Ende AHGG, 1998. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41: 183‒189. Dixon DM, Shadomy HJ, Shadomy S, 1980. Dematiaceous fungal pathogens isolated from nature. Mycopathologia 70: 153-161. Dixon DM, Walsh TJ, Merz WG, McGinnis MR, 1989. Infections due to Xylohypha bantiana (Cladosporium trichoides). Rev Infect Dis 11: 515‒525. Elies L, Balandraud V, Boulouha L, Crespeau F, Guillot J, 2003. Fatal systemic phaeohyphomycosis in a cat due to Cladophialophora bantiana. J Vet Med A Physiol Pathol Clin Med 50: 50‒53. Fondati A, Gallo MG, Romano E, Fondevila D, 2001. A case of feline phaeohyphomycosis due to Fonsecaea pedrosoi. Vet Dermatol 12: 297‒301. de Hoog GS, Guarro J, Gené J, Figueras MJ, 2000. Atlas of clinical fungi, 2nd edn ed. Centraalbureau voor Schimmelcultures, Utrecht / Universitat Rovira i Virgili, Reus. Giri DK, Sims WP, Sura R, Cooper JJ, Gavrilov BK, Mansell JE, 2010. Cerebral and renal phaeohyphomycosis in a dog infected with Bipolaris species. Vet Pathol, inpress. Glass NL, Donaldson GC, 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61: 1323‒1330. Hillis DM Bull JJ, 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. System Biol 42: 182‒192. Horré R de Hoog GS, 1999. Primary cerebral infections by melanized fungi: a review. Stud Mycol 43: 176-193. Jacobson ES, 2000. Pathogenic roles for fungal melanins. Clin Microbiol Rev 13: 708‒717. Koo S, Klompas M, Marty FM, 2010. Fonsecaea monophora cerebral phaeohyphomycosis: case report of successful surgical excision and voriconazole treatment and review. Med Mycol 48: 769-774. Li DM, de Hoog GS, 2009. Cerebral phaeohyphomycosis ‒ a cure at what lengths? Lancet Infect Dis 9: 376‒383. Maeda H, Shibuya H, Yamaguchi Y, Miyoshi T, Irie M, Sato T, 2008. Feline digital phaeohyphomycosis due to Exophiala jeanselmei. J Vet Med Sci 70: 1395‒1397. Mariani CL, Platt SR, Scase TJ, Howerth EW, Chrisman CL, Clemmons RM, 2002. Cerebral phaeohyphomycosis caused by Cladosporium spp. in two domestic shorthair cats. J Am Anim Hosp Assoc 38: 225‒230. Masclaux F, Guého E, de Hoog GS, Christen R, 1995. Phylogenetic relationships of human-pathogenic Cladosporium (Xylohypha) species inferred from partial LS rRNA sequences. J Med Vet Mycol 33: 327-338. Najafzadeh MJ, Badali H, Illnait-Zaragozi MT, de Hoog GS, Meis JF, 2010a. In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea spp. Antimicrob Agents Chemother 54: 1636‒1638.

60

Fonsecaea multimorphosa sp. nov

61

Chapter 4

Najafzadeh MJ, Gueidan C, Badali H, Gerits Gerrits van den Ende AHGG, Xi L, de Hoog GS, 2009. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 47: 17‒25. Najafzadeh MJ, Sun J, Vicente VA, de Hoog GS, 2011. Rapid identification of fungal pathogens by rolling circle amplification (RCA) using Fonsecaea as a model.Mycoses, in press. Najafzadeh MJ, Rezusta A, Cameo MI, Zubiri ML, Yus MC, Badali H, Revillo MJ, de Hoog GS, 2010b. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol 48: 390‒393. Najafzadeh MJ, Sun J, Vicente VA, Xi L, Gerrits Gerrits van den Ende AHGG, de Hoog GS, 2010b. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol 48: 800‒806. Revankar SG, Patterson JE, Sutton DA, Pullen R, Rinaldi MG, 2002. Disseminated phaeohyphomycosis: review of an emerging mycosis. Clin Infect Dis 34: 467‒476. Revankar SG, Sutton DA, Rinaldi MG, 2004. Primary central nervous system phaeohyphomycosis: a review of 101 cases. Clin Infect Dis 38: 206‒216. Shinwari MW, Thomas AD, Orr JS, 1985. Feline cerebral phaeohyphomycosis associated with Cladosporium bantianum. Aust Vet J 62: 383‒384. Shoham S, Pic-Aluas L, Taylor J, Cortez K, Rinaldi MG, Shea Y, Walsh TJ, 2008. Transplant-associated Ochroconis gallopava infections. Transpl Infect Dis 10: 442‒448. Singh K, Flood J, Welsh RD, Wyckoff JH, Snider TA, Sutton DA, 2006. Fatal systemic phaeohyphomycosis caused by Ochroconis gallopavum in a dog (Canis familaris). Vet Pathol 43: 988‒992. Sun J, Najafzadeh MJ, Vicente VA, Xi L, de Hoog GS, 2009. Rapid detection of pathogenic fungi using loop-mediated isothermal amplification, exemplified by Fonsecaea agents of chromoblastomycosis. J Microbiol Methods 80: 19‒24. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP, 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 43: 465‒472. Sutton DA, Slifkin M, Yakulis R, Rinaldi MG, 1998. U.S. case report of cerebral phaeohyphomycosis caused by Ramichloridium obovoideum (R. mackenziei): criteria for identification, therapy, and review of other known dematiaceous neurotropic taxa. J Clin Microbiol 36: 708‒715. Swofford D, 2003. PAUP*. Phylogenetic Analysis using parsimony. Sinauer Associates. Takei H, Goodman JC, Powell SZ, 2007. Cerebral phaeohyphomycosis caused by Cladophialophora bantiana and Fonsecaea monophora: report of three cases. Clin Neuropathol 26: 21‒27. Tamura K, Dudley J, Nei M, Kumar S, 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596‒1599. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, de Hoog GS, Zhao J, PizziraniKleiner A, 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 61: 137‒144. Wong JS, Schousboe MI, Metcalf SS, Endre ZH, Hegarty JM, Maze MJ, Keith ER, Seaward LM, Podmore RG, 2010. Ochroconis gallopava peritonitis in a cardiac transplant patient on continuous ambulatory peritoneal dialysis. Transpl Infect Dis, 21(5):455-8. Zeng JS, Sutton DA, Fothergill AW, Rinaldi MG, Harrak MJ, de Hoog GS, 2007. Spectrum of clinically relevant Exophiala species in the United States. J Clin Microbiol 45: 3713-3720.

62

Chapter

5 Molecular epidemiology of Fonsecaea species

M. J. Najafzadeh1,2,3, J. Sun4, V. A. Vicente5, C. H. W. Klaassen6, A. Bonifaz7, A. H. G. Gerrits van den Ende1, S. B. J. Menken2, & G. S. de Hoog1,2,8 CBS–KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat–Sen University, Guangzhou, Guangdong, China, 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil, 6Canisius Wilhelmina Hospital, Nijmegen, the Netherlands, 7 Hospital General de México, Narvarte, Mexico and 8Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China 1

*Correspondence: G. S. de Hoog, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Tel.: +31 30 2122 663; fax: +31 30 251 2097; E-mail: de.hoog@cbs. knaw.nl. Published in: Emerg Infect Dis, 2011 mar;17(3): 464-9

63

Chapter 5

Abstract To assess population diversities among 81 strains of fungi in the genus Fonsecaea that had been identified down to species level, we applied amplified fragmentlength polymorphism (AFLP) technology and sequenced the internal transcribed spacer regions and the partial cell division cycle, β-tubulin, and actin genes. Many species of the genus Fonsecaea cause human chromoblastomycosis. Strains originated from a global sampling of clinical and environmental sources in the Western Hemisphere, Asia, Africa, and Europe. According to AFLP fingerprinting, Fonsecaea isolates clustered in 5 groups corresponding with F. pedrosoi, F. monophora, and F. nubica: the latter 2 species each comprised 2 groups, and F. pedrosoi appeared to be of monophyletic origin. F. pedrosoi was found nearly exclusively in Central and South America. F. monophora and F. nubica were distributed worldwide, but both showed substantial geographic structuring. Clinical cases outside areas where Fonsecaea is endemic were probably distributed by human migration. Keywords: Chromoblastomycosis, Fonsecaea, AFLP.

Introduction The genus Fonsecaea comprises etiologic fungal agents of human chromoblastomycosis (1–3), a chronic cutaneous and subcutaneous infection characterized by slowly expanding nodules that eventually lead to emerging, cauliflower-like, mutilating and disfiguring eruptions. Infection proceeds with muriform cells in tissue provoking a granulomatous immune response. In areas where it is endemic, disease incidence is high. Yegres et al. (4) and Yëgues-Rodriguez et al. (5) noted a frequency of 16 cases/1,000 population under arid climatic conditions in rural communities of Venezuela; chromoblastomycosis in that region is caused mainly by Cladophialophora carrionii. In contrast, Fonsecaea spp. are prevalent in humid tropical climates. Esterre et al. (6) reported 1,343 cases of chromoblastomycosis from Madagascar, 61.8% of which were caused by Fonsecaea spp. Kombila et al.(7) reported 64 cases in Gabon (equatorial Africa), all caused by Fonsecaea spp., and Silva et al. (8) cited 325 cases in the Amazon region of Brazil, 98% of which had Fonsecaea spp. as the etiologic agent. In Sri Lanka, 94% of 71 chromoblastomycosis cases were caused by Fonsecaea spp. (9). Fonsecaea contains anamorphic ascomycetes belonging to the family Herpotrichiellaceae (order Chaetothyriales), which includes black yeasts and relatives (10–12). The genus comprises 3 sibling species: F. pedrosoi, F. monophora, and F. nubica, each of which has pathogenic potential (10,13,14). Infection process and routes of dispersal are insufficiently clarified. Humans presumably acquire the infection after being pricked by contaminated thorns or wood splinters, but some agents are substantially more clinically prevalent than their predominantly (hitherto unnamed) environmental counterparts (15), which indicates that infection is not a random process. In many published case reports, etiologic agents were referred to as Phialophora pedrosoi or identified with the obsolete name F. compacta, now known to be a mutant F. pedrosoi (9,13,16). Strains are no longer accessible for molecular verification. Hence, no data are available on the epidemiology of the species as defined by 64

Molecular Epidemiology of Fonsecaea Species

sequence data. Phylogenetically, Fonsecaea spp. agents of chromoblastomycosis are flanked by nonpathogenic species (10) growing on plant debris. Discovery of natural habitat and source of infection by entities emerging on the human host is essential for understanding the evolution of pathogenicity. We present an amplified fragment-length polymorphism (AFLP) DNA fingerprinting study of a worldwide collection of clinical isolates that were identified as Fonsecaea spp. by state-of-the-art sequencing methods, supplemented with environmental isolates of the same species. The AFLP technique is a powerful method for discrimination between fungal species and for providing high-resolution fingerprinting data within species (17–19). Materials and methods

DNA extraction and identification Approximately 1 cm2 of 14- to 21-day-old cultures were transferred to 2 mL Eppendorf tubes containing 400 μL TEx buffer (Sigma-Aldrich, Zwijndrecht, the Netherlands), pH 9.0 (100 mmol Tris, 40 mmol Na-EDTA) and glass beads (Sigma G9143, Sigma-Aldrich). The fungal material was homogenized with a MoBio vortex (Bohemia, New York, USA) for 1 min. Subsequently, 120 μL of a 10% sodium dodecyl sulfate solution and 10 μL proteinase K (10 mg/mL, Sigma-Aldrich) were added and incubated for 30 min at 55°C; the mixture was vortexed for 3 min. After addition of 120 μL of 5M NaCl and 1/10 vol 10% cetyltrimethylammonium bromide solution (Sigma-Aldrich), the material was incubated for 60 min at 55°C. Then the mixture was vortexed for 3 min. Subsequently, 700 μL SEVAG (24:1, chloroform: isoamyl alcohol) was added, mixed carefully, and centrifuged for 5 min at 4°C at 20,400 × g. The supernatant was transferred to a new Eppendorf tube with 225 μL 5M NH4 acetate (Sigma-Aldrich), mixed carefully by inverting, incubated for 30 min on ice water, and centrifuged again for 5 min at 4°C at 20,400 × g. The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20,400 × g. Finally, the pellet was washed with 1 mL ice cold 70% ethanol. After drying at room temperature, it was resuspended in 48.5 μL TE buffer (Sigma-Aldrich) (Tris 0.12% wt/vol, Na-EDTA 0.04% wt/vol) and 1.5 μL of RNase (Sigma-Aldrich) and incubated in 37°C for 20–30 min. Quality of genomic DNA was verified on agarose gel. Species were identified on the basis of internal transcribed spacer (ITS), partial cell division cycle (cdc42), β-tubulin (BT2), and ACT sequences (10–14). 65

Chapter 5

Fungal strains and culture conditions We studied 81 isolates representing the 3 currently recognized Fonsecaea spp. Geographic origins and hosts of the strains are listed in Table 1; the set include reference strains from the Centraalbureau voor Schimmelcultures (CBS-KNAW Fungal Biodiversity Centre, Utrecht, the Netherlands) and fresh isolates from patients and from the environment. Stock cultures were maintained on slants of 2% malt extract agar and oatmeal agar at 24°C.

