BMPs in cranial neural crest

1095

Development 127, 1095-1104 (2000) Printed in Great Britain © The Company of Biologists Limited 2000 DEV4251

BMP signaling is essential for development of skeletogenic and neurogenic cranial neural crest Benoît Kanzler1, Ruth K. Foreman2, Patricia A. Labosky2 and Moisés Mallo1,* 1Max-Planck Institute of Immunobiology, Stübeweg 51, D-79108 Freiburg, Germany 2Department of Cell and Developmental Biology, University of Pennsylvania, 421 Curie

Blvd., Philadelphia, PA 19104, USA

*Author for correspondence (e-mail: [email protected])

Accepted 14 December 1999; published on WWW 8 February 2000

SUMMARY BMP signaling is essential for a wide variety of developmental processes. To evaluate the role of Bmp2/4 in cranial neural crest (CNC) formation or differentiation after its migration into the branchial arches, we used Xnoggin to block their activities in specific areas of the CNC in transgenic mice. This resulted in depletion of CNC cells from the targeted areas. As a consequence, the branchial arches normally populated by the affected neural crest cells were hypomorphic and their skeletal and neural derivatives failed to develop. In further analyses, we have

identified Bmp2 as the factor required for production of migratory cranial neural crest. Its spatial and temporal expression patterns mirror CNC emergence and Bmp2 mutant embryos lack both branchial arches and detectable migratory CNC cells. Our results provide functional evidence for an essential role of BMP signaling in CNC development.

INTRODUCTION

the caudal neural crest (i.e. originating at the level of the developing spinal cord), but considering that cranial and caudal neural crest share many developmental properties (Le Douarin, 1982), it is expected that at least some of the mechanisms that induce caudal crest cells also operate at the cranial level. Nonetheless, differences also exist between both crest populations because caudal neural crest cells are unable to form skeletal elements, even when transplanted into the cranial area (Nakamura and Ayer-Le Lievre, 1982). Whether this reflects regional-specific induction mechanisms, regionalspecific responses to common inducing mechanisms or a combination of both is still an unresolved question. It is clear that some molecular differences between cranial and caudal neural crest exist already at early times of neural crest formation, and that some of these differentially expressed genes, like Id2, play a role in neural crest formation (Martinsen and Bronner-Fraser, 1998). How these molecular differences arise or participate in establishing different developmental potentials remains to be addressed. Although the facial skeleton develops from CNC cells, in isolation these cells cannot enter chondrogenic or osteogenic differentiation pathways. Specific reciprocal interactions with facial epithelia are required for the developmental potentials of the CNC cells to be turned on according to precise spatial and temporal patterns (Le Douarin, 1982). The molecular basis for these interactions are starting to be understood, mainly on the basis of an increasing amount of genetic data. Factors implicated in facial development include secreted molecules, like Fgf8 (Meyers et al., 1998), activin βA (Matzuk et al., 1995a) or endothelin-1 (Kurihara et al., 1994), which trigger

The cranial neural crest (CNC) plays an essential role in the development of the vertebrate face and neck. It is composed of cells originating at the dorsal part of the developing brain which migrate along defined pathways to populate the branchial arches and frontonasal mass, where they constitute a major part of the mesenchyme (Lumsden et al., 1991; Serbedzija et al., 1992; Osumi-Yamashita et al., 1994). After migration, these cells undergo specific interactions with the facial epithelia, which trigger a series of differentiation programs, eventually giving rise to a variety of structures. These include neurons and glial cells of the cranial peripheral nervous system, the dermis and the facial bones and cartilages (Le Douarin, 1982), which, unlike the skeleton of the rest of the body, are not of mesodermal origin (Noden 1983; Le Douarin et al., 1993). In addition to giving rise to those structures, it is thought that the CNC also plays additional patterning roles, such as specifying the insertion of facial muscles (Köntges and Lumsden, 1996). Recent experiments with chicken and Xenopus embryos indicate that the neural crest originates at the interface between the surface ectoderm and neural plate by inductive interactions between both tissues (Selleck and Bronner-Fraser, 1995; Mancilla and Mayor, 1996). The molecular details of neural crest induction are still not clear, but a variety of data implicate Fgf, BMP and Wnt proteins in this process (Liem et al., 1995; Mayor et al., 1997; LaBonne and Bronner-Fraser, 1998; Selleck et al., 1998; Ikeya et al., 1997; Saint-Jeannet et al., 1997). Most of these experiments have been performed with

Key words: Bmp2, Xnoggin, Neural crest, Craniofacial development, Xenopus

1096 B. Kanzler and others specific developmental programs in neighboring target cells; receptors, like activin receptors IIA and IIB (Matzuk et al., 1995b, Song et al., 1999), endothelin-A receptor (Clouthier et al., 1998) or various Fgf receptors (Reardon et al., 1994; Meyers et al., 1995), which transduce signals into the target cells; or transcription factors, like Hoxa2 (Gendron-Maguire et al., 1993; Rijli et al., 1993), goosecoid (Rivera-Pérez et al., 1995; Yamada et al., 1995), Dlx1, Dlx2 and Dlx5 (Qiu et al., 1995, 1997; Acampora et al., 1999; Depew et al., 1999) or Mhox (Martin et al., 1995), which mediate or modulate specific responses in the cells where they are expressed. Several members of the BMP family of proteins have also been suggested to play a role in the development of the craniofacial region (Francis-West et al., 1998). These proteins have been implicated in a variety of signaling processes during development, including neural crest formation and skeletogenesis (Hogan, 1996), and expression patterns of several of them, particularly Bmp2, Bmp4 and Bmp7, suggest a role in the face (Francis-West et al., 1994; Wall and Hogan, 1995). Inactivation of the Bmp7 gene resulted in very mild phenotypic malformations in the craniofacial area (Dudley et al., 1995; Luo et al., 1995), indicating that either this gene is not essential in this area or that it is functionally redundant with other genes (Dudley and Robertson, 1997). A recent analysis of Bmp5 and Bmp7 compound mutants (Solloway and Robertson, 1999) indicates that the latter is the case. Double homozygous Bmp5;Bmp7 mutants had branchial arch defects resulting from increased apoptosis and abnormal head mesenchyme development. The possible role of Bmp2 and Bmp4 in the development of the face could not be addressed by standard gene targeting techniques because inactivation of these genes resulted in early embryonic death (Winnier et al., 1995; Zhang and Bradley, 1996). In this manuscript, we analyze the possible role of Bmp2/4 in craniofacial development using a transgenic approach. We took advantage of the ability of Xnoggin to inactivate Bmp2/4 signaling by physical interaction with these proteins (Zimmerman et al., 1996). We targeted Xnoggin expression to the premigratory and migratory neural crest populating the second and more caudal branchial arches. This resulted in the spatially specific ablation of the neural crest normally originating from the targeted areas. This deficiency was associated with the failure of the corresponding branchial arches to be formed and the absence of neural and skeletal CNC derivatives from the targeted regions. In addition, we show that Bmp2 is likely the BMP signal required for production of migratory CNC. Its expression pattern is consistent with this role and Bmp2 mutant embryos lack branchial arches and detectable migratory CNC.