Chapter 5

corresponded with spp. species borderlines recently by Najafzadeh et al. (10,14) on Table 1. Fonsecaea isolates used for established amplified fragment-length polymorphism analyses Name

CBS number

Other reference(s)

Origin

Host

Location

Pop

F. nubica

CBS 121733

dH 18411, SUMS 0011

Chromoblastomycosis

Human, male

China, Guangdong

1

F. nubica

CBS 125199

dH 20427

Chromoblastomycosis

Human, female

China, Guangdong

1

F. nubica

CBS 125186

dH 20429

Chromoblastomycosis

Human, male

China, Guangdong

1

F. nubica

CBS 125200

dH 20425

Chromoblastomycosis

Human, male

China, Guangdong

1

F. nubica

CBS 121720

dH 18398, SUMS 0251

Chromoblastomycosis

Human, male

China, Guangdong

1

F. nubica

CBS 125198

dH 20418

Chromoblastomycosis

Human, male

China, Guangdong

1

F. nubica

CBS 121734

dH 18412, SUMS 0255

Chromoblastomycosis

Human, male

China, Guangdong

1

F. nubica

CBS 271.33

dH 15659, ATCC 18658, IMI 134458

Chromoblastomycosis

Human, male

South America

2

F. nubica

CBS 557.76

ATCC 28174

Unknown

Unknown

Unknown

2

F. nubica

CBS 270.37

dH 15657

Unknown

Unknown

France

2

F. nubica

CBS 277.29

dH 15668

Chromoblastomycosis

Human, male

Brazil

2

F. monophora

CBS 102243

dH 11607

Chromoblastomycosis

Human, male

Brazil, Parana, Ibituva

3

F. monophora

CBS 117236

dH 15330, UTHSC 04-2904

Brain

Human, male

USA

3

F. monophora

CBS 102246

dH 11611

Chromoblastomycosis

Human, male

Brazil, Parana, Campo Largo

3

F. monophora

CBS 102242

dH 11606

Chromoblastomycosis

Human, male

Brazil, Sta Cat., Curitibanos

3

F. monophora

CSB 102225

dH 11585

Decaying wood

Plant

Brazil, Parana, Colombo

3

F. monophora

CSB 269.37

dH 12659

Chromoblastomycosis

Human

South America

3

F. monophora

CSB 102238

dH 11602

Soil

Soil

Brazil, Parana, Tibagi River

3

F. monophora

CBS 117237

dH 15331, UTHSC 04-2631

Chromoblastomycosis

Human, male

USA

3

F. monophora

CBS 102229

dH 11590

Decaying vegetable cover

Plant

Brazil, Parana, Piraquara

3

F. monophora

CBS 397.48

dH 15828, ATCC 9475

Chromoblastomycosis

Human, male

South America

3

F. monophora

CBS 115830

dH 12978

Brain

Human, male

Brazil

3

F. monophora

CBS125189

dH 20421

Chromoblastomycosis

Human, male

China, Haikou

3

F. monophora

CBS 100430

ATCC 32280

Brain

Human, male

Africa

3

F. monophora

CBS 123849

dH 20215

Chromoblastomycosis

Human, female

Africa, Guinea

3

F. monophora

CBS 102248

dH 11613

Chromoblastomycosis

Human, male

Brazil, Parana, Piraquara

3

F. monophora

CBS 121725

dH 18403, SUMS 0250

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 121728

dH 18406, SUMS 0158

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 121726

dH 18404, SUMS 0192

Chromoblastomycosis

Human, male

China, Guangdong

4

66

Molecular Epidemiology of Fonsecaea Species

Table 1. (continued) CBS number

Other reference(s)

Origin

Host

Location

Pop

CBS 121727

dH 18405, SUMS 0190

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 121721

dH 18399, SUMS 0246

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 125193

dH 20426

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 125195

dH 20417

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 125196

dH 20419

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 125197

dH 20420

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 121732

dH 18410, SUMS 0012

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 125190

dH 20422

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 125192

dH 20424

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 117238

dH 13130, UTHSC R-3486

Brain

Human

U.K

4

F. monophora

CBS 121731

dH 18409, SUMS 0013

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 121730

dH 18408, SUMS 0014

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 121722

dH 18400, SUMS 0247

Chromoblastomycosis

Human, male

China, Guangdong

4

F. monophora

CBS 122742

dH 19251, SUMS 0147

Chromoblastomycosis

Human

China, Shandong

4

F. monophora

CBS 121724

dH 18402, SUMS 0200

Chromoblastomycosis

Human, male

China, Guangdong

4

F. pedrosoi

CBS 273.66

dH 15663

Mouse passage

Soil

Venezuela

5

F. pedrosoi

CBS 271.37

dH 15659, ATCC 18658, IMI 134458

Chromoblastomycosis

Human, male

South America

5

F. pedrosoi

CBS 671.66

dH 16159

Mouse passage

Soil

Venezuela

5

F. pedrosoi

CBS 274.66

dH 15665

Mouse passage

Soil

Venezuela

5

F. pedrosoi

CBS 102245

dH 11610

Chromoblastomycosis

Human, male

Brazil, Parana, Ampere

5

F. pedrosoi

CBS 659.76

dH 16142, ATCC 28303

Chromoblastomycosis

Human, male

Argentina

5

F. pedrosoi

CBS 102247

dH 11612

Chromoblastomycosis

Human, male

Brazil, Parana

5

F. pedrosoi

CBS 122740

dH 18430, Bonifaz 002200

Chromoblastomycosis

Human, male

Mexico, Mexico City

5

F. pedrosoi

CBS 122737

dH 18896

Chromoblastomycosis

Human, male

Mexico, Mexico City

5a

F. pedrosoi

CBS 122735

dH 18898

Chromoblastomycosis

Human, male

Mexico, Mexico City

5a

F. pedrosoi

CBS 122736

dH 18897

Chromoblastomycosis

Human, male

Mexico, Mexico City

5a

F. pedrosoi

CBS 122739

dH 18894

Chromoblastomycosis

Human, male

Mexico, Mexico City

5a

F. pedrosoi

CBS 122732

dH 18901

Chromoblastomycosis

Human, male

Mexico, Mexico City

5

F. pedrosoi

CSB 122733

dH 18900

Chromoblastomycosis

Human, male

Mexico, Mexico City

5

67

Chapter 5

Name F. monophora

Chapter 5

Table 1. (continued) Name

CBS number

Other reference(s)

Origin

Host

Location

Pop

F. pedrosoi

CBS 122849

dH 18902

Chromoblastomycosis

Human, male

Mexico, Mexico City

5b

F. pedrosoi

CBS 122738

dH 18895

Chromoblastomycosis

Human, male

Mexico, Mexico City

5b

F. pedrosoi

CBS 122731

dH 18903

Chromoblastomycosis

Human, male

Mexico, Mexico City

5b

F. pedrosoi

CBS 122734

dH 18899

Chromoblastomycosis

Human, male

Mexico, Mexico City

5b

F. pedrosoi

CBS 102244

dH 11608

Chromoblastomycosis

Human, male

Brazil, Parana, Ipora

5

F. pedrosoi

CBS 122729

dH 18905

Chromoblastomycosis

Human, male

Mexico, Mexico City

5

F. pedrosoi

CBS 122730

dH 18904

Chromoblastomycosis

Human, male

Mexico, Mexico City

5

F. pedrosoi

CBS 285.47

dH 15680, ATCC 10222

Chromoblastomycosis

Human, male

Puerto Rico

5

F. pedrosoi

CBS 342.34

dH 15773

Chromoblastomycosis

Human, male

Puerto Rico

5

F. pedrosoi

CBS 670.66

dH 16157

Mouse passage

Soil

Venezuela

5

F. pedrosoi

CBS 122741

dH 18431, Bonifaz 02300

Chromoblastomycosis

Human, male

Mexico, Mexico City

5

F. pedrosoi

CBS 122729

dH 18905

Chromoblastomycosis

Human

Mexico, Mexico City

5

F. pedrosoi

CBS 212.77

dH 15549

Chromoblastomycosis

Human, male

Netherlands, Amsterdam

5

F. pedrosoi

CBS 117910

dH 14477

Chromoblastomycosis

Human, male

Venezuela, Coro, Falcón State

5

F. pedrosoi

CBS 272.37

dH 15661

Chromoblastomycosis

Human

Brazil

5

F. pedrosoi

CBS 122345

dH 18914, Bonifaz 121-06

Chromoblastomycosis

Human, male

Mexico, Mexico City

5c

F. pedrosoi

CBS 122343

dH 18916, Bonifaz 122-07

Chromoblastomycosis

Human, male

Mexico, Mexico City

5c

F. pedrosoi

CBS 122341

dH 18918, Bonifaz 345-07

Chromoblastomycosis

Human, male

Mexico, Mexico City

5c

F. pedrosoi

CBS 122349

dH 18910, Bonifaz 234-04

Chromoblastomycosis

Human, male

Mexico, Mexico City

5c

F. pedrosoi

CBS 122347

dH 18912, Bonifaz 0257-05

Chromoblastomycosis

Human, male

Mexico, Mexico City

5c

F. pedrosoi

CBS 122346

dH 18913, Bonifaz 333-05

Chromoblastomycosis

Human, male

Mexico, Mexico City

5c

F. pedrosoi

CBS 253.49

dH 15620

Chromoblastomycosis

Human

Uruguay, Montevideo

5

F. pedrosoi

CBS 201.31

dH 15523

Gazelle, ear

Animal

Libya, Cyrenaica, Derna

5

*ATCC, American Type Culture Collection, Manassas, VA, USA; CBS, Centraalbureau voor Schimmelcultures, Utrecht, the Netherlands; dH, G.S. de Hoog working collection; SUMS, Sun Yat-Sen University Medical Science, Guangzhou, People´s Republic of China; IMI, International Mycological Institute, London, UK; UTHSC, Fungus Testing Laboratory, Department of Pathology, University of Texas Health Science Center at San Antonio, San Antonio, TX, USA

68

Molecular Epidemiology of Fonsecaea Species

AFLP fingerprinting We followed a protocol provided by the manufacturer (Applied Biosystems, Nieuwerkerk aan de IJssel, the Netherlands), with some minor modifications (20–23). Analyses were performed with 100–200 ng DNA. Restriction and ligation of adaptors Two μL of DNA (100 ng/μL) was added to 9 μL restriction and ligation mixture (1.1 μL T4 DNA ligase buffer [Applied Biosystems]), 1.1 μL M NaCl, 2 U MseI endonuclease, 10 U EcoRI endonuclease (New England Biolabs, Ipswich, UK), 30 U T4 DNA ligase, 1 μL MseI-adaptor, 1 μL EcoRI-adaptor, and 3 μL dH20 and incubated at 37°C for 2.5 h. Subsequently, each restriction/ligation reaction was diluted ≈3× by adding 25 μL demineralized water.

AFLP analysis FAM-labeled products were prepared for analysis in an ABI PRISM 377 Genetic Analyzer (Applied Biosystems) as follows: the selective PCR products were cleaned with Sephadex G-50, and selective PCR products were mixed with LIZ 500 in the new plate by several times pipetting (first by preparing master mix [8.7 μL demineralized water plus 0.3 μL Liz 500], then mixing this with 1.0 μL of selective PCR product by pipetting). The total volume was adjusted to 10 μL with dH2O. Denaturation was done at 95°C for 5 min, and then the reaction was snap-cooled on ice water. The LIZ 500 internal size standard in each sample was used for normalization of the fingerprint pattern according to the instruction manual. The densitometric curves were analyzed with BioNumerics software package (version 4.61, Applied Maths, Kortrijk, Belgium), by using the cosine similarity coefficient and the unweighted pair group method with arithmetic means cluster analysis. Statistical reliability of the cluster was investigated by using a cophenetic value, which calculates the correlation between the calculated and the dendrogram-derived similarity. Subdivisions in clusters were checked visually if they were supported by the banding patterns. 69

Chapter 5

Preselective and selective PCR In preselective PCR, 2 μL of diluted restriction/ligation product was added to 7.5 μL of AFLP core mix (Applied Biosystems), 0.25 μL of the EcoRI core sequence (5´- GAC TGC GTA CCA ATTC-3´), and 0.25 μL of the MseI core sequence (5´-GAT GAG TCC TGA GTAA-3´). The mixture was amplified in an iCycler (Bio-Rad, Hercules, CA, USA) under the following conditions: 2 min at 72°C, followed by 20 cycles of 20 s at 94°C, 30 s at 56°C, and 2 min at 72°C. Each preselective PCR was diluted 2× by adding 10 μL of dH2O. In selective PCR, 1.5 μL of diluted preselective PCR products was mixed with 8.5 selective PCR mix containing 0.5 μL EcoRI-AC (labeled with FAM [6-carboxy fluorescein]), 0.5 μL MseI-A, and 7.5 μL AFLP core mix (Applied Biosystems). The selective PCR conditions were cycling for 2 min at 94°C, followed by 10 cycles of 20 s at 94°C and 30 s at 66°C (decreasing 1°C with each subsequent cycle), and a final extension of 2 min at 72°C. This sequence was followed by 25 cycles of 20 s at 94°C, 30 s at 56°C, and 2 min at 72°C, and a final incubation of 30 min at 60°C.

Chapter 5

Results Profiles of 81 strains were generated with the EcoRI AC + MseI-A PCR adaptors. Fingerprints contained ≈60–70 bands in a 50–500-bp range. Another selective PCR with EcoRI core sequence+C and MseI core sequence+A primer combination used elsewhere in related fungi (24) resulted in nonscorable fingerprints because of amplification of too many or only faint bands. Dendrograms derived from the AFLP banding patterns of Fonsecaea spp. were generated by using the unweighted pair group method with arithmetic means cluster analysis (Fig. 1). At ≥62.5% similarity, 3 main clusters were found that matched with existing species on the basis of multilocus sequence analysis (ITS, cdc42, BT2, and ACT1), i.e., F. pedrosoi, F. monophora, and F. nubica. At an automatic cutoff value option set at 71.7% (Fig. 1, Table 1) were mostly collected at close geographic distance from each other. This finding suggests that vectors of dispersal for Fonsecaea spp. are slow, leading to detectable regional diversification. The relatively low degree of variation of F. pedrosoi and confinement to Central and South America indicate a founder effect, the species being the most recently emerged taxon in Fonsecaea. F. monophora and F. nubica were distributed worldwide but were geographically diverse in that population 4 of F. monophora was nearly confined to China, with highly similar profiles (Fig. 1). One strain of this population 4, CBS 117238, originated from a brain infection in a human in the United Kingdom; whether this patient had emigrated from China could not be determined from the original publication (25). F. monophora population 3 was found mainly in the Western Hemisphere, particularly in Brazil. Judging from the near identity of profiles of strains isolated in 1937 (CBS 271.37) and in 1999 (CBS 102245) (Fig. 1), we can conclude that clones are maintained locally over decades. The 2 US strains presumably derived from immigrants from South America or Central America. Population 3 was also found in Africa and in Haikou in China, 600 km from Guangdong, where population 4 of F. monophora is prevalent. Strains of F. nubica show a similar bipartition over Asia and the Western Hemisphere, with a prevalently Chinese (population 1) and a prevalently Brazilian (population 2) population, and a presumed infected immigrant in France. Kawasaki et al. (31,32) provided similar data on the basis of restriction fragmentlength polymorphism of mitochondrial DNA, showing that Fonsecaea spp. from Japan and China iffered consistently from isolates from Central and South America. Nearly all Fonsecaea spp. isolates available in culture collections originate from mammals, mostly humans with chromoblastomycosis, and were rarely recovered from the environment of symptomatic patients despite several attempts (33). Occasionally, F. pedrosoi was isolated from mice that were euthanized for isolation of black yeasts after they had been inoculated with environmental samples (34). This information suggests that Fonsecaea spp., particularly F. pedrosoi, have a competitive advantage by using this enrichment source. Mouse passage proved to be more efficient for environmental isolation of etiologic agents of chromoblastomycosis than general methods such as oil flotation (35). The latter technique mostly isolates other environmental Fonsecaea spp. that are not known to be pathogenic to humans (33). In humans with chromoblastomycosis, the male:female ratio of patients is 63:2. This male preponderance of 97% cannot be explained by different exposition rates. Distinct male preponderance is also noted in the neurotropic relative, Cladophialophora bantiana (G.S. de Hoog, unpub. data). Population 3 of F. monophora has a wider clinical

Chapter 5

spectrum than the remaining groups, comprising, in addition to chromoblastomycosis, several isolates from human brain infection. This population also comprised some isolates from soil and plant debris acquired without use of mammal baits. Coexistence of closely interrelated entities differing in pathogenicity and virulence seems likely in Fonsecaea spp., as was also suggested for black yeasts (A.H.G. Gerrits van den Ende et al. unpub. data). Our data demonstrate that AFLP fingerprinting is a tool that produces highly reproducible results for molecular epidemiology. The use of AFLP showed that local Fonsecaea agents of chromoblastomycosis seem able to be maintained over 70 years, and therefore epidemiologic profiles take the structure of expanding clones. By locality, patients are infected by only a limited number of genotypes. The fungi disperse slowly, leading to appreciable geographic structuring, which ultimately may lead to allopatric speciation (diversification resulting from geographic barriers). Few environmental strains have been recovered during repeated isolation experiments, whereas Fonsecaea spp. accumulates substantially in the human host. The mechanisms behind their pathology remain unexplained. Acknowledgments We are grateful to Liyan Xi and Flavio Queiroz-Telles for providing Fonsecaea spp. strains. M.J.N. was supported by the Ministry of Health and Medical Education of Iran and Mashhad University of Medical Sciences, Mashhad, Iran. J.S. was partly supported by International Program of Project 985, Sun Yat-Sen University, China. V.A.V. was supported by Coordenação de Aperfeiçoamento Pessoal de Nivel Superior/Brazil. References 1. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol. 2009;47:3–15. 2. López Martínez R, Méndez Tovar LJ. Chromoblastomycosis. Clin Dermatol. 2007;25:188–94. 3. Bonifaz A, Carrasco-Gerard E, Saul A. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses. 2001;44:1–7. 4. Yegres FR-YN, Medina-Ruiz E, González-Vivas R. Cromomicosis por Cladosporium carrionii en criadores de caprinos del estado Falcon. Investigación Clinica. 1985;26:235–46. 5. Yegüez-Rodriguez J R-YN, Yegres F, Rodríguez Larralde A. Cromomicosis: susceptibilidad genética en grupos familiares de la zona endémica en Venezuela. Acta Científica Venezuelana 1992;43:98– 102 6. Esterre P, Andriantsimahavandy A, Ramarcel ER, Pecarrere JL. Forty years of chromoblastomycosis in Madagascar: a review. Am J Trop Med Hyg. 1996;55:45–7. 7. Kombila M, Gomez de Diaz M, Richard-Lenoble D, Renders A, Walter P, Billiault X, et al. Chromoblastomycosis in Gabon. Study of 64 cases [in French]. Sante. 1995;5:235–44. 8. Silva JP, de Souza W, Rozental S. Chromoblastomycosis: a retrospective study of 325 cases on Amazonic Region (Brazil). Mycopathologia. 1998–1999;143:171–5. 9. Attapattu MC. Chromoblastomycosis—a clinical and mycological study of 71 cases from Sri Lanka. Mycopathologia. 1997;137:145– 51. 10. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol. 2009;47:17–25. 11. Xi L, Sun J, Lu C, Liu H, Xie Z, Fukushima K, et al. Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol. 2009;47:27–33. 12. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHGG, de Hoog GS. Biodiversity of the genus Cladophialophora. Stud Mycol. 2008;61:175–91. 13. de Hoog GS, Attili-Angelis D, Vicente VA, Gerrits Gerrits van den Ende AHGG, Queiroz-Telles F. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol. 2004;42:405–16.

74

Molecular Epidemiology of Fonsecaea Species

75

Chapter 5

14. Najafzadeh MJ, Sun J, Vicente V, Xi L, Gerrits van den Ende AHG, de Hoog GS. Fonsecaea nubica sp. nov, a new agent of human chromoblastomycosis revealed using molecular data. Med Mycol. 2010;48:800–6. 15. de Hoog GS, Nishikaku AS, Fernandez-Zeppenfeldt G, Padin-Gonzalez C, Burger E, Badali H, et al. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud Mycol. 2007;58:219–34. 16. Nishimoto K. Chromomycosis in Japan. Ann Soc Belg Med Trop. 1981;61:405–12. 17. Klaassen CHW, Osherov N. Aspergillus strain typing in the genomics era. Stud Mycol. 2007;59:47–51. 18. Borst A, Theelen B, Reinders E, Boekhout T, Fluit AC, Savelkoul PH. Use of amplified fragment length polymorphism analysis to identify medically important Candida spp., including C. dubliniensis. J Clin Microbiol. 2003;41:1357–62. 19. Warris A, Klaassen CH, Meis JF, De Ruiter MT, De Valk HA, Abrahamsen TG, et al. Molecular epidemiology of Aspergillus fumigates isolates recovered from water, air, and patients shows two clusters of genetically distinct strains. J Clin Microbiol. 2003;41:4101–6. 20. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, et al. Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology. 2001;147:891–907. 21. Theelen B, Silvestri M, Gueho E, van Belkum A, Boekhout T. Identification and typing of Malassezia yeasts using amplifi ed fragment length polymorphism (AFLP), random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE). FEM Yeast Res. 2001;1:79–86. 22. Ball LM, Bes MA, Theelen B, Boekhout T, Egeler RM, Kuijper EJ. Significance of amplified fragment length polymorphism in identification and epidemiological examination of Candida species colonization in children undergoing allogeneic stem cell transplantation. J Clin Microbiol. 2004;42:1673–9. 23. Gupta AK, Boekhout T, Theelen B, Summerbell R, Batra R. Identification and typing of Malassezia species by amplifi ed fragment length polymorphism and sequence analyses of the internal transcribed spacer and largesubunit regions of ribosomal DNA. J Clin Microbiol. 2004;42:4253–60. 24. Sudhadham M, de Hoog GS, Menken SBJ, Gerrits Gerrits van den Ende AHGG, Sihanonth P. Elucidation of distribution patterns and possible infection routes of the neutropic black yeast Exophiala dermatitidis using AFLP. Fungal Biol. 2011. In press. 25. Najafzadeh MJ, Rezusta A, Cameo MI, Zubiri ML, Yus MC, Badali H, et al. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol. 2010;48:390–3. 26. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP. Cerebral phaeohyphomycosis caused by Fonsecaea monophora.Med Mycol. 2005;43:465–72. 27. Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, et al. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 1995;23:4407–14. 28. Mueller UG, Wolfenbarger LL. AFLP genotyping and fingerprinting. Trends Ecol Evol. 1999;14:389–94. 29. Neyra E, Fonteyne PA, Swinne D, Fauche F, Bustamante B, Nolard N. Epidemiology of human sporotrichosis investigated by amplified fragment length polymorphism. J Clin Microbiol. 2005;43:1348–52. 30. Savelkoul PH, Aarts HJ, de Haas J, Dijkshoorn L, Duim B, Otsen M, et al. Amplified-fragment length polymorphism analysis: the state of an art. J Clin Microbiol. 1999;37:3083–91. 31. Kawasaki M, Aoki M, Ishizaki H, Miyaji M, Nishimura K, Nishimoto K, et al. Molecular epidemiology of Fonsecaea pedrosoi using mitochondrial DNA analysis. Med Mycol. 1999;37:435–40. 32. Kawasaki M. Typing and molecular epidemiology of some black fungi based on analysis of the restriction fragment length polymorphism in the mitochondrial DNA. Jpn J Med Mycol. 1996;37:129– 33. 33. Vicente VA, Attili-Angelis D, Pie MR, Queiroz-Telles F, Cruz LM, Najafzadeh MJ, et al. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol. 2008;61:137–44. 34. Gezuele E, Mackinnon JE, Conti-Diaz IA. The frequent isolation of Phialophora verrucosa and Phialophora pedrosoi from natural sources. Sabouraudia. 1972;10:266–73. 35. Satow MM, Attili-Angelis D, de Hoog GS, Angelis DF, Vicente VA. Selective factors involved in oil fl otation isolation of black yeasts from the environment. Stud Mycol. 2008;61:157–63.

76

Chapter

6

Rapid detection of pathogenic fungi using loop-mediated isothermal amplification, exemplified by Fonsecaea agents of chromoblastomycosis J. Sun1, M. J. Najafzadeh2, 3, 4, V.A. Vicente5, Liyan Xi1 & G. S. de Hoog1, 2, 6*

Department of Dermatology, The Second Affiliated Hospital, Sun Yat–Sen University, Guangzhou, China, 2CBS– KNAW Fungal Biodiversity Centre, Utrecht, The Netherland, 3Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands, 4Department of Parasitology and Mycology, Faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil, 6Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China 1

*Correspondence: G. S. de Hoog, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Tel.: +31 30 2122 663; fax: +31 30 251 2097; E-mail: de.hoog@cbs. knaw.nl Published in: J Microbiol Methods. 2010 Jan; 80(1): 19-24.