MATERIALS AND METHODS Transgenic constructs B2-NC::noggin construct: the 0.8 kb BglII fragment of the Hoxa2 genomic region containing the enhancer driving Hoxa2 expression in the second and more caudal branchial arches (Nonchev et al., 1996; Kanzler et al., 1998; Maconochie et al., 1999), in which the binding sites for Krox20 were inactivated (Nonchev et al., 1996; Kanzler et al., 1998), was cloned upstream of the minimal promoter from the adenovirus 2 late region (Conaway and Conaway, 1988). The Xenopus noggin (Xnoggin)

cDNA (Smith and Harland, 1992) and the polyadenylation signal of SV40 were then introduced downstream of the minimal promoter. R2::noggin construct: similar to the B2-NC::noggin but containing, instead of the neural crest enhancer, the 2.5 kb BamHI fragment of the Hoxa2 gene active in rhombomere 2, in opposite orientation, as described in Frasch et al. (1995). The constructs were released from vector sequences, gel-purified using the Qiaquick gel extraction kit (Qiagen) and injected at a concentration of 2 ng/µl according to standard protocols (Hogan et al., 1994). Embryonic analyses For the identification and analysis of the transgenes, DNA was obtained from the viscerae of fetuses according to the method of Laird et al. (1991). DNA (5 µg) was digested with BamHI and the fragments were resolved in 0.8% agarose gels, blotted to ZetaProbe GT membranes (BioRad) and hybridized with the appropriate 32P-labeled probes according to standard methods (Sambrook et al., 1989). Copy number was estimated by comparing the intensities of the transgene and a control endogenous band corresponding to the Grg gene (Mallo et al., 1993). In the case of early embryos, the transgenics were identified by semiquantitative PCR using as primers 5′ TGGACCTTATTGAGCACCCGG 3′ and 5′ CCCTGCGTTGACATCTCCACC 3′, corresponding to the Xnoggin cDNA. In these cases, the DNA was obtained from the yolk sacs by digestion with 20 µg/ml of proteinase K in 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2, 0.45% NP-40, 0.45% Tween 20, at 50°C for 12 hours. The Bmp2 mutant embryos were obtained from intercrosses of heterozygous animals (Zhang and Bradley, 1996). Noon on the day of appearance of the vaginal plug is E0.5. Embryos were genotyped by PCR on DNA obtained from the yolk sacs using the following primers: BMP2-18 5′ AGCATGAACCCTCATGTGTTGG 3′, BMP219, 5′ GTGACATTAGGCTGCTGTAGCA 3′; and PGK-Pro, 5′ GAGACTAGTGAGACGTGCTACT 3′. Whole-mount in situ hybridization was performed according to the method of Wilkinson (1992), using digoxigenin-labeled probes. The probes used were: Crabp1 (Stoner and Gudas, 1989); Bmp2 (Lyons et al., 1989), NF-M (Levi et al., 1987), AP-2 (Mitchell et al., 1991), Xnoggin (Smith and Harland, 1992). For whole-mount TUNEL assays, embryos were fixed overnight in paraformaldehyde at 4°C, washed with PBT (PBS containing 0.1% Tween 20) and dehydrated with methanol. After rehydration, the embryos were treated with proteinase K (10 µg/ml in PBT at room temperature for 5 to 8 minutes), washed with PBT and refixed with 4% formaldehyde, 0.1% glutaraldehyde at 4°C for 20 minutes. After treatment with 0.1% sodium borohydride for 30 minutes, the embryos were incubated in TUNEL reaction mixture (20 µM FITC-12-dUTP, 20 µM dATP, 1 U/µl terminal deoxinucleotidyl transferase, 1 mM CoCl2, 30 mM Tris-HCl, pH 7.2, 140 mM sodium cacodylate) for 60 minutes at 37°C, washed with PBT and incubated with horseradish peroxidase-conjugated anti-fluorescein antibody for 30 minutes at 37°C. After extensive washing with PBT, the embryos were incubated with a developing solution containing 500 µg/ml diaminobenzidine and 0.03% hydrogen peroxide. The reaction was stopped with PBT, the embryos fixed in 4% paraformaldehyde at 4°C overnight and stored in PBT. For histological analysis, embryos were fixed in Carnoy’s fixative, embedded in paraffin, sectioned to 10 µm and stained with hematoxylin and eosin. Skeletal preparations were performed as described by Mallo and Brändlin (1997) on E18.5 embryos.

RESULTS Specific skeletal defects resulting from Xnoggin expression in the CNC Bmp2 and Bmp4 are expressed in different regions of the

BMPs in cranial neural crest 1097

Fig. 1. Effect of B2-NC::noggin and R2::noggin transgenes on the head skeleton. (A-C) Wild-type (A), B2-NC::noggin (B) and R2::noggin (C) transgenic embryos were stained at E18.5 with Alizarin red and Alcian blue. The supraoccipital (so), atlas (at) and axis (ax) of both kinds of transgenics are affected. (D-I) Dissection of the otic capsules (D,F,H) and middle ear elements (E,G,I) of wild-type (D,E), B2-NC::noggin (F,G) and R2::noggin (H,I) transgenic embryos shown in A-C. The first arch elements, Meckel’s cartilage (me), malleus (m), incus (i) and tympanic ring (tr) are present and normal looking in all the cases. The second arch elements, stapes (s) and the styloid process (st) are absent in B2-NC::noggin transgenics (arrowhead in F) but present in the R2::noggin transgenics. (J,K) Hematoxylin and eosin staining of frontal sections through the middle ear of wild-type (J) and B2-NC::noggin transgenic (K) embryos at E18.5. The stapes is absent in the transgenic (arrowhead in K). The oval window (ow) is still present, but reduced in size.

branchial arches and frontonasal mass in patterns consistent with mediating tissue interactions responsible for different aspects of craniofacial development (Francis-West et al., 1998). In addition, their expression in the neural folds is consistent with a role in neural crest formation (Dudley and Robertson, 1997; and Fig. 7A-C). To explore their function in vivo, we decided to use a transgenic approach in which Xnoggin, an inhibitor of Bmp2/4 signaling by physical interaction with those molecules (Zimmerman et al., 1996), was expressed in the premigratory/migratory neural crest populating the second and more caudal branchial arches, using an enhancer of the Hoxa2 gene (Nonchev et al., 1996; Maconochie et al., 1999). We will refer to those transgenics as B2-NC::noggin. If a Bmp2/4 signal is essential for the formation/migration of neural crest cells or later in the branchial arches for the epithelial-mesenchymal interactions originating the skeleton of the area, blocking those signals in these transgenics would result in the failure of the relevant skeleton to develop. Analysis of B2-NC::noggin transgenic embryos at E18.5 revealed a variety of skeletal abnormalities restricted to the branchial arch derivatives, the occipital region and the vertebral column (Fig. 1 and not shown). The affected areas correspond to the domains where the enhancer is active (i.e. neural crest of the second and more caudal branchial arches and a variable number of somites; Nonchev et al., 1996; Maconochie et al., 1999). The phenotypes varied slightly among different embryos, normally in direct correlation with the number of copies of the transgene integrated into the genome (Table 1). In addition, only embryos with 10 or more copies presented an obvious phenotype.