77

Chapter 6

Abstract Loop-mediated isothermal amplification (LAMP) was developed for rapid detection of pathogenic or allergenic fungal in the environment. Primers applied were derived from the rDNA Internal Transcribed Spacer and the 5.8S rRNA gene. The assay enabled amplification of target fungi at the level of genus or closely related species using pure cultures after 1 h reaction at 65°C in a water bath. No cross-reactivity to related species was observed. The DNA detection limit was 0.2 fg. The method also proved to work well with fungi on non-sterile adhesive tape. Amplification products were detected by visual inspection using SYBR Green I as well as by electrophoresis on agarose gels. As a model organism we selected Fonsecaea, a fungal genus containing etiologic agents of chromoblastomycosis, a widely distributed tropical and subtropical skin disease in otherwise healthy patients and supposed to be acquired by environmental inoculation. It is suggested that LAMP can also be used for rapid clinical diagnosis, for environmental detection, and for retrospective studies in archived clinical samples. Key words: Chromoblastomycosis, Fonsecaea, diagnosis, LAMP

Introduction Environmental detection of detrimental fungi is of major significance for understanding a wide diversity of problems related to public health. For example, fungi may contribute to allergic responses of patients due to overabundance of moulds in indoor environments (Beezhold et al. 2008). Locating the source of mycotoxin-producing Stachybotrys species occurring in moist homes is urgent (Kuhn & Ghannoum, 2003). Hygienic questions also arise with dermatophyte contamination of public bathing facilities such as swimming pools (Hilmarsdottir et al. 2005). Preventive measures against fungal opportunists require understanding of routes of infection, for which extensive studies on natural habitats and methods of dispersal are undertaken (Sudhadham et al. 2008). Numerous investigations have been carried out to locate the ecological niche of pathogens such as Cryptococcus gattii (Datta et al. 2009) and Penicillium marneffei (Chariyalertsak et al. 1997). Quite often, the fungi in question grow in culture only with difficulty or are unculturable (Bougoure and Cairney, 2005). In view of these problems, isolation and culturing may be far from optimal (Elliott et al. 2006), for which reason molecular detection is recommended. In the present article, we apply a recently proposed method, loop-mediated isothermal amplification (LAMP), which is rapid and allows only minute amounts of DNA, to detection of a group of pathogenic fungi. The method is demonstrated here using potential agents of a skin disease, chromoblastomycosis, a relatively frequent disorder in (sub) tropical climate zones (QueirozTelles et al. 2009). The spectrum of species causing this disease is very limited: in addition to Fonsecaea species, mainly Cladophialophora carrionii (Badali et al. 2008), Phialophora verrucosa (Guerriero et al. 1998), Rhinocladiella aquaspersa (Badali et al. in press) and some scattered cases of Exophiala (Barba- Gomez et al. 1992; De Hoog et al. 2000, Fader and McGinnis,

78

LAMP screening of pathogens

Material and methods Strains and culture conditions Twelve strains of Fonsecaea pedrosoi, 27 of F.monophora, 8 of F. nubica and 61 reference strains of 36 related melanized fungi (Table 1) were obtained from the reference collection

79

Chapter 6

1988; Padhye et al. 1996) are involved. The genus Fonsecaea comprises two sibling species, F. pedrosoi and F. monophora (de Hoog et al. 2004; Najafzadeh et al. 2009a), while recently a third one was proposed (Najafzadeh et al. 2010). Fonsecaea monophora has repeatedly been found, in addition to causing chromoblastomycosis, as an agent of brain infection (Najafzadeh et al. in press-a,b; Surash et al. 2005). Laboratory diagnosis of chromoblastomycosis is based on microscopy of the muriform cells in tissue and skin scrapings. Morphologic characteristics and antigen detection have also been developed for the identification of F. pedrosoi (Carrión and Silva-Hutner, 1971; da Silva et al. 2002; Iwatsu et al. 1982; Vidal et al. 2004), but these methods are time-consuming and have low specificity. Polymerase chain reaction has been developed for rapid detection of several dematiaceous fungi including members of Fonsecaea (Abliz et al. 2003a,b, 2004a; Caligiorne et al. 1999; De Andrade et al. 2007; Karuppayil et al. 1996). The disease is supposed to be acquired by traumatic inoculation of contaminated material into the skin (Rubin et al. 1991). Origins have been supposed to be prickly plant spines such as cactus (Fernández-Zeppenfeldt et al. 1994) or Mimosa (Salgado et al. 2004). However, several authors (de Hoog et al. 2007; Vicente et al. 2008) report that most fungi isolated from nature concern less virulent siblings of the pathogenic species concerned, rather than the pathogens themselves. Detection of the true agents of disease in the environment thus remains overdue. Loop-mediated isothermal amplification (LAMP) was firstly described and initially evaluated for detection of hepatitis B virus DNA by Notomi et al. (2000). This novel nucleic acid mplification method can amplify DNA with high specificity, efficiency and rapidity under isothermal conditions. The cycling reactions result in the accumulation of 109 to 1010fold copies of target in less than an hour. The amplification products can be easily detected by visual assessment of turbidity, electrophoresis or by the naked eye. The sensitivity of LAMP appears not to be affected by the presence of non-target DNA in samples, neither by known PCR inhibitors such as blood, serum, plasma, or heparin (Enosawa et al. 2003; Notomi et al. 2000; Poon et al. 2005). For this reason the method is very promising as a tool for environmental detection of microorganisms. LAMP assays have been used for diagnostics of bacteria (Aoi et al. 2006; Iwamoto et al. 2003; Yoshida et al. 2005), virus (Cai et al. 2008; Hagiwara et al. 2007) and parasites (Ikadai et al. 2004; Iseki et al. 2007), but only rarely for fungi (Endo et al. 2004; Inacio et al. 2008; Ohori et al. 2006). In the present study, we developed a sensitive, specific and rapid method for the detection of members of the genus Fonsecaea by LAMP, in the laboratory as well as on non-sterile adhesive tape widely used for environmental screening.

Chapter 6

of the Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre and grown on Malt Extract Agar (MEA) at 25°C for 14 days. DNA extraction and quality test Approximately 0.5 g mycelium of 14-d-old cultures was transferred to a 2 ml Eppendorf tube containing 400 μl TEx buffer pH 9.0 (100 mM Tris, 40 mM Na-EDTA) and glass beads (Sigma G9143). The fungal material was homogenized with MoBio vortex (Bohemia, New York, U.S.A.) for 1 min. Subsequently 120 μl SDS 10% and 10 μl proteinase K (10 mg/ml) were added and incubated for 30 min at 55°C; the mixture was vortexed for 3 min. After addition of 120 μl of 5 M NaCl and 1/10 vol CTAB 10% (cetyltrimethylammoniumbromide) solution, the material was incubated for 60 min at 55°C. Then the mixture was vortexed for 3 min. Subsequently 700 μl SEVAG (24:1, chloroform:isoamylalcohol) was added, mixed carefully by hand and centrifuged for 5 min at 4°C at 20,400g force value. The supernatant was transferred to a new Eppendorf tube with 225 μl 5 M NH4- acetate, incubated for 30 min on ice water, and spun for 5 min at 4°C at 20,400 g force value. The supernatant was then transferred to another Eppendorf tube with 0.55 vol isopropanol and centrifuged for 5 min at 20,400 g force value. Finally, the pellet was washed with 1000 μl ice cold 70% ethanol. After drying at room temperature, it was re-suspended in 48.5 μl TE buffer (Tris 0.12% w/v, NaEDTA 0.04% w/v). The DNA concentration was detected with nano-drop DNA concentration detector at 260 nm (Thermo Scientific, U.S.A.). Identities of strains were verified by ITS sequencing as described (Najafzadeh et al. 2009a, in press-a) using the database validated by type-material, followed by BLAST analysis in GenBank (www.blast.ncbi.nlm.nih.gov). Sevenday-old colonies of F. monophora CBS 269.37, F. pedrosoi CBS 271.37, F. nubica CBS 121733 and Exophiala dermatitidis CBS 537.73 were used for in situ fungal detection. About 1 cm2 non-sterile adhesive tape was used to collect minute amounts of fungal cells. The colony was gently touched with adhesive tape, and then the tape was transferred into a 2 ml Eppendorf tube containing 300 μl TES buffer to extract DNA, procedures were identical to those of DNA extraction from pure cultures. To test the presence of trace DNA, the internally transcribed spacer (ITS) region of samples was amplified by nested PCR with primer V9G and LS266 in the first run, while primers ITS1 and ITS4 were used in the second run. Amplification conditions were described previously (Najafzadeh et al. 2009a). Primer design and LAMP reaction For primer design, the Internally Transcribed Spacer and 5.8S rDNA gene of 39 species were aligned using Bionumerics software v. 4.6 (Applied Maths, Kortrijk, Belgium). One set of LAMP primers was selected for F. pedrosoi CBS 271.37 using PrimerExplorer v. 4 (http:// primerexplorer.jp), as follows: forward outer primer (F3): 5´ACATTGCGCCCTTTGGTAT3´, reverse outer (B3): 5´GCACCCTTCATCCGATACG3´, forward inner primer (FIP): 5´CAACACCAAGCACAGGGGCTTTTTCGAAGGGCATGCCTGTTC3´, reverse inner primer (BIP): 5´TGGTGGAGCGAGTTCACACTTTTTTTAAAGAAGCTCAGTGTACCGG3´. LAMP was performed in a 25 μl reaction volume containing 0.25 μM each of F3 and B3, 1.0 μM each of 80

LAMP screening of pathogens

FIP and BIP, 1.0 mM dNTPs, 1 M betaine (Sigma, U.S.A.), 20 mM Tris–HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 4 mM MgSO4, 0.1% Triton X-100, 8 U of the Bst DNA polymerase large fragment (New England Biolabs, U.S.A.), and 2 μl crude DNA extract as template. The reaction mixture except Bst DNA polymerase was denatured at 95°C for 5 min and cooled on ice, then 1 μl Bst DNA polymerase was added and incubated at 65°C for 60 min, and finally heated at 85°C for 2 min to terminate the reaction. Sensitivity and specificity assay DNAs of 12 F. pedrosoi, 27 F. monophora, 8 F. nubica and 61 reference strains were used as templates; DNA of F. pedrosoi CBS 271.37 and a reaction mixture without DNA were used as controls. Sensitivity was tested by a 10-fold DNA dilution series of CBS 271.37 from 2 ng to 0.002 fg with conditions identical to those of the specificity assay. To evaluate the inhibition of non-target DNA, each of the 2 μl crude extract DNA of F. pedrosoi was added to the LAMP negative samples, and tested again by LAMP.

Results The LAMP assay could be performed within 1 h at 65°C in a water bath. LAMP products were visualized directly by the naked eye or under UV trans-illumination after adding SYBR Green I dye, positive reactions showing bright green fluorescence, while a negative reaction remained light orange (Fig. 1). Prior to the addition of SYBR Green I, white turbidity of the reaction mixture by magnesium pyrophosphate (by-product of LAMP) was also observed (data not shown). The products of LAMP reaction could also be detected by electrophoresis on 1% agarose gels, and showed ladder-like patterns (Fig. 2). Positive results were obtained with F. pedrosoi (lane 1), F. monophora (lane 2) and F. nubica (lane 3), while all reactions with fungi included for comparison (Table 1) remained negative, with a response identical to the negative control. The specificity assay thus showed that positive amplification is obtained with the genus Fonsecaea but not in any other member of Chaetothyriales (black yeasts and relatives) (Table 1). The detection limit was found to be 0.2 fg (Fig. 3). The inhibition test showed that all LAMP-negative samples turned positive after the addition of 2 μl crude DNA solution of F. pedrosoi or F. monophora, LAMP reaction was not inhibited by other fungal DNA. To evaluate the potential application of this LAMP assay in screening possible pathogens in environmental samples, minute amounts of fungal cells were adhered to non-sterile adhesive tape by gently pressing a fungal colony; subsequently the DNA was extracted successfully. 81

Chapter 6

Observation of LAMP products The LAMP reaction products were detected by adding 2.0 μl of 10-fold diluted original SYBR Green I (Cambrex Bio Science Workingham, U.K.) to the reaction tube separately. Change of the solution color was observed directly by naked eye or using a UV transilluminator. Amplified products were also analyzed by electrophoresis on 1% agarose gels, followed by ethidium bromide staining and photography. Smart DNA ladder (Eurogentec, Seraing, Belgium) was used as a molecular weight standard.

Chapter 6

Fig 1. Visual appearance of LAMP reactions from isolates after addition of SYBR Green I. Panel A: Fonsecaea pedrosoi (tube 1), F. monophora (tube 2), F. nubica (tube 3), negative control (tube 4) and tube without DNA templates (tube 5). Panel B: under UV transillumination, F. pedrosoi (tube 6), F. monophora tube 7), F. nubica (tube 8), negative control (tube 9) and tube without DNA templates (tube 10).

Table 1. Isolates used in this study with resultsof ITS amplification and LAMP test Species F. pedrosoi

F. monophora

CBS Number

ITSPCR

LAMP

Species

CBS Number

ITSPCR

LAMP

CBS122741

+

+

CBS 121724

+

+

CBS 122740

+

+

CBS 121725

+

+

CBS 671.66

+

+

CBS 121726

+

+

CBS 274.66

+

+

CBS 121727

+

+

CBS 273.66

+

+

CBS 121728

+

+

CBS 253.49

+

+

CBS 121729

+

+

CBS 212.77

+

+

CBS 121730

+

+

CBS 102247

+

+

CBS 121731

+

+

CBS 102245

+

+

CBS 121732

+

+

CBS 201.31

+

+

CBS 117236

+

+

CBS 670.66

+

+

CBS 102229

+

+

CBS 271.37b(T)

+

+

CBS121733(T)

+

+

CBS 102238

+

+

CBS121734

+

+

CBS 102242

+

+

CBS121720

+

+

CBS 102246

+

+

CBS444.62

+

+

CBS 102248

+

+

CBS269.64

+

+

CBS 117238

+

+

CBS277.29

+

+

CBS 269.37(T)

+

+

CBS117910

+

+

CBS 289.93

+

+

CBS271.33

+

+

CBS 397.48

+

+

CBS117900

+

-

CBS 117542

+

+

CBS 117237

+

+

CBS160.54

+

-

CBS 122742

+

+

CBS 160.82 (T)

+

-

CBS 122845

+

+

CBS101252

+

-

CBS 123849

+

+

CBS100429

+

-

CBS 121721

+

+

CBS328.65

+

-

CBS 121722

+

+

CBS444.96

+

-

CBS 121723

+

+

CBS173.52 (T)

+

-

F. nubica

Cladophialophora carrionii

C. bantiana

82

LAMP screening of pathogens

Table 1.(continued) Species C. emmonsii

CBS Number

ITSPCR

LAMP

Species

CBS Number

ITSPCR

LAMP

+

-

CBS 292.49

+

-

+

-

CBS 100341

+

-

C. minourae

CBS556.83 (T)

+

-

CBS 709.95

+

-

C. mycetomatis

CBS454.82

+

-

E. moniliae

CBS 520.76

+

-

CBS122637(T)

+

-

E. alcalophila

CBS 520.82

+

-

CBS114405

+

-

E .leacnii-comi

CBS 232.39

+

-

CBS 114406

+

-

E. prototropha

CBS 534.94

+

-

CBS 114326

+

-

Capronia moravica

CBS 602.96

+

-

CBS 109628

+

-

CBS 552.79

+

-

CBS 834.96 (T)

+

-

Cap. coronata

CBS 617.96

+

-

CBS 110551

+

-

Cap.epimyces

CBS 606.96

+

-

CBS 102227

+

-

Cap. munkii

CBS 615.96

+

-

CBS 661.76

+

-

Cap. acutisela

CBS 618.96

+

-

CBS 537.73

+

-

Cap. villosa

CBS 616.96

+

-

CBS 660.76

+

-

Cap.fungicola

CBS 614.96

+

-

CBS 899.68

+

-

Cap .pulcherrima

CBS 609.96

+

-

CBS 668.76

+

-

Cap.dactylotricha

CBS 604.96

+

-

CBS 101538

+

-

CBS 650.93(T)

+

-

E. jeanselmei

CBS 507.90(T)

+

-

Rhinocladiella mackenziei

E. heteromorpha

CBS 579.76

+

-

Phaeococcomyces catenats

CBS 650.76

+

-

Phialophora americana

CBS 840.69(T)

+

-

CBS 102233

+

-

CBS 273.37

+

-

CBS 102234

+

-

CBS 839.69

+

-

CBS 131.88

+

-

C. yegresii

C. satumica

C. immuda

Exophiala pisciphila

E .spinifera

E. castellanii

CBS 525.76

+

-

CBS 526.76

+

-

E. nigra

CBS 546.82

+

-

E . oligosperma

CBS 725.88(T)

+

-

E . salmonis E . dopicola E . dermatitidis

CBS 587.66 CBS 537.94

+ +

P. verrucosa

-

CBS 207.35

+

-

CBS 120440

+

-

Exophiala phaeomuriformis

Positive ITS-PCR was used as criterion for DNA quality of the sample. Abbreviations used: CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; T, ex-type strain.

This direct trace DNA test on in situ environmental samples showed that the fungal DNA from members of the genus Fonsecaea could be detected by nested PCR but not by direct PCR (Table 2). The LAMP in situ Fonsecaea assay remained negative for Exophiala dermatitis. Discussion LAMP is a powerful innovative gene amplification technique emerging as a simple and rapid diagnostic tool for early detection and identification of microbial agents of disease. The echnique was firstly described and initially evaluated for detection of hepatitis B virus DNA by Notomi et al. (2000) and depends on the Bst DNA polymerase performing autocycling strand displacement DNA synthesis. A set of four or six specific primers recognize six or 83

Chapter 6

CBS678.79 CBS 979.96 (T)

Chapter 6

Table 2. Results of detection of minute amounts of fungal DNA in non-sterile adhesive tape samples by nested-PCR and LAMP. Species

Strain

Nested-PCR

LAMP

First run

Second run

F. monophora

CBS 269.37 (T)

-

+

+

F. pedrosoi

CBS 271.37 (T)

-

+

+

F . nubica

CBS 121733 (T)

-

+

+

E. dermatidis

CBS 537.73 (T)

-

+

-

Abbreviation used: CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; T, ex-type strain.

eight distinct sequences of the target DNA. The cycling reactions result in billions of copies of target gene within an hour at isothermal conditions. With recent improvements (Boehme et al. 2007) and combination with hybridization (Nagamine et al. 2002), ELISA (Lee et al. 2009) and rolling circle amplification (Marciniak et al. 2008) the value of the method as a potential technique for the detection minute quantities of DNA and protein has increased. We used the fungal genus Fonsecaea as a set of model organisms, because it is relatively homogeneous in its ecological and clinical preferences and taxonomically well-demarcated containing three species only. Cladistic analysis of the genes coding for small-subunit rRNA (SSU rDNA) supported a close relationship of Fonsecaea with other dematiaceous hyphomycetes of the order Chaetothyriales in the form-genera Exophiala, Phialophora, and Rhinocladiella (Spatafora et al. 1995). Sequence analysis of total-SSU and of the D1/D2 domains of LSU ribosomal DNA showed that between some of the close relatives of black yeast-like fungi the diversity may be extremely small: as few as 0 changes were detected between species of Fonsecaea, some Exophiala species, and Cladophialophora bantiana, while two mutations were observed with P. verrucosa (Abliz et al. 2004b). SSU and LSU obviously are insufficiently variable for the identification of pathogenic melanized fungi and relevant species in sequencing analysis. Zeng & de Hoog (2008) demonstrated that in melanized pathogens the rDNA ITS region is much more useful as a specific marker. This domain has been used to identify anamorphs of Chaetothyriales including the genus Fonsecaea (Abliz et al. 2003b; Chen et al. 2001; da Silva et al. 2002; de Andrade et al. 2007; Iwen et al. 2002;

Fig 2. Agarose gel electrophoresis of LAMP products from tested strains obtained after application of the primer set designed in this work. Left to right: lane “M” Smart DNA marker; lane 1, negative control without DNA; lane 2, F. pedrosoi; lane 3, F. monophora; lane 4, F. nubica; lanes 5–40, Cladophialophora carrionii, C. bantiana, C. emmonsii, C. minourae, C. mycetomatis, C. yegresii, C. satumica, C. immuda, Exophiala pisciphila, E. spinifera, E. jeanselmei, E. heteromorpha, E. castellanii, E. nigra, E. oligosperma, E. salmonis, E. dopicola, E. dermatitidis, E. moniliae, E. alcalophila, E. lecanii-corni, E. prototropha, Capronia moravica, Cap. coronata, Cap. epimyces, Cap. munkii, Cap. acutisela, Cap. villosa, Cap. fungicola, Cap. pulcherrima, Cap. dactylotricha, Rhinocladiella mackenziei, Phaeococcomyces catenatus, Phialophora americana, P. verrucosa, Exophiala phaeomuriformis.

84

LAMP screening of pathogens

Fig 3.  Analytical sensitivity of LAMP for detection of the ITS rDNA gene. Left to right: Lane “M”, Smart DNA ladder; lanes 1–10, 2 ng, 200 pg, 20 pg, 2 pg, 200 fg, 20 fg, 2 fg, 0.2 fg, 0.02 fg, 0.002 fg/tube, respectively.

Acknowledgements This work was supported by the International Program of Project 985, Sun Yat-Sen University and a Public Health Project Funded by the Ministry of Health of the People´s Republic of China (no. 200802026). EU support to GSdH (contract No. 017626) is gratefully acknowledged. References Abliz, P., Fukushima, K., Takizawa, K., Miyaji, M., Nishimura, K., 2003a. Specific oligonucleotide primers for identification of Hortaea werneckii, a causative agent of tinea nigra. Diagn. Microbiol. Infect. Dis. 46, 89–93. Abliz, P., Fukushima, K., Takizawa, K., Nieda, N., Miyaji, M., Nishimura, K., 2003b. Rapid identification of the genus Fonsecaea by PCR with specific oligonucleotide primers. J. Clin. Microbiol. 41, 873–876. Abliz, P., Fukushima, K., Takizawa, K., Nishimura, K., 2004a. Specific oligonucleotide primers for identification of Cladophialophora carrionii, a causative agent of chromoblastomycosis. J. Clin. Microbiol. 42, 404–407. Abliz, P., Fukushima, K., Takizawa, K., Nishimura, K., 2004b. Identification of pathogenic dematiaceous fungi and related taxa based on large subunit ribosomal DNA D1/D2 domain sequence analysis. FEMS Immunol. Med. Microbiol. 40, 41–49. Aoi, Y., Hosogai, M., Tsuneda, S., 2006. Real-time quantitative LAMP (loop-mediated isothermal amplification of 85

Chapter 6

Najafzadeh et al. 2009a). In this study, we proved that the LAMP technique successfully amplified DNA of the genus Fonsecaea but not of related fungi, such as C. carrionii, C. bantiana and P. verrucosa. In addition, it was not inhibited by the presence of other fungal DNA. The LAMP assay can be performed within 1 h at 65°C in a water bath, heating block or PCR machine, and the reaction products can easily be observed by electrophoresis or directly by the naked eye. The detection limit was found to be 0.2 fg. Moreover, our results proved that it could be used to detect minute amounts of fungi adhering to adhesive tapes applied to non-sterile surfaces with fungal colonization. Given its specificity, sensitivity, easy handing and cost-efficiency, the LAMP assay is judged to be suitable for a wide range of applications. In this paper it has been used for the detection of Fonsecaea, a pathogenic fungus that due to its simple morphology is difficult to identify by microscopic methods (de Hoog et al. 2004, Xi et al. 2009). In addition, in retrospective studies LAMP provides an accurate and specific procedure for the detection of the pathogen in archived samples. The limited need for equipment and techniques makes the LAMP assay suitable for diagnosis in a routine clinical laboratory.

Chapter 6

DNA) as a simple method for monitoring ammoniaoxidizing bacteria. J. Biotechnol. 125, 484–491. Badali, H., Gueidan, C., Najafzadeh, M.J., Bonifaz, A., Gerrits van den Ende, A.H.G., de Hoog, G.S., 2008. Biodiversity of the genus Cladophialophora. Stud. Mycol. 61, 175–191. Badali, H.B., A. Barrón-Tapia, T. Vázquez-González, D. Estrada-Aguilar, L. de Hoog, G. S., 2010. Rhinocladiella aquaspersa, a proven agent of human chromoblastomycosis and phaeohyphomycosis with novel clinical type. Med.Mycol. (in press) Barba-Gomez, J.F., Mayorga, J., McGinnis, M.R., Gonzalez-Mendoza, A., 1992. Chromoblastomycosis caused by Exophiala spinifera. J. Am. Acad. Dermatol. 26, 367–370. Beezhold, D.H., Green, B.J., Blachere, F.M., Schmechel, D., Weissman, D.N., Velickoff, D.,Hogan, M.B., Wilson, N.W., 2008. Prevalence of allergic sensitization to indoor fungi in West Virginia. Allergy Asthma. Proc. 29, 29–34. Boehme, C.C., Nabeta, P., Henostroza, G., Raqib, R., Rahim, Z., Gerhardt, M., Sanga, E., Hoelscher, M., Notomi, T., Hase, T., Perkins, M.D., 2007. Operational feasibility of using loop-mediated isothermal amplification for diagnosis of pulmonary tuberculosis in microscopy centers of developing countries. J. Clin. Microbiol. 45, 1936–1940. Bougoure, D.S., Cairney, J.W., 2005. Fungi associated with hair roots of Rhododendron lochiae (Ericaceae) in an Australian tropical cloud forest revealed by culturing and culture-independent molecular methods. Environ. Microbiol. 7, 1743–1754. Cai, T., Lou, G., Yang, J., Xu, D., Meng, Z., 2008. Development and evaluation of real-time loop-mediated isothermal amplification for hepatitis B virus DNA quantification: a new tool for HBV management. J. Clin. Virol. 41, 270–276. Caligiorne, R.B., de Resende, M.A., Dias-Neto, E., Oliveira, S.C., Azevedo, V., 1999. Dematiaceous fungal pathogens: analysis of ribosomal DNA gene polymorphism by polymerase chain reaction–restriction fragment length polymorphism. Mycoses. 42, 609–614. Carrión, A.L., Silva-Hutner, M., 1971. Taxonomic criteria for the fungi of chromoblastomycosis with reference to Fonsecaea pedrosoi. Int. J. Dermatol. 10, 35–43. Chariyalertsak, S., Sirisanthana, T., Supparatpinyo, K., Praparattanapan, J., Nelson, K.E., 1997. Case-control study of risk factors for Penicillium marneffei infection in human immunodeficiency virus-infected patients in northern Thailand. Clin. Infect. Dis. 24, 1080–1086. Chen, Y.C., Eisner, J.D., Kattar, M.M., Rassoulian-Barrett, S.L., Lafe, K., Bui, U., Limaye, A.P.,Cookson, B.T., 2001. Polymorphic internal transcribed spacer region 1 DNA sequences identify medically important yeasts. J. Clin. Microbiol. 39, 4042–4051. da Silva, J.P., Alviano, D.S., Alviano, C.S., de Souza, W., Travassos, L.R., Diniz, J.A., Rozental, S., 2002. Comparison of Fonsecaea pedrosoi sclerotic cells obtained in vivo and in vitro: ultrastructure and antigenicity. FEMS Immunol. Med. Microbiol. 33, 63–69. Datta, K., Bartlett, K.H., Marr, K.A., 2009. Cryptococcus gattii: emergence in Western North America: exploitation of a novel ecological niche. Interdiscip. Perspect. Infect. Dis. 2009, 176532. De Andrade, T.S., Cury, A.E., de Castro, L.G., Hirata, M.H., Hirata, R.D., 2007. Rapid identification of Fonsecaea by duplex polymerase chain reaction in isolates from patients with chromoblastomycosis. Diagn. Microbiol. Infect. Dis. 57, 267–272. de Hoog, G.S., Queiroz-Telles, F., Haase, G., Fernandez-Zeppenfeldt, G., Attili Angelis, D., Gerrits van den Ende, A.H., Matos, T., Peltroche-Llacsahuanga, H., Pizzirani-Kleiner, A.A., Rainer, J., Richard-Yegres, N., Vicente, V., Yegres, F., 2000. Black fungi: clinical and pathogenic approaches. Med. Mycol. 38 (Suppl 1), 243–250. de Hoog, G.S., Attili-Angelis, D., Vicente, V.A., Gerrits van den Ende, A.H., Queiroz-Telles, F., 2004. Molecular ecology and pathogenic potential of Fonsecaea species. Med. Mycol. 42, 405–416. de Hoog, G.S., Nishikaku, A.S., Fernández-Zeppenfeldt, G., Padin-Gonzalez, C., Burger, E., Badali, H., RichardYegres, N., van den Ende, A.H., 2007. Molecular analysis and pathogenicity of the Cladophialophora carrionii complex, with the description of a novel species. Stud. Mycol. 58, 219–234. Elliott, S., Sandler, A.D., Meehan, J.J., Lawrence, J.P., 2006. Surgical treatment of a gastric diverticulum in an adolescent. J. Pediatr. Surg. 41, 1467–1469. Endo, S., Komori, T., Ricci, G., Sano, A., Yokoyama, K., Ohori, A., Kamei, K., Franco, M., Miyaji, M., Nishimura, K., 2004. Detection of gp43 of Paracoccidioides brasiliensis by the loop-mediated isothermal amplification (LAMP) method. FEMS Microbiol. Lett. 234, 93–97. Enosawa, M., Kageyama, S., Sawai, K., Watanabe, K., Notomi, T., Onoe, S., Mori, Y., Yokomizo, Y., 2003. Use of loopmediated isothermal amplification of the IS900 sequence for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis. J. Clin. Microbiol. 41, 4359–4365. Fader, R.C., McGinnis, M.R., 1988. Infections caused by dematiaceous fungi: chromoblastomycosis and phaeohyphomycosis. Infect. Dis. Clin. North. Am. 2, 925–938. Fernández-Zeppenfeldt, G.R.-Y.N., Yegres, F., Hernández, R., 1994. Cladosporium carrionii: hongo dimórfico en cactáceas de la zona endémica para la cromomicosis en Venezuela. Revista Iberoamericana de Micologia 11, 86