The components of the occipital bone and cervical vertebrae which derive from the most anterior somites (Couly et al., 1993), showed different degrees of abnormalities in all affected embryos (Fig. 1B and not shown). In addition, more caudal vertebrae were also affected in some cases (not shown). It is very likely that these malformations resulted from inhibition of BMP signals, known to be required for somite development (Watanabe et al., 1998; Murtaugh et al., 1999), by mesodermal

Fig. 2. Effect of the B2-NC::noggin transgene on the neck and laryngeal skeleton. The hyoid bone and the laryngeal cartilages of wild-type (A) and B2-NC::noggin transgenic (B) embryos were dissected out after Alcian blue and Alizarin red staining. (B) In this specimen, the body of the hyoid bone (b-hy) is absent (asterisk) and the thyroid cartilage (th) is hypomorphic. Two additional cartilages were present (arrowheads) which could represent a fusion of the greater (gh-hy) and lesser horn (lh-hy) of the hyoid bone. cr: cricoid cartilage.

1098 B. Kanzler and others Table 1. Skeletal phenotype of B2-NC::noggin transgenic embryos Transgene copy number No phenotype Phenotype 2nd arch Stapes and styloid‡ Lesser horn hyoid‡ 3rd+4th arches Greater horn hyoid‡ Body hyoid Thyroid bone

25

12/12 0/12

2/7 5/7

1/4 3/4

-

-

Otic capsule (labyrinth)‡

-

Occipital region Cervical vertebrae Atlas and axis

-

C3-C7 Thoracic/lumbar vertebrae

-

Always absent Absent (5) Fused (3) Non-affected (2) Absent (7) Fused (3) Absent (5)* Absent (3) Affected (2) Affected (5) Non-affected (5) Always affected Affected (4) Non-affected (1) Affected (3) Non-affected (2) Affected (1)

Always absent Always absent Always absent Always absent Always absent Always affected Always affected Always affected Always affected Always affected

The number of cases in which a phenotype was observed is indicated in parenthesis. *In one embryo a hyoid body was present in one side. ‡Each side counted independently.

expression of Xnoggin and not in the cranial neural crest. This conclusion is supported by the analysis of other transgenic animals expressing Xnoggin under the control of a Hoxa2 enhancer active in rhombomere (r) 2 and in the anterior somites (Frasch et al., 1995) (referred to as R2::noggin), which show equivalent phenotypic characteristics in these areas (Fig. 1C). Analysis of the branchial arch-derived skeleton of B2NC::noggin embryos indicated that, while the first branchial arch derivatives (mandible, Meckel’s cartilage, malleus, incus, tympanic ring) were essentially unaffected (in one case the processus brevis of the malleus was unilaterally hypomorphic) the structures derived from more caudal branchial arches were severely affected (Figs 1F,G,K, 2B). The stapes and styloid process, both second branchial arch derivatives, were deleted in all affected embryos (Fig. 1F,G,K). The otic capsules of these transgenics, which is where the stapedial footplate is inserted and the styloid process attached, were either normal or presented variable malformations in the labyrinth (Fig. 1F; and not shown). That the absence of stapes and styloid process in B2-NC::noggin transgenics does not derive from possible alterations in the otic capsule is supported by the analysis of R2::noggin transgenic animals, which showed otic capsule phenotypes similar to those in B2-NC::noggin embryos but preserved their styloid processes and stapes (Fig. 1C,H,I). In addition, histological analysis of affected B2-NC::noggin embryos revealed no skeletal deficiencies in the cochlea at the level of the oval window (the place of attachment for the stapes) (Fig. 1J,K). The fenestra was smaller but still present. The reduction in size observed in this fenestra is likely secondary to the absence of stapes (Fig. 1J,K), because the same was observed when the development of the ossicle was inhibited by an independent mechanism (Mallo, 1997).

The skeleton derived from more caudal branchial arches (greater horn and body of the hyoid bone, and the thyroid and cricoid cartilages) was also totally or partially deleted (Table 1; Figs 1B, 2B). In cases of incomplete deletion of these cartilages, some abnormal structures were present, resembling fusions between remaining parts of the branchial skeleton (Fig. 2B). These fusions seemed to involve elements derived from different branchial arches. For instance, in the specimen shown in Fig. 2B the lesser and greater horns of the hyoid bone (second and third arch derivatives, respectively) seemed to have fused. None of these deficiencies were found in R2::noggin embryos (not shown), indicating that they derive from Xnoggin expression in the neural crest, and not in the mesoderm. Altogether, these results indicate that expression of Xnoggin in the CNC produces a specific inhibition of the skeleton derived from the targeted areas. Therefore, we conclude that a Bmp2/4 signal is required at some step during development of the branchial arch-derived skeleton. Absence of migratory CNC cells in B2-NC::noggin transgenics To find out the origin of these skeletal deficiencies, we analyzed B2-NC::noggin transgenic embryos at earlier stages of development. At E9.0 to E10.5, 45% of the transgenic embryos showed strong underdevelopment or complete absence of the second, third and fourth branchial arches (Figs 3B, 4B,D, 6B); in addition, some of these embryos had a slightly delayed closure of the hindbrain (Fig. 4B). Since the skeletal elements affected at E18.5 derive from the branchial arches hypomorphic at E9.5, we assume that these affected embryos correspond to those that would show skeletal abnormalities at later stages. Therefore, we restricted our subsequent analyses to those embryos. As BMP proteins have been previously associated with cell death and cell survival processes (Graham et al., 1994; Zou and Niswander, 1996; Solloway and Robertson, 1999), we wanted to determine whether the underdevelopment of the branchial arches in B2-NC::noggin transgenics could be due to an increase in apoptosis in the migratory neural crest. Therefore, we performed TUNEL assays on whole embryos and compared the patterns obtained in wild type and B2-NC::noggin transgenics. At E9.0, an inverted Y-shaped domain of TUNELpositive cells superficial to the otic vesicle was found both in transgenic and wild-type embryos (Fig. 3A,B). However, also in both kinds of embryos, the second branchial arch and the pathway followed by neural crest cells populating this arch (running rostral to the otic capsule) was virtually free of apoptotic cells (Fig. 3A,B). The same was true for more caudal branchial arches, also hypomorphic in B2-NC::noggin transgenic embryos (Fig. 3A,B). Analyses at earlier developmental stages were complicated by the absence of morphological criteria to distinguish affected from unaffected transgenic embryos and by the presence of a variable number of TUNEL-positive cells in the dorsal hindbrain of normal mouse embryos (Fig. 3C; and not shown). However, in the B2NC::noggin transgenic embryos analyzed at E8.5 (n=5), no apoptotic cells were observed in the pathways of migratory CNC cells and no clear increase of apoptotic cells was evident in their hindbrains (Fig. 3C,D). These results suggest that, contrary to what has been reported for Bmp5;Bmp7 double