LAMP screening of pathogens

87

Chapter 6

61–63. Guerriero, C., De Simone, C., Tulli, A., 1998. A case of chromoblastomycosis due to Phialophora verrucosa responding to treatment with fluconazole. Eur. J. Dermatol. 8, 167–168. Hagiwara, M., Sasaki, H., Matsuo, K., Honda, M., Kawase, M., Nakagawa, H., 2007. Loopmediated isothermal amplification method for detection of human papillomavirus type 6, 11, 16, and 18. J. Med. Virol. 79, 605–615. Hilmarsdottir, I., Haraldsson, H., Sigurdardottir, A., Sigurgeirsson, B., 2005. Dermatophytes in a swimming pool facility: difference in dermatophyte load in men´s and women´s dressing rooms. Acta Derm. Venereol. 85, 267–268. Ikadai, H., Tanaka, H., Shibahara, N., Matsuu, A., Uechi, M., Itoh, N., Oshiro, S., Kudo, N., Igarashi, I., Oyamada, T., 2004. Molecular evidence of infections with Babesia gibsoni parasites in Japan and evaluation of the diagnostic potential of a loopmediated isothermal amplification method. J. Clin. Microbiol. 42, 2465–2469. Inacio, J., Flores, O., Spencer-Martins, I., 2008. Efficient identification of clinically relevant Candida yeast species by use of an assay combining panfungal loopmediated isothermal DNA amplification with hybridization to species-specific oligonucleotide probes. J. Clin. Microbiol. 46, 713–720. Iseki, H., Alhassan, A., Ohta, N., Thekisoe, O.M., Yokoyama, N., Inoue, N., Nambota, A., Yasuda, J., Igarashi, I., 2007. Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of bovine Babesia parasites. J. Microbiol. Methods 71, 281–287. Iwamoto, T., Sonobe, T., Hayashi, K., 2003. Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium, and M. intracellulare in sputum samples. J. Clin. Microbiol. 41, 2616–2622. Iwatsu, T., Miyaji, M., Taguchi, H., Okamoto, S., 1982. Evaluation of skin test for chromoblastomycosis using antigens prepared from culture filtrates of Fonsecaea pedrosoi, Phialophora verrucosa, Wangiella dermatitidis and Exophiala jeanselmei. Mycopathologia 77, 59–64. Iwen, P.C., Hinrichs, S.H., Rupp, M.E., 2002. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med. Mycol. 40, 87–109. Karuppayil, S.M., Peng, M., Mendoza, L., Levins, T.A., Szaniszlo, P.J., 1996. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi. J. Med. Vet. Mycol. 34, 117–125. Kuhn, D.M., Ghannoum, M.A., 2003. Indoor mold, toxigenic fungi, and Stachybotrys chartarum: infectious disease perspective. Clin. Microbiol. Rev. 16, 144–172. Lee, M.F., Chen, Y.H., Peng, C.F., 2009. Evaluation of reverse transcription loop-mediated isothermal amplification in conjunction with ELISA-hybridization assay for molecular detection of Mycobacterium tuberculosis. J. Microbiol. Methods 76, 174–180. Marciniak, J., Kummel, A., Esener, S., Heller, M., Messmer, B., 2008. Coupled rolling circle amplification loopmediated amplification for rapid detection of short DNA sequences. Biotechniques 45, 275–280. Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell Probes. 16, 223–229. Najafzadeh, M.J., Gueidan, C., Badali, H., Gerrits van den Ende, A.H.G., Xi, L., de Hoog, G.S., 2009a. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med. Mycol. 47, 17–25. Najafzadeh, M.J., Rezusta, A., Cameo, M.I., Zubiri, M.L., Yus,M.C., Badali, H., Revillo, M.J., De Hoog,G.S., in press-a. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med. Mycol. 48,390-3. Najafzadeh, M.J.B., H. Sun, J. Xi, L., Gerrits van den Ende, A.H.G., de Hoog, G.S., in press-b. Fonsecaea nubica, a new species of agent of human chromoblastomycosis revealed using molecular data. Med Mycol. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63. Ohori, A., Endo, S., Sano, A., Yokoyama, K., Yarita, K., Yamaguchi, M., Kamei, K., Miyaji, M., Nishimura, K., 2006. Rapid identification of Ochroconis gallopava by a loopmediated isothermal amplification (LAMP) method. Vet. Microbiol. 114, 359–365. Padhye, A.A., Hampton, A.A., Hampton, M.T., Hutton, N.W., Prevost-Smith, E., Davis, M.S., 1996. Chromoblastomycosis caused by Exophiala spinifera. Clin. Infect. Dis. 22,331–335. Poon, L.L., Wong, B.W., Chan, K.H., Ng, S.S., Yuen, K.Y., Guan, Y., Peiris, J.S., 2005. Evaluation of real-time reverse transcriptase PCR and real-time loop-mediated amplification assays for severe acute respiratory syndrome coronavirus detection. J. Clin. Microbiol. 43, 3457–3459. Queiroz-Telles, F., Esterre, P., Perez-Blanco, M., Vitale, R.G., Salgado, C.G., Bonifaz, A., 2009. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med. Mycol. 47, 3–15. Rubin, H.A., Bruce, S., Rosen, T., McBride, M.E., 1991. Evidence for percutaneous inoculation as the mode of transmission for chromoblastomycosis. J. Am. Acad. Dermatol. 25, 951–954. Salgado, C.G., da Silva, J.P., Diniz, J.A., da Silva, M.B., da Costa, P.F., Teixeira, C., Salgado, U.I., 2004. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Rev. Inst.

Chapter 6

Med. Trop. Sao Paulo 46, 33–36. Spatafora, J.W., Mitchell, T.G., Vilgalys, R., 1995. Analysis of genes coding for smallsubunit rRNA sequences in studying phylogenetics of dematiaceous fungal pathogens. J. Clin. Microbiol. 33, 1322–1326. Sudhadham, M., Prakitsin, S., Sivichai, S., Chaiyarat, R., Dorrestein, G.M., Menken, S.B.J., De Hoog, G.S., 2008. The neurotropic black yeast Exophiala dermatitidis has a possible origin in the tropical rain forest. Stud. Mycol. 61, 145–155. Surash, S., Tyagi, A., de Hoog, G.S., Zeng, J.S., Barton, R.C., Hobson, R.P., 2005. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med. Mycol. 43, 465–472. Vicente, V.A., Attili-Angelis, D., Pie, M.R., Queiroz-Telles, F., Cruz, L.M., Najafzadeh, M.J., de Hoog, G.S., Zhao, J., Pizzirani-Kleiner, A., 2008. Environmental isolation of black yeast-like fungi involved in human infection. Stud. Mycol. 61, 137–144. Vidal, M.S., Castro, L.G., Cavalcante, S.C., Lacaz, C.S., 2004. Highly specific and sensitive, immunoblot-detected 54 kDa antigen from Fonsecaea pedrosoi. Med. Mycol. 42, 511–515. Xi, L., Lu, C., Sun, J., Li, X., Liu,H., Zhang, J., Xie, Z., de Hoog, G.S., 2009. Chromoblastomycosis caused by a meristematic mutant of Fonsecaea monophora. Med. Mycol. 47, 77–80. Yoshida, A., Nagashima, S., Ansai, T., Tachibana, M., Kato, H., Watari, H., Notomi, T., Takehara, T., 2005. Loopmediated isothermal amplification method for rapid detection of the periodontopathic bacteria Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola. J. Clin. Microbiol. 43, 2418–2424. Zeng, J.S., de Hoog, G.S., 2008. Exophiala spinifera and its allies: diagnostics from morphology to DNA barcoding. Med. Mycol. 46, 193–208.

88

Chapter

7

Rapid detection and identification of fungal pathogens by rolling circle amplification (RCA) using Fonsecaea as a model

M. J. Najafzadeh1, 2, 3, J. Sun1, 4, V.A. Vicente1, 5 & G. S. de Hoog1, 2, 6* CBS–KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, The Netherlands; 3Department of Parasitology and Mycology, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran; 4Department of Dermatology, The Second Affiliated Hospital, Sun Yat-Sen University, Guangzhou, Guangdong, China; 5Department of Basic Pathology, Federal University of Paraná, Curitiba, PR, Brazil; 6Peking University Health Science Center, Research Center for Medical Mycology, Beijing, China 1

*Correspondence: G. S. de Hoog, Centraalbureau voor Schimmelcultures Fungal Biodiversity Centre, P. O. Box 85167, NL-3508 AD Utrecht, The Netherlands. Tel.: +31 30 2122 663; fax: +31 30 251 2097; E-mail: de.hoog@cbs. knaw.nl. In press in: Mycoses

89

Chapter 7

Abstract We aimed to describe a rapid and sensitive assay for identification of pathogenic fungi without sequencing. The method of rolling circle amplification (RCA) is presented with species of Fonsecaea, agents of human chromoblastomycosis, as a model. The internal transcribed spacer (ITS) rDNA region of 103 Fonsecaea strains was sequenced and aligned in view of designing three specific padlock probes to be used for the detection of single nucleotide polymorphisms in three Fonsecaea species. The 38 strains included for testing the specificity of RCA comprised 17 isolates of Fonsecaea pedrosoi, 13 of Fonsecaea monophora and eight of Fonsecaea nubica. The assay successfully amplified DNA of the target fungi at the level of species, while no cross reactivity was observed. The amplification product was visualised on a 1% agarose gel to verify the specificity of probe–template binding. Amounts of reagents were minimised to avoid the generation of false-positive results. The simplicity, sensitivity, robustness and low costs provide RCA a distinct position among isothermal techniques for DNA diagnostics as a very practical identification method. Key words: Fonsecaea, chromoblastomycosis, RCA, rapid diagnosis

Introduction Fungal infections that cause life-threatening infections in critically ill and immunocompromised patients have increased significantly over the last decades. In addition, the burden of disease of mutilating infections in healthy individuals, such as chromoblastomycosis, is increasingly recognised. Rapid and specific identification of fungal pathogens in early stages of the infection is important for timely and appropriate treatment with antifungal agents.1,2 Conventional methods for fungal identification in the clinical laboratory rely on morphological and physiological tests and need several days or weeks and are frequently unspecific.3 Molecular identification mostly implies sequencing, which is relatively expensive and time-consuming. Rolling circle amplification (RCA) was introduced as a rapid and specific tool for molecular diagnostics4–7 of microbial agents including fungi.8,9 The RCA method is discussed in this article using the genus Fonsecaea. This genus of black yeast-like fungi comprises potential agents of chromoblastomycosis, a chronic, cutaneous and subcutaneous infection with high morbidity and characterised by the presence of muriform fungal cells in tissue.10,11 Chromoblastomycosis is found worldwide, but most reports of the disease are from tropical and subtropical climates. 12–14 The genus comprises two sibling species, Fonsecaea pedrosoi and Fonsecaea monophora,11,15 while a third one, Fonsecaea nubica, was described recently.16 The latter taxon was reported from Brazil and southern China. Patients with chromoblastomycosis are supposed to have acquired their infection after traumatic inoculation of contaminated material such as spines of cactus17 or of mimosa plants.18 However, fungi isolated directly from the environment often concern less virulent siblings of the species rather than the pathogens themselves.19 With environmental search for the culprit pathogen yielding many avirulent

90

RCA

counterparts, precise identification at the level of molecular species is therefore essential. Laboratory diagnosis of chromoblastomycosis relies on presence of the muriform cells in tissue and on microscopic morphology of the agent, which both have low specificity. Rolling circle amplification is a sensitive, specific and reproducible isothermal DNA amplification technique for rapid molecular identification of microorganisms. RCA-based diagnostics are characterised by good reproducibility, with less amplification errors as compared with PCR.5 The method uses a padlock probe, a circularisable oligonucleotide consisting of two segments complementary to the 3´ and 5´ ends of the target and a linker sequence.20 When the 3´ and 5´ terminal regions of the oligonucleotide probes are juxtaposed to the sequence of interest, the probe ends can be joined by a DNA ligase to form a circular DNA molecule that can be amplified by RCA. Recently the power of padlock probes to accurately identify target nucleic acid sequences, with high specificity down to the single nucleotide polymorphism level, has been demonstrated.4,6,21,22 RCA assays have been used for rapid identification of bacteria,23 viruses7,24 and fungi.8,9,25 In this study, we develop a specific, sensitive and rapid method for identification of clinically important Fonsecaea species by RCA. Material and methods

DNA extraction and ITS PCR amplification DNA extraction and PCR amplification of ITS regions were performed as described previously.15,27 We used ITS amplicons for RCA reactions. Tree building A consensus tree of 38 members of Fonsecaea species based on ITS constructed with the Tree 91

Chapter 7

Fungal strains Thirty-eight Fonsecaea isolates were studied, including 17 F. pedrosoi, 13 F. monophora and eight F. nubica. Thirty isolates originated from patients with chromoblastomycosis, two from brain infection, one from an animal ear and five from the environment. Twenty-five strains came from the South and Central America, five from Southern China and eight isolates came from other countries. Strain data and GenBank accession numbers have been published elsewhere.15,16 To evaluate the specificity of three Fonsecaea-specific padlock probes, we tested five closely related species:26 Cladophialophora bantiana (CBS 678.79, Gen Bank EU103992), Cladophialophora minourae (CBS 556.83, GenBank AY251087), Cladophialophora modesta (CBS 985.96), Cladophialophora saturnica (CBS 109630, GenBank FJ385270) and a hitherto unidentified Cladophialophora species (dH 12336). The affinity of Fonsecaea to these species was established using a phylogenetic tree constructed with Small SubUnit (SSU) rDNA sequences.26 Strains were maintained on slants of 2% malt extract agar (MEA) and oatmeal agar (OA) at 24oC. Species identity was confirmed by sequencing rDNA internal transcribed spacer (ITS), partial β-tubulin (BT2), actin (ACT1), and cell division control protein (cdc42) genes, supplemented with Amplified Fragment Length Polymorphism profiles

Chapter 7

Finder algorithm (v. June 2007, by Gangolf Jobb) with 100 bootstrap replicates and edited with MEGA4 software.28 Based on SSU data26 strain CBS 306.94 (Cladophialophora arxii) was off among the species closest to Fonsecaea species and was taken as outgroup. Padlock probe design For the selection of padlock probes, sequences of ITS regions of 103 Fonsecaea strains (F. monophora, F. pedrosoi and F. nubica) from the CBS reference collection were aligned and adjusted manually using BioNumerics v. 4.61 (Applied Maths, Kortrijk, Belgium) to identify informative nucleotide polymorphisms. Three padlock probes targeting the ITS region were designed and were ordered from Invitrogen Inc (Breda, The Netherlands). In order to optimise binding efficiency to target DNAs, the padlock probes were designed with minimum secondary structure and with Tm of the 5´ end probe binding arm close to or above ligation temperature (63ºC, see below). To increase its discriminative specificity, the 3´ end binding arm was designed with a Tm 10–15ºC below ligation temperature. The linker regions of each Fonsecaea species-specific probe were taken from Zhou et al.8 and the 5´ and the 3´ binding arms were designed in this article (Table 1). Sequences of the two primers used for RCA and the oligonucleotide padlock probes are listed in Table 1. The oligonucleotide probes used were c. 92-99 nt in length and consisted of two adjacent target complementary sequences (14–20 nt) with a spacer region (63 nt) to facilitate loop formation and provide a template for RCA primer binding. Ligation of padlock probe One microlitre of ITS amplicon was mixed with 2 U pfu DNA ligase (Epicentre Biotechnologies, Madison, WI,USA) and 0.1 lmol l-1 padlock probe in 20 mmol l-1 Tris-HCl (pH 7.5), 20 mmol l-1 Cl, 10 mmol l-1 MgCl2, 0.1% Igepal, 0.01 mmol l-1 rATP, 1 mmol l-1 DTT with a total reaction volume of 10µl. Padlock probe ligation was conducted with one cycle of denaturation for 5 min at 94ºC, followed by five cycles of 94ºC for 30 s and 4 min ligation at 63ºC.7 Exonucleolysis Exonucleolysis is required to remove unligated padlock probe and template PCR product and thus reduce subsequent ligation-independent amplification events. It was performed in a 20 µl vol by addition of 10 U each of exonuclease I and III (New England Biolabs, Hitchin, UK) to the ligation mixture and incubation at 37ºC for 30 min, followed by 94ºC for 3 min to inactive the exonuclease reaction. Rolling circle amplification (RCA) reaction Two microlitre of ligation product was used as template for RCA. The total volume was 50 µl containing 8 U Bst DNA polymerase (New England Biolabs), 400 µmol l-1 deoxynucleoside triphosphate mix, 10 pmol of each RCA primer in distilled water. Probe signals were amplified by incubation at 65ºC for 60 min, and accumulation of double stranded DNA products was visualised on a 1% agarose gel to verify the specificity of probe–template

92

RCA

Table 1. Rolling circle amplification padlock probes and padlock probe-specific primers used in this study. Oligonucleotides

Sequences

RCA1 [4]

5´-ATGGGCACCGAAGAAGCA-3´

RCA2 [4]

5´-CGCGCAGACACGATA-3´

FOP

5´Pa-497AAGAAGCTCAGTGTACCGGG477 gatcaTGCTTCTTCGGTGCCCATtacgaggtgcggatagctacCGCGCAGACACGATAgtcta 514CGATACGTGCTCAATA498 3´

FOM

5´Pa-111AGCGGTCCTCCAGCG96 gatcaTGCTTCTTCGGTGCCCATtacgaggtgcggatagctacCGCGCAGACACGATAgtcta 125CAACGCCCGCATTG112 3´

FON

5´Pa-397 CAGGGGCTTGAGGGGGTGAT376 gatcaTGCTTCTTCGGTGCCCATtacgaggtgcggatagctacCGCGCAGACACGATAgtcta 422CGTCCAACACCAAGCG398 3´

FOM, Fonsecaea monophora, FOP, Fonsecaea pedrosoi; FON, Fonsecaea nubica; RCA, rolling circle amplification. a At the 5` end of probe, “P” indicates 5`-phosphorilation. The underlined sequences are the binding arms of the padlock probes, which are joined by the backbone of the probe including the non-specific linker region, which is the same for all three padlock probes.

binding. Positive reactions showed a ladder-like pattern, whereas negative reactions showed a clean background. Results

Discussion Rolling circle amplification is a robust and simple, isothermal in vitro DNA amplification technique emerging as a tool for rapid detection of specific nucleic-acid sequences in DNA samples.5 The use of a padlock probe to circularise oligonucleotides was discovered by Nilsson et al. 20. The method is based on the replication of a short, single stranded DNAcircle 93

Chapter 7

Fonsecaea species were easily distinguished from each other and from other members of the order Chaetothyriales (black yeast and relatives) by ITS sequence analysis (Fig. 1). Each of the three recently recognized clinically relevant species had several unique nucleotide positions. The duration of the RCA assay was 2 h. Positive responses proved to be highly specific for all strains; individual species-specific probes being correctly identified in all three Fonsecaea species analysed (F. pedrosoi, F. monophora and F. nubica). No cross reaction was observed between the three Fonsecaea species (Fig. 2a, b). The products of the RCA reaction were visualised by electrophoresis on 1% agarose gels. Positive responses showed ladder-like patterns after RCA, whereas with negative results the background remained clean. When the exonucleolysis step was omitted, a single weak band was visible on the gel representing a non-specific band that did not interfere with the RCA reaction (data not shown). The concordance of RCA results and identification with ITS sequencing was 100%. The five closely related relevant species used for comparison, i.e. C. bantiana (CBS 678.79), C. minourae (CBS 556.83), C. modesta (CBS 985.96), C. saturnica (CBS 109630) and a hitherto unidentified Cladophialophora species (dH 12336), yielded negative results with the Fonsecaea-specific padlock probes (data not shown).

Chapter 7

Fig. 1. Consensus tree of Fonsecaea based on Internal Transcribed Spacer (ITS) ribosomal DNA of 38 strains, constructed with the Tree Finder algorithm (v. June 2007) with100 bootstrap and edited with Mega 4 software. CBS 306.94 was taken as outgroup(bootstrap values >70 are shown at branches in bold).

94

RCA

Fig. 2. Gel representation of specificity of RCA probes. Amplification of probe signals was seen only with matched template-probe mixtures (empty lanes denote absence of signals with unmatched template-probe mixtures). The species-specific probes are labelled as shown at the top of the figure (FOM, Fonsecaea monophora; FOP, Fonsecaea pedrosoi and FON, Fonsecaea nubica). (A) Lane “M” is DNA smart ladder; lane 1, 4, and 7, F. monophora (CBS 269.37); lane 2, 5 and 8, F. pedrosoi (CBS 271.37); lane 3, 6 and 9, F. nubica (CBS 269.64). (B) Lane “M” is DNA smart ladder; lane 1- 4 are F. monophora (CBS 117238, CBS 102225, CBS 121727 and CBS 121724 respectively); lane 5- 8 are F. pedrosoi ( CBS 253.49, CBS 122741, CBS122849 and CBS 274.66 respectively ); lane 9- 12 are F. nubica (CBS 444.62, CBS 272.29, CBS 270.37 and CBS 121734 respectively).

95

Chapter 7

by BstDNApolymerases at constant temperature. The technique was first applied by Fire et al. 29 and Liu et al. 29,30 in the mid 1990s. The sensitivity of RCA enables accurate and reliable detection and quantification of gene copy numbers,discrete antigen–antibody complexes, and mRNA expression levels in individual cells.5 Its technical simplicity makes the method also applicable for rapid and specific routine diagnostics of pathogenic fungal agents.In this study, the RCA assay was developed for the identification of the three currently recognised pathogenic Fonsecaea species. ITS sequencing is the gold standard for species identification of black yeast and relatives,31 but sequencing is expensive, time-consuming and impractical for analysis of large numbers of isolates.8 In addition, validated databases for comparison are required, as GenBank data are polluted within correctly identified sequences. The RCA reaction is relatively free from requirement for expensive laboratory equipment and can be performed within 2 h isothermally at 65ºC in a water bath, thermocycler, heating block or microwave.32 However, a positive signal was usually evident 15 min after commencement of the RCA reaction when detected by real time PCR.8,9 In this study, we used the fungal genus Fonsecaea as a model organism, as it contains three species which potentially cause the same disease, chromoblastomycosis, and are morphologically indistinguishable from each other. Rapid identification of the agents is significant because virulence differs between species, F. monophora also being an agent of primary encephalitis.33 RCA amplicons were detected here with gel electrophoresis, but other researchers used fluorescence,34 radiolabelling35 or UV absorbance.36 Recently also loop-mediated isothermal amplification (LAMP) has been proposed for rapid diagnosis of Fonsecaea.27 LAMP proved to be a fast and sensitive method based on direct amplification of fungal DNA, whereas for RCA, ITS amplicons are needed. However, with the LAMP assay, we could not distinguish between the different species of the genus Fonsecaea, because they differ in relatively few nucleotide polymorphisms that were sufficient to allow successful RCA diagnostics. Thus, RCA is more specific than LAMP, but LAMP is more sensitive than RCA.27 Thus far, the RCA method has only rarely been