BMPs in cranial neural crest 1099 mutants (Solloway and Robertson, 1999), increased apoptosis is probably not involved in the branchial arch phenotype of B2NC::noggin transgenic embryos, although a role for cell death in this phenotype cannot be definitely ruled out. Another possible cause for underdeveloped branchial arches is that the neural crest that normally populates them is affected. Analysis of CrabpI expression, a marker of migratory cranial neural crest cells (Maden et al., 1992), showed that the neural crest migrating into the second and more caudal branchial arches was absent or very reduced in B2-NC::noggin transgenic embryos (Fig. 4B). In contrast, consistent with the spatial specificity of the observed phenotypic deficiencies in these transgenics, the first arch neural crest remained unaffected (Fig. 4B). Equivalent results were observed with AP-2 (Fig. 4D), another neural crest marker (Mitchell et al., 1991). These results indicate that the skeletal defects in the branchial area of B2-NC::noggin transgenic embryos result from the inhibition of neural crest formation and/or migration into the second and more caudal branchial arches. CNC neural derivatives are affected in B2NC::noggin transgenics We then wanted to determine whether the neural crest-derived defects in B2-NC::noggin transgenics were specific to the skeletogenic neural crest or if they also included other CNC derivatives. Therefore, we analyzed the cranial ganglia which have a mixed embryological origin in the epibranchial placodes and neural crest (D’Amico-Martel and Noden, 1983; Le Douarin et al., 1986). Neural crest contributes to the Vth, and proximal ganglia of the IXth and Xth cranial nerves. In addition, it provides a small contribution to the rudimentary proximal ganglion of the VIIth nerve. Of placodal origin are the neurons of the VIIth, VIIIth, distal ganglia associated with the IXth and Xth cranial nerves, as well as the distal part of the Vth (D’Amico-Martel and Noden, 1983; Le Douarin et al., 1986). Comparison of the staining patterns of wild-type and B2-NC::noggin transgenic embryos with an anti-neurofilament probe revealed clear differences in the branchial area (Fig. 5A,B). The trigeminal ganglia were not affected, as expected from their r2-neural crest origin. However, in the region of the IXth and Xth cranial ganglia the staining patterns of B2NC::noggin embryos revealed that only the distal components, those of placodal origin, were present (Fig. 5B). The VIIth/VIIIth cranial ganglia showed levels of neurofilament staining comparable to those of the controls (Fig. 5A,B), likely reflecting their high proportion of ectodermal placode contribution (D’Amico-Martel and Noden, 1983; Le Douarin et al., 1986). However, close analysis of this area revealed an extra proximal component in B2-NC::noggin transgenics that we have not detected in control embryos. Histological analysis of transgenic embryos containing skeletal defects confirmed that the proximal ganglia associated with the IXth and Xth cranial nerves were affected. However, although clearly reduced (Fig. 5D shows the biggest piece of the jugal ganglion that we could observe, and analysis of serial sections indicated that its volume was about one third of that of controls), they were still identifiable, suggesting either residual CNC cell migration in these embryos or partial late compensation by placode-derived cells (see Discussion). We could not detect any clear difference in the VIIth and VIIIth ganglia in B2-NC::noggin transgenics (not shown), which is in

keeping with the observations of neurofilament staining. These results indicate that the neurogenic neural crest has also been affected by inhibition of BMP signaling, suggesting that the requirement of BMP signaling for its formation/migration is shared by different subpopulations of the CNC.

Xnoggin expression in B2-NC::noggin transgenic embryos The above results indicate that BMP signaling is required for CNC development. To determine at which stage this signal is required we analyzed Xnoggin expression in transgenic embryos. This data will also be essential to identify the BMP signal(s) that had been blocked by the ectopic Xnoggin expression. At E8.25, two domains of Xnoggin expression were evident, one in the somites and another in the hindbrain (Fig. 6A). In the latter, Xnoggin was expressed in the dorsal aspect of the rhombencephalon continuously from its caudal limit up to r4; it is also possible that r3 is at least partially included in the Xnoggin expression domain. In r5 some Xnoggin expression is also apparent in more ventral areas of the neuroectoderm. No labeled migratory neural crest was observed, although at this stage CNC cells have already started migration in wild-type embryos (Serbedzija et al., 1992; Mallo, 1997). In the rostral area of E9.0 B2-NC::noggin transgenic embryos (Fig. 6B) Xnoggin expression was restricted to the dorsal part of r4 and the dorsal part of rhombencephalic areas caudal to r5. At this stage expression was weaker and required longer developing times. In r4, expression was particularly intense at the border between the neuroepithelium and the surface ectoderm. In addition, some labeling was detected in a few cells that seemed to have migrated a short way from r4. These results indicate that the transgene is active in areas of the neuroectoderm from which neural crest cells are produced. Since no expression was evident in areas where CNC derivatives normally develop, it is likely that the BMP signal that has been inhibited in the B2NC::noggin transgenic embryos is required at some stage of the production or early migration of cranial neural crest cells. Xnoggin expression in r5 (and maybe r3) of E8.25 B2NC::noggin embryos was unexpected because we used a Hoxa2 enhancer with inactive Krox-20 binding sites, which has been reported not to be active in r3 and r5 (Nonchev et al., 1996). One possible explanation for this discrepancy is that in Nonchev et al. (1996) the analysis was performed at a developmental stage (E9.5) when this enhancer is no longer active in r3 and r5. This is in agreement with the lack of Xnoggin expression in B2-NC::noggin embryos at E9.0. Bmp2 is essential for the production of migratory CNC cells We next wanted to determine the identity of the BMP signal required for cranial neural crest formation/migration. Biochemical data indicate that Xnoggin has specificity for Bmp2 and Bmp4 (Zimmerman et al., 1996). Expression of the mouse Bmp4 gene has not been detected in the dorsal hindbrain (Winnier et al., 1995; Dudley and Robertson 1997; and not shown). In addition, Bmp4 null embryos that survive further than E9.5 do not have major branchial arch deficiencies (Winnier et al., 1995; and not shown). Bmp4 is, therefore, not a good candidate for the molecule we have blocked in the B2-