Chapter 7

applied in medical mycology. Papers were limited to Candida, Aspergillus and Scedosporium,8 Cryptococcus25 and Trichophyton.9 In this study, we have demonstrated that RCA is a very efficient method for specific and sensitive identification of fungal pathogens and opportunistic agents, with species-specific detection of Fonsecaea taxa and excluding the closely related species of the genus Cladophialophora. Judging from these results and given the simplicity of the method, it is our impression that RCA deserves a place in routine testing in laboratories for fungal diagnostics where large numbers of samples are to be screened. The establishment of the test is relatively expensive, but with high throughput applications, the performance of testing will be rapid and inexpensive. For identification of very low volume of cases, the method is less suitable. Acknowledgements This study was financially supported by the Ministry of Health and Medical Education of Iran, Mashhad University of medical sciences, Mashhad, Iran and Brazilian Government fellowship from Coordenação de Pessoal de Nível Superior (CAPES). References 1. Hsiao CR, Huang L, Bouchara JP, Barton R, Li HC, Chang TC. Identification of medically important molds by an oligonucleotide array. J Clin Microbiol 2005; 43: 3760-8. 2. Najafzadeh MJ, Falahati M, Pooshanga Bagheri K., Fata A., Fateh R. Flow cytometry susceptibility testing for conventional antifungal drugs and comparison with the NCCLS broth macrodilution test. DARU 2009; 17: 94-8. 3. Larone DH. Medically important fungi: a guide to identification: Washington, D.C., 2002. 4. Faruqi AF, Hosono S, Driscoll MD, et al. High-throughput genotyping of single nucleotide polymorphisms with rolling circle amplification. BMC Genomics 2001; 2: 4. 5. Demidov VV. Rolling-circle amplification in DNA diagnostics: the power of simplicity. Expert Rev Mol Diagn 2002; 2: 542-8. 6. Alsmadi OA, Bornarth CJ, Song W, et al. High accuracy genotyping directly from genomic DNA using a rolling circle amplification based assay. BMC Genomics 2003; 4: 21. 7. Wang B, Potter SJ, Lin Y, et al. Rapid and sensitive detection of severe acute respiratory syndrome coronavirus by rolling circle amplification. J Clin Microbiol 2005; 43: 2339-44. 8. Zhou X, Kong F, Sorrell TC, Wang H, Duan Y, Chen SC. Practical method for detection and identification of Candida, Aspergillus, and Scedosporium spp. by use of rolling-circle amplification. J Clin Microbiol 2008; 46: 24237. 9. Kong F, Tong Z, Chen X, et al. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification. J Clin Microbiol 2008; 46: 1192-9. 10. Bonifaz A, Carrasco-Gerard E, Saul A. Chromoblastomycosis: clinical and mycologic experience of 51 cases. Mycoses 2001; 44: 1-7. 11. De Hoog GS, Attili-Angelis D, Vicente VA, Gerrits van den Ende AHG, Queiroz-Telles F. Molecular ecology and pathogenic potential of Fonsecaea species. Med Mycol 2004; 42: 405-16. 12. Queiroz-Telles F, Esterre P, Perez-Blanco M, Vitale RG, Salgado CG, Bonifaz A. Chromoblastomycosis: an overview of clinical manifestations, diagnosis and treatment. Med Mycol 2009; 47: 3-15. 13. Xi L, Sun J, Lu C, et al. Molecular diversity of Fonsecaea (Chaetothyriales) causing chromoblastomycosis in southern China. Med Mycol 2009; 47: 27-33. 14. Najafzadeh MJ, Rezusta A, Cameo MI, et al. Successful treatment of chromoblastomycosis of 36 years duration caused by Fonsecaea monophora. Med Mycol. 2010; 48(2):390-3 15. Najafzadeh MJ, Gueidan C, Badali H, Gerrits van den Ende AHG, Xi L, de Hoog GS. Genetic diversity and species delimitation in the opportunistic genus Fonsecaea. Med Mycol 2009; 47: 17-25. 16. Najafzadeh MJ, Sun J, Vicente V, Xi L, Gerrits van den Ende AHG, de Hoog G S. Fonsecaea nubica, a new species of agent of human chromoblastomycosis revealed using molecular data. Med Mycol 2010; 48(6):800-6. 17. Fernández-Zeppenfeldt G R-YN, Yegres F, Hernández R. Cladosporium carrionii: hongo dimórfico en cactáceas de 96

RCA

97

Chapter 7

la zona endémica para la cromomicosis en Venezuela. Revista Iberoam de Micol 1994; 11: 61-3. 18. Salgado CG, da Silva JP, Diniz JA, et al. Isolation of Fonsecaea pedrosoi from thorns of Mimosa pudica, a probable natural source of chromoblastomycosis. Rev Inst Med Trop Sao Paulo 2004; 46: 33-6. 19. Vicente VA, Attili-Angelis D, Pie MR, et al. Environmental isolation of black yeast-like fungi involved in human infection. Stud Mycol 2008; 61: 137-44. 20. Nilsson M, Malmgren H, Samiotaki M, Kwiatkowski M, Chowdhary BP, Landegren U. Padlock probes: circularizing oligonucleotides for localized DNA detection. Science 1994; 265: 2085-8. 21. Pickering J, Bamford A, Godbole V, et al. Integration of DNA ligation and rolling circle amplification for the homogeneous, end-point detection of single nucleotide polymorphisms. Nucleic Acids Res 2002; 30: e60. 22. Nilsson M. Lock and roll: single-molecule genotyping in situ using padlock probes and rolling-circle amplification. Histochem Cell Biol 2006; 126: 159-64. 23. Tong Z, Kong F, Wang B, Zeng X, Gilbert GL. A practical method for subtyping of Streptococcus agalactiae serotype III, of human origin, using rolling circle amplification. J Microbiol Methods 2007; 70: 39-44. 24. Haible D, Kober S, Jeske H. Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. J Virol Methods 2006; 135: 9-16. 25. Kaocharoen S, Wang B, Tsui KM, Trilles L, Kong F, Meyer W. Hyperbranched rolling circle amplification as a rapid and sensitive method for species identification within the Cryptococcus species complex. Electrophoresis 2008; 29: 3183-91. 26. Badali H, Gueidan C, Najafzadeh MJ, Bonifaz A, Gerrits van den Ende AHG, de Hoog GS. Biodiversity of the genus Cladophialophora. Stud Mycol 2008; 61: 175-91. 27. Sun J, Najafzadeh MJ, Vicente V, Xi L & de Hoog GS. Rapid detection of pathogenic fungi of the genus Fonsecaea by Loop Mediated Isothermal Amplification. Microbiol Methods 2010; 80(1): 19-24. 28. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24: 1596-9. 29. Fire A, Xu SQ. Rolling replication of short DNA circles. Proc Natl Acad Sci U S A 1995; 92: 4641-5. 30. Liu D, Daubendiek SL, Zillman MA, Ryan K, Kool ET. Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases. J Am Chem Soc 1996; 188: 1587-94. 31. Zeng JS, de Hoog GS. Exophiala spinifera and its allies: diagnostics from morphology to DNA barcoding. Med Mycol 2008; 46: 193-208. 32. Yoshimura T, Nishida K, Uchibayashi K, Ohuchi S. Microwave assisted rolling circle amplification. Nucleic Acids Symp Ser (Oxf) 2006: 305-6. 33. Surash S, Tyagi A, de Hoog GS, Zeng JS, Barton RC, Hobson RP. Cerebral phaeohyphomycosis caused by Fonsecaea monophora. Med Mycol 2005; 43: 465-72. 34. Schweitzer B, Wiltshire S, Lambert J, et al. Immunoassays with rolling circle DNA amplification: a versatile platform for ultrasensitive antigen detection. Proc Natl Acad Sci U S A 2000; 97: 10113-9. 35. Baner J, Nilsson M, Mendel-Hartvig M, Landegren U. Signal amplification of padlock probes by rolling circle replication. Nucleic Acids Res 1998; 26: 5073-8. 36. Kuhn H, Demidov VV, Frank-Kamenetskii MD. Rolling-circle amplification under topological constraints. Nucleic Acids Res 2002; 30: 574-80.

98

Chapter

8

In vitro activities of eight antifungal drugs against 55 clinical isolates of Fonsecaea species.

M. J. Najafzadeh,1,2,3 H. Badali,1,2,4 M. T. Illnait-Zaragozi,5 G. S. de Hoog,1,2,6 & J. F. Meis7* CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands, 2Institute for Biodiversity and Ecosystem Dynamics, University of Amsterdam, Amsterdam, The Netherlands, 3Department of Parasitology and Mycology, faculty of medicine, Mashhad University of Medical Sciences, Mashhad, Iran, 4Department of Medical Mycology and Parasitology, School of Medicine/Molecular and Cell Biology Research Center,Mazandaran University of Medical Sciences, Sari, Iran, 5Department of Mycology, Tropical Medicine Institute Pedro Kouri, Havana, Cuba, 6 Peking University Health Science Center, Research Center for Medical Mycology,Beijing, China, 7Department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen, The Netherlands

1

*Corresponding author. Mailing address: Department of Medical Microbiology and Infectious Diseases, Canisius Wilhelmina Hospital, Nijmegen 6500, The Netherlands. Phone: 31243657514. Fax: 31243657516. E-mail: j.meis@ cwz.nl. Publiced in: Antimicrob Agents Chemother. 2010; 54(4):163 6-8

99

Chapter 8

Abstract The in vitro activities of eight antifungal drugs against clinical isolates of Fonsecaea pedrosoi (n = 21), Fonsecaea monophora (n= 25), and Fonsecaea nubica (n = 9) were tested. The resulting MIC90s for all strains (n= 55) were as follows, in increasing order: posaconazole, 0.063 µg/ml; itraconazole, 0.125 µg/ml; isavuconazole, 0.25 µg/ml; voriconazole, 0.5 µg/ml; amphotericin B, 2 µg/ml; caspofungin, 2 µg/ml; anidulafungin, 2 µg/ml; and fluconazole, 32 µg/ml. Key word: Fonsecaea, chromoblastomycosis, antifungal susceptibility.

Introduction Fonsecaea spp., anamorph members of the order Chaetothyriales (black yeasts and other melanized fungi), are principal agents of human chromoblastomycosis (16), a chronic cutaneous and subcutaneous infection characterized by slowly expanding skin lesions, a granulomatous immune response, and the presence of meristematic melanized muriform fungal cells in tissue scrapings (4). The last characteristic is a crucial diagnostic indicator that tends to be similar irrespective of the fungal pathogen. Chromoblastomycosis occurs worldwide in tropical and subtropical climates. Fonsecaea spp. are recoverable from environmental sources, so the disease is considered to be of traumatic origin (8, 9). The taxonomy of the genus Fonsecaea has been reviewed recently (12), and on the basis of sequence data, the following three species are recognized: Fonsecaea pedrosoi, Fonsecaea monophora, and Fonsecaea nubica. These species are morphologically identical, but their clinical spectra differ slightly: F. pedrosoi and F. nubica appear to be associated strictly with chromoblastomycosis, whereas F. monophora has also been isolated from brain abscesses, cervical lymph nodes, and bile (4, 13, 18). Therapy for chromoblastomycosis is challenging because there is no consensus regarding the treatment of choice. Several treatment options have been applied, but these tend to result in protracted disease, low cure rates, and frequent relapses (5, 9, 10, 16, 18). The therapeutic outcomes are variable and are allegedly dependent on the site of infection, lesion size, the etiological agent, and the patient´s health status (4). The specific identification of the causative pathogen is important for epidemiological reasons. The vast majority of cases of chromoblastomycosis in which the pathogen has been identified are caused by F. pedrosoi; for example, F. pedrosoi was isolated from 94% (66/69 cases) of patients with chromoblastomycosis in Sri Lanka (2) and from 98% (77/78 cases) of patients with culturepositive chromoblastomycosis in Brazil (17). The present study aimed at determining the in vitro susceptibilities of clinical isolates of Fonsecaea spp. to seven marketed antifungal drugs and the experimental 1,2,4-triazole antimycotic isavuconazole (11). Fifty-five Fonsecaea strains were obtained from the Centraalbureau voor Schimmelcultures (Utrecht, The Netherlands) and comprised 21 F. pedrosoi strains, 25 F. monophora strains, and 9 F. nubica strains. Fifty isolates originated from patients with chromoblastomycosis, one isolate was recovered from a patient with a cerebral

100

AFST

101

Chapter 8

infection, two isolates were from diseased animals, and two isolates were clinical isolates from unknown sources. Seventeen strains came from southern China, 30 from South and Central America, and 8 from other countries (The Netherlands, Spain, Uruguay, Libya, France, United Kingdom). Strain identities were verified by sequencing the ribosomal internal transcribed spacer (ITS), tubulin (BT2), and actin (ACT1) regions. In vitro susceptibility was determined as described in CLSI document M38-A2 (6). Briefly, the isolates were cultured on potato dextrose agar (35°C) for up to 7 days, and inocula were prepared by gently scraping the surface of the fungal colonies with a sterile cotton swab moistened with sterile physiological saline containing 0.05% Tween 40. Large particles in the cell suspensions were allowed to settle for 3 to 5 min at room temperature, and then the concentration of spores in the supernatant was adjusted spectrophotometrically (530 nm) to a percent transmission in the range 68 to 71, corresponding to 1.5 ×104 to 4 ×104 CFU/ml, as controlled by quantitative colony counts (6). Antifungal drugs were obtained as reagent-grade powders. The final concentrations of amphotericin B (AMB; Bristol-Myers Squibb, Woerden, The Netherlands), itraconazole (ITR; Janssen Research Foundation, Beerse, Belgium), voriconazole (VOR; Pfizer Central Research, Sandwich, United Kingdom), posaconazole (POS; Schering-Plough, Kenilworth, NJ), and caspofungin (CAS; Merck, Sharp & Dohme, Haarlem, The Netherlands) ranged from 0.016 to 16 µg/ml; the fluconazole (FLU; Pfizer) assay range was 0.063 to 64 µg/ml; and the isavuconazole (ISA; Basilea Pharmaceutica International AG, Basel, Switzerland) and anidulafungin (ANI; Pfizer) assay ranges were 0.008 to 8 µg/ml. After 72 h of incubation at 35°C, MICs and minimum effective concentrations (MECs) were determined visually by comparison of the growth in the wells containing the drug with the drug-free control. The MICs of AMB, ITR, VOR, POS, and ISA were defined as the lowest drug concentration that prevented any discernible growth (100% inhibition), whereas for FLU, the MIC was taken as the lowest concentration supporting ≥50% growth inhibition compared to the growth in the control wells. For CAS and ANI, MECs were determined microscopically as the lowest concentration of drug promoting the growth of small, round, compact hyphae relative to the appearance of the filamentous forms seen in the control wells. Quality control strains Paecilomyces variotii (ATCC 22319), Candida parapsilosis (ATCC 22019), and Candida krusei (ATCC 6258) were included in each assay run. The geometric mean MICs, MIC ranges, MIC50s, and MIC90s for the Fonsecaea isolates are presented in Table 1. For each drug-species pair, the MIC50 and geometric mean MIC values differed by