1100 B. Kanzler and others

Fig. 3. Effect of the B2-NC::noggin transgene on cell death in migratory neural crest. Wild-type (A,C) and B2-NC::noggin transgenic (B,D) embryos were analyzed by TUNEL at E9.0 (A,B) and E8.5 (C,D). At E9.0, the second branchial arch (arrow) of the B2-NC::noggin embryos were smaller but no increase of TUNELpositive cells was seen in the neural crest migrating into this or more caudal branchial arches. ov: otic vesicle. At E8.5, TUNEL-positive cells were seen in the hindbrain of wild type and B2-NC::noggin embryos. No obvious increase in apoptosis is observed in the transgenics. The white line indicates the aproximate location of r4 and more caudal rhombomeres. Fig. 5. Effect of the B2-NC::noggin transgene on cranial ganglia development. Wild-type (A,C) and B2-NC::noggin transgenic (B,D) embryos were analyzed at E9.5 by in situ hybridization with a neurofilament probe (A,B), or at E18.5 by hematoxylin and eosin staining of histological sections. (B) The proximal ganglia associated with the IXth and Xth cranial nerves (arrows) are absent in the transgenic embryos. An extension of the antineurofilament staining is evident proximal to the VIIth/VIIIth cranial ganglia (arrowhead). (C,D) The jugal ganglion (arrows), a proximal ganglion associated with the IXth cranial nerve, is reduced in B2-NC::noggin transgenic embryos (D). These panels show frontal sections oriented with rostral to the top and medial to the left.

Fig. 4. Effect of the B2-NC::noggin transgene on the cranial neural crest. Wild-type (A,C) and B2-NC::noggin transgenic (B,D) embryos were analyzed by in situ hybridization with CrabpI (A,B) and AP-2 (C,D). A and B are E9.0; C and D are E9.5.The neural crest migrating into the first branchial arches (arrowheads) is not affected in the transgenic embryos. The neural crest migrating into more caudal branchial arches (brackets) is very strongly reduced. The white arrows in A and B indicate rhombomere 4, the site of origin of CNC cells populating the second branchial arch.

NC::noggin transgenics. Bmp2 is expressed in early day 8 embryos with a spatial and temporal pattern compatible with playing a role in neural crest formation. At the 2- to 4-somite stage, it can already be detected associated with the lateral edges of the rostral neural plate (Fig. 7A). Bmp2 expression then extends further rostrally and caudally and by the 6-8

somite stage it is detectable along the whole lateral (prospective dorsal) margins of the neural folds (Fig. 7B). Analysis of sections revealed that Bmp2 is expressed in the surface ectoderm where it contacts the neuroepithelium (Fig. 7C). Bmp2 expression in this area is transitory and cannot be detected after E9.5 (Furuta et al., 1997; and not shown). Therefore, since it is expressed in the region of neural crest emergence with a time course that mirrors neural crest production (Serbedzija et al., 1992), Bmp2 could be the BMP signal inhibited in our studies. To test this possibility we analyzed the branchial arches and cranial neural crest in Bmp2 mutant embryos (Zhang and Bradley, 1996). At E9.0 these embryos have not finished turning, likely resulting from amnion/chorion defects, and show severe dismorphologies (Fig. 7E), as previously described (Zhang and Bradley, 1996). In addition, while in stage matched (15-17 somite pairs) wild-type embryos the first and second branchial arches were clearly identifiable (Fig. 7D), no branchial arches could be detected in Bmp2 mutant embryos (Fig. 7E). To determine if the absence of branchial arches in these mutants resulted from a deficit in the CNC, in situ hybridization was performed with a CrabpI probe. The hindbrain was still stained with this probe in the mutants, but none of the streams of migratory neural crest cells were evident

BMPs in cranial neural crest 1101

Fig. 6. Xnoggin expression in B2-NC::noggin transgenic embryos. In situ hybridization was performed on E8.25 (A) and E9.0 (B) B2NC::noggin transgenic embryos with a Xnoggin antisense probe. At E8.25 the transgene is expressed in the somites (s) and in the dorsal aspect of the caudal hindbrain. In rhombomere 5 (r5), it is also detected in more ventral areas of the neuroepithelium. At E9.0, the transgene is expressed in the dorsal part of rhombomeres 4 (r4) and 6/7 (r6/7). The arrowhead indicates the border between the neuroepithelium and the surface ectoderm at r4, where transgene expression in stronger. I, first branchial arch; o, otic vesicle.

(Fig. 7E). This was particularly clear in the region populating the second branchial arch because it is very strongly stained with this probe in wild-type embryos (Fig. 7D,E). Altogether, these results provide evidence for an essential role for Bmp2 in the formation and/or migration of CNC cells. It is, therefore, likely that the BMP signal that we have blocked in the B2-NC::noggin transgenic embryos was Bmp2. DISCUSSION In this study, we have identified a BMP signal as one of the essential factors in the early stages of cranial neural crest development. Previous studies in chicken embryos showed that Bmp4 and Bmp7 could induce dorsal neural markers, including those of neural crest, in neural explants from the caudal region, suggesting that these molecules played a role in neural crest induction (Liem et al., 1995). This hypothesis was supported by subsequent studies showing that inactivation of BMP signaling in the dorsal neural tube at the time of neural crest formation was able to inhibit migration of labeled caudal neural crest cells and to downregulate expression of some neural crest markers (Selleck et al., 1998). Whether this requirement for BMP signaling was specific for the caudal neural crest or was also shared by the neural crest originating in the cranial region was not clear. On the contrary, some data indicated that, in the cranial region, Bmp4 is associated with apoptotic elimination of neural crest cells originating at r3 and r5 (Graham et al., 1994). Our results clearly implicate a BMP signal in the induction and/or migration of the cranial neural crest. Antagonizing Bmp2/4 activity in specific CNC areas in

Fig. 7. Requirement of Bmp2 for neural crest formation. (A-C) In situ hybridization on wild-type embryos at early somite stages (indicated in the figure) with a Bmp2 antisense probe. (C) A section through the same embryo as in B at the indicated level. Expression is detected in the surface ectoderm (se) in the area where it contacts the neuroectoderm (ne). The arrow indicates the contact point between neuroectoderm and surface ectoderm. (D,E) In situ hybridization on wild-type (D) and Bmp2 mutant (E) embryos with Crabp1 at E9.0. The otic vesicle (ov) and the first (I) and second (II) branchial arches are indicated. The bracket in E indicates the area where the branchial arches should be located.

transgenic mice resulted in very strong or total inhibition of neural crest cell migration from the targeted areas, as estimated after staining with neural crest markers. Moreover, the absence of neural crest migration correlated with phenotypic features expected from neural crest deficiencies. At early stages, the branchial arches normally populated by these cells failed to develop, and the skeletogenic and neurogenic CNC derivatives of these arches were also affected. In addition, we could not detect migratory neural crest cells or branchial arches in Bmp2 mutant embryos, further supporting an essential role for this molecule in early stages of neural crest development. Unfortunately, Bmp2-/- mutants die at early stages of gestation, hampering efforts to analyze neural crest derivatives at later developmental times. However, considering that Xnoggin preferentially inactivates Bmp2 and Bmp4 (Zimmerman et al., 1996) and that the Bmp4 expression pattern and null mutant phenotype seem not to indicate a role for Bmp4 in neural crest production in the mouse hindbrain (Winnier et al., 1995; Dudley and Robertson, 1997), we consider it highly likely that the phenotypic characteristics in the branchial area of B2NC::noggin transgenics resulted from inactivation of Bmp2. It has been shown recently that the neural crest originates at the interface between the surface ectoderm and neural plate by inductive interactions between both tissues (Selleck and Bronner-Fraser, 1995; Mancilla and Mayor, 1996). Our results are consistent with BMP signaling being part of this process. According to this hypothesis, a BMP signal, likely Bmp2,

1102 B. Kanzler and others secreted by the surface ectoderm would act on the neuroectoderm to produce neural crest cells able to delaminate and migrate into the surrounding mesenchyme. In this scenario, expression of Xnoggin in the dorsal neural tube would interfere with this signal, resulting in the CNC phenotype of B2NC::noggin transgenic embryos. However, since both BMPs and Xnoggin are secreted molecules, it is also possible that the role of BMP signaling in early CNC development is more indirect. For instance, Bmp2 could be required for proper development of the mesenchyme that has to support CNC cell migration. In this case, inhibition of this BMP signal could also result in absence of migratory CNC cells even without direct effects on the crest cells themselves. BMP signaling and cranial versus caudal neural crest Bmp4 and Bmp7 have been previously implicated in neural crest production in the caudal region, and Bmp7 expression pattern was also consistent with a role in cranial neural crest formation (Liem et al., 1995). From our experiments it is also clear that BMP signaling is also involved in cranial neural crest cell formation/migration, but it seems that Bmp2 is the active signal and not Bmp4 or Bmp7. Mutations in the Bmp4 and Bmp7 genes did not produce obvious deficiencies in cranial neural crest development (Winnier et al., 1995; Dudley et al., 1995; Luo et al., 1995). Therefore, if they play a role in this process, it must be redundant with other molecules. Analysis of double heterozygous mutants for Bmp4;Bmp7 and Bmp2;Bmp7 (Katagiri et al., 1998) did not reveal CNC defects, but since only heterozygous combinations were studied, possible redundancies between these genes in CNC development cannot be ruled out. Recently, it has been shown that Bmp7 and Bmp5 functionally compensate for each other in different embryonic areas (Solloway and Robertson, 1999). These included the branchial arches, which were smaller in Bmp5;Bmp7 double mutants than in controls or single mutants. However, this phenotype resulted from abnormal head mesenchyme development and increased cell death within the arches but not from reduced CNC formation or migration (Solloway and Robertson, 1999). In addition, we have shown here that inactivation of Bmp2 alone results in the absence of migratory cranial neural crest and branchial arches. These phenotypes fit very well with the Bmp2 expression pattern, which reproduces the spatial and temporal dynamics expected for a neural crest inducer (Serbedzija et al., 1992). Therefore, the product of the Bmp2 gene seems to be essential for the production of migratory CNC cells. Whether other BMP molecules also play a role in this process, if Bmp2 heterodimerizes with other BMPs to be functionally active, or even if a small subset of migratory CNC cells is formed through a BMP-independent pathway remains to be determined. It is also possible that different sets of BMP molecules sustain physiological neural crest cell production at different rostrocaudal levels. Bmp5;Bmp7 double mutants seem to provide support for the existence of some degree of differential requirement for these molecules between the cranial and caudal neural crest cells, because trunk neural crest derivatives seemed to be affected in these mutants (Solloway and Robertson, 1999). However, caudal neural crest cells were still produced in such double mutants. When considering BMP signals in

trunk neural crest formation it should be noted that Bmp2 expression pattern is also consistent with its playing a role in this process, but this possible function of Bmp2 has rarely been considered. Interestingly, it has been reported recently that neural crest progenitors are severely reduced in swirl mutant embryos, which contain a mutation in one of the two homologs for Bmp2 that exist in zebrafish (Nguyen et al., 1998). Most of the experiments implicating Bmp4 and Bmp7 in neural crest formation relied on in situ patterns, combined with RNA- or protein-mediated induction assays and Xnoggin-dependent inactivating experiments (Liem et al., 1995; Selleck et al., 1998). Given the high degree of cross-activities between different BMPs (at least in vitro), it cannot be ruled out that in such experiments Bmp4 and/or Bmp7 were mimicking a Bmp2 activity. Clearly, further experiments are required to clarify this issue. Cell lineages in the cranial neural crest Since the neural crest gives rise to many different cell types, it is important to understand when and how cell lineages are determined. The two scenarios that have been proposed consider either that a population of pluripotent neural crest cells exists at the time of induction and later acquires particular fates in response to peripheral environmental cues, or that the neural crest cells are already predetermined at the time of induction. For the caudal neural crest, results supporting each of the alternatives have been reported (Bronner-Fraser and Fraser, 1989; Sieber-Blum, 1989; Fraser and Bronner-Fraser, 1991; Riable and Eisen, 1994; Henion and Weston, 1997). This issue is closely connected to the question of whether a common mechanism underlies the formation of all the neural crest types or if different neural crest subtypes are determined by independent mechanisms. Experiments done to address neural crest induction have relied on general neural crest markers (Liem et al., 1995; Mayor et al., 1997; LaBonne and BronnerFraser, 1998; Selleck et al., 1998) and thus do not help to answer this question. In the cranial region, the origin of neural crest diversity is particularly relevant, considering that CNC cells have an additional developmental potential, skeletogenesis (Noden, 1983; Le Douarin et al., 1993), not shared by their caudal counterparts (Nakamura and Ayer-Le Lievre, 1982). Therefore, it is important to understand whether crest cells forming bones and cartilages result from specific inducing mechanisms or originate from a common pool of multipotent CNC cells. Cell culture experiments seem to favor the existence of common precursors for neural and mesectodermal cranial crest (Baroffio et al., 1991), but no in vivo experiments have been performed. Our results are consistent with the existence of at least some common, BMPdependent, mechanism controlling early development of both skeletogenic and neurogenic neural crest, because both types of derivatives are affected in B2-NC::noggin transgenics. However, whether a combination of general and specific mechanisms exist remains to be determined. Our data also suggest that a degree of plasticity might exist between neural crest and placodal-derived cells in the formation of cranial ganglia. Various experiments have shown that the cranial ganglia have a dual contribution from the neural crest and the ectodermal placodes (D’Amico-Martel and Noden, 1983; Le Douarin et al., 1986; Fode et al., 1998; Ma et al., 1998). Analysis of B2-NC::noggin transgenic embryos at early stages

BMPs in cranial neural crest 1103 indicated that the proximal elements of the IXth and Xth cranial ganglia were not present. However, later in development these elements could be detected, although they were very reduced. A possible interpretation is that these embryos, which lacked second arch skeletal elements, still had residual neural crest migration which was not enough to achieve the size limits required for formation of skeletogenic condensations (Hall and Miyake, 1995), but still could contribute to cranial ganglia formation. Alternatively, these residual ganglia could derive from a subset of crest cells insensitive to BMP inactivation, with neural but not skeletogenic potential. Finally, it is possible that a late compensatory mechanism of placodal origin occurred in these areas. This would be the complementary situation to that reported for Neurogenin 2 mutant mice, in which the geniculate ganglion, of placodal origin, seemed to have recovered at late stages of development, likely by a compensatory effect of the neural crest (Fode et al., 1998). We would like to thank Richard Harland for the Xnoggin cDNA, anti-Xnoggin monoclonal antibodies and helpful comments; Hubert Schorle and Reinhard Buettner for the AP-2 probe, Brigid Hogan for the mouse Bmp2 probe and Andrea Schepler for the NF-M probe; Richard Behringer for the Bmp2 mice and Yuji Mishina for help with the Bmp2 genotyping; Sabine Ohnemus for excellent technical assistance; and Randy Cassada and Heiner Schrewe for reading the manuscript. P. A. L. is supported by the American Heart Association.

REFERENCES Acampora, D., Merlo, G. R., Paleari, L, Zerega, B., Postiglione, M. P., Mantero, S., Bober, E., Barbieri, O., Simeone, A. and Levi, G. (1999). Craniofacial, vestibular and bone defects in mice lacking the Distal-lessrelated gene Dlx5. Development 126, 3795-3809. Baroffio, A., Dupin, E. and Le Douarin, N. M. (1991). Common precursors for neural and mesectodermal derivatives in the cephalic neural crest. Development 112, 301-305. Bronner-Fraser, M. and Fraser, S. (1989). Developmental potential of avian trunk neural crest cells in situ. Neuron 3, 755-766. Clouthier, D. E., Hosoda, K., Richardson, J. A., Williams, S. C., Yanagisawa, H., Kuwaki, T., Kumada, M., Hammer, R. E. and Yanagisawa, M. (1998). Cranial and cardiac neural crest defects in endothelin-A receptor-deficient mice. Development 125, 813-824. Conaway, R. C. and Conaway, J. W. (1988). ATP activates transcription initiation from promoters by RNA polymerase II in a reversible step prior to RNA synthesis. J. Biol. Chem. 263, 2962-2968. Couly, G. F., Coltey, P. M. and Le Douarin, N. M. (1993) The triple origin of skull in higher vertebrates: a study in quail-chick chimeras. Development 117, 409-429. D’Amico-Martel, A. and Noden, D. M. (1983). Contributions of placodal and neural crest cells to avian cranial peripheral ganglia. Am. J. Anat. 166, 445468. Depew, M. J., Liu, J. K., Long, J. E., Presley, R, Meneses, J. J., Pedersen, R. A. and Rubenstein, J. L. R. (1999). Dlx5 regulates regional development of the branchial arches and sensory capsules. Development 126, 3831-3846. Dudley, A. T., Lyons, K. M. and Robertson, E. J. (1995). A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 9, 2795-2807. Dudley, A. T. and Robertson, E. J. (1997). Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev. Dyn. 208, 349-362. Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMeur, M., Goridis, C. and Guillemot, F. (1998). The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons. Neuron 20, 483-494. Francis-West, P. H., Tatla, T. and Brickell, P. M. (1994). Expression patterns

of the bone morphogenetic protein genes Bmp-4 and Bmp-2 in the developing chick face suggest a role in outgrowth of the primordia. Dev. Dyn. 201, 168-178. Francis-West, P., Ladher, R., Barlow, A. and Graveson, A. (1998). Signalling interactions during facial development. Mech. Dev. 75, 3-28. Frasch, M., Chen, X. and Lufkin, T. (1995). Evolutionary-conserved enhancers direct region-specific expression of the murine Hoxa-1 and Hoxa2 loci in both mice and Drosophila. Development 121, 957-974. Fraser, S. E. and Bronner-Fraser, M. (1991). Migrating neural crest cells in the trunk of the avian embryo are multipotent. Development 112, 913920. Furuta, Y., Piston, D.W. and Hogan, B.L.M. (1997). Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development 124, 2203-2212. Gendron-Maguire, M., Mallo, M., Zhang, M. and Gridley, T. (1993). Hoxa2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest. Cell 75, 1317-1331. Graham, A., Francis-West, P., Brickell, P. and Lumsden, A. (1994). The signalling molecule BMP4 mediates apoptosis in the rhombencephalic neural crest. Nature 372, 684-686. Hall, B. K. and Miyake, T. (1995). Divide, accumulate, differentiate: cell condensation in skeletal development revisited. Int. J. Dev. Biol. 39, 881893. Henion, P. D. and Weston, J. A. (1997). Timing and pattern of cell fate restrictions in the neural crest leneage. Development 124, 4351-4359. Hogan, B. L. M. (1996). Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10, 1580-1594. Hogan, B., Beddington, R., Constantini, F. and Lacy, E. (1994). Manipulating the Mouse Embryo. A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor. Ikeya, M., Lee, S. M. K., Johnson, J. E., McMahon, A. P. and Takada. S. (1997). Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389, 966-970. Kanzler, B., Kuschert, S. J., Liu, Y.-H. and Mallo, M. (1998). Hoxa2 restricts the chondrogenic domain and inhibits bone formation during development of the branchial area. Development 125, 2587-2597. Katagiri, T., Boorla, S., Frendo, J. L., Hogan, B. L. M. and Karsenty, G. (1998). Skeletal abnormalities in doubly heterozygous Bmp4 and Bmp7 mice. Dev. Genet. 22, 340-348. Köntges, G. and Lumsden, A. (1996). Rhomboencephalic neural crest segmentation is preserved throughout craniofacial ontogeny. Development 122, 3229-3242. Kurihara, Y., Kurihara, H., Suzuki, H., Kodama, T., Maemura, K., Nagai, R., Oda, H., Kuwaki, T., Cao, W.-H., Kamada, N., Jishage, K., Ouchi, Y., Azuma, S., Toyoda, Y., Ishikawa, T., Kumada, M. and Yazaki, Y. (1994). Elevated blood pressure and craniofacial abnormalities in mice deficient in endothelin-1. Nature 368, 703-710. LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two-signal model. Development 125, 2403-2414. Laird, P. W., Zijderveld, A., Linders, K, Rudnicki, M. A., Jaenisch, R. and Berns, A. (1991). Simplified mammalian DNA isolation procedure. Nucl. Acids Res. 19, 4293. Le Douarin, N. M. (1982). The Neural Crest. Cambridge, UK: Cambridge Univ. Press. Le Douarin, N. M., Fontaine-Pérus, J. and Couly, G. (1986). Cephalic ectodermal placodes and neurogenesis. Trends Neurosci. 9, 175-180. Le Douarin, N. M., Ziller, C. and Couly, G. F. (1993). Patterning of neural crest derivatives in the avian embryo: in vivo and in vitro studies. Dev. Biol. 159, 24-49. Levi, E., Liem, R. K., D’Eustachio, P. and Cowan, N. J. (1987). Structure and evolutionary origin of the gene encoding mouse NF-M, the middlemolecular-mass neurofilament protein. Eur. J. Biochem. 166, 71-77. Liem, K. F. Jr., Tremmi, G., Roelink, H. and Jessell, T. M. (1995). Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82, 969-979. Lumsden, A., Sprawson, N. and Graham, A. (1991). Segmental origin and migration of neural crest cells in the hindbrain region of the chick embryo. Development 113, 1281-1291. Luo, G., Hofmann, C., Bronckers, A. L. J. J., Sohocki, M., Bradley, A. and Karsenty, G. (1995). BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev. 9, 28082820. Lyons, K. M., Pelton, R. W. and Hogan, B. L. M. (1989). Patterns of expression of murine Vgr-1 and BMP-2a RNA suggest that transforming

1104 B. Kanzler and others growth factor-β-like genes coordinately regulate aspects of embryonic development. Genes Dev. 3, 1657-1668. Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L. and Anderson, D. J. (1998). neurogenin 1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 20, 469482. Maconochie, M., Krishnamurthy, R, Nonchev, S., Meier, P. Manzanares, M., Mitchell, P. J. and Krumlauf, R. (1999). Regulation of Hoxa2 in cranial neural crest cells involves members of the AP-2 family. Development 126, 1483-1494. Maden, M., Horton, C., Graham, A., Leonard, L., Pizzey, J., Siegenthaler, G., Lumsden, A. and Eriksson, U. (1992) Domains of cellular retinoic acid-binding protein I (CRABP I) expression in the hindbrain and neural crest of the mouse embryo. Mech. Dev. 37, 13-23. Mallo, M., Franco del Amo, F., and Gridley, T. (1993). Cloning and developmental expression of Grg, a mouse gene related to the groucho transcript of the Drosophila Enhancer of split complex. Mech. Dev. 42, 6776. Mallo, M. (1997). Retinoic acid disturbs mouse middle ear development in a stage-specific fashion. Dev. Biol. 184, 175-186. Mallo, M. and Brändlin, I. (1997). Segmental identity can change independently in the hindbrain and rhombencephalic neural crest. Dev. Dyn. 210, 146-156. Mancilla, A. and Mayor, R. (1996). Neural crest formation in Xenopus laevis: mechanisms of Xslug induction. Dev. Biol. 177, 580-589. Martin, J. F., Bradley, A. and Olson, E. N. (1995). The paired-like homeo box gene Mhox is required for early events of skeletogenesis in multiple lineages. Genes Dev. 9, 1237-1249. Martinsen, B. J. and Bronner-Fraser, M. (1998). Neural crest specification regulated by the helix-loop-helix repressor Id2. Science 281, 988-991. Matzuk, M. M., Kumar, T. R., Vassalli, A., Bickenbach, J. R., Roop, D. R., Jaenisch, R. and Bradley, A. (1995a). Functional analysis of activins during mammalian development. Nature 374, 354-356. Matzuk, M. M., Kumar, T. R. and Bradley, A. (1995b). Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 374, 356-360. Mayor, R., Guerrero, N. and Martínez, C. (1997). Role of FGF and noggin in neural crest induction. Dev. Biol. 189, 1-12. Meyers, E. N., Lewandoski, M. and Martin, G. R. (1998). An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nature Genet. 18, 136-141. Meyers, G. A., Orlow, S. J., Munro, I. R., Przylepa, K. A. and Jabs, E. W. (1995). Fibroblast growth factor receptor 3 (FGFR3) transmembrane mutation in Crouzon syndrome with acanthosis nigricans. Nature Genet. 11, 462-464. Mitchell, P. J., Timmons, P. M., Hébert, J. M., Rigby, P. W. J. and Tjian, R. (1991). Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev. 5, 105-119. Murtaugh, L. C., Chyung, J. H. and Lassar, A. B. (1999). Sonic hedgehog promotes somitic chondrogenesis by altering the cellular response to BMP signaling. Genes Dev. 13, 225-237. Nakamura, H. and Ayer-Le Lievre, C. S. (1982). Mesectodermal capabilities of the trunk neural crest of birds. J. Embryol. Exp. Morph. 70, 1-18. Nguyen, V. H., Schmid, B., Trout, J., Connors, S.A., Ekker, M. and Mullins, M.C. (1998). Ventral and lateral regions of the zebrafish gastrula, including the neural crest progenitors, are established by a bmp2b/swirl pathway of genes. Dev. Biol. 199, 93-110. Noden, D. M. (1983). The role of the neural crest in patterning of avian cranial skeletal, connective and muscle tissues. Dev. Biol. 96, 144-165. Nonchev, S., Vesque, C., Maconochie, M., Seitanidou, T., ArizaMcNaughton, L., Frain, M., Marshall, H., Sham, M. H., Krumlauf, R. and Charnay, P. (1996). Segmental expression of Hoxa-2 in the hindbrain is directly regulated by Krox-20. Development 122, 543-554. Osumi-Yamashita, N., Ninomiya, Y., Doi, H. and Eto, K. (1994). The contribution of both forebrain and midbrain crest cells to the mesenchyme in the frontonasal mass of mouse embryos. Dev. Biol. 164, 409-419. Qiu, M., Bulfone, A., Martínez, S., Meneses, J. J., Shimamura, K., Pedersen, R. A. and Rubenstein, J. L. R. (1995). Null mutation of Dlx2 results in abnormal morphogenesis of proximal first and second branchial arch derivatives and abnormal differentiation in the forebrain. Genes Dev. 9, 2523-2538. Qiu, M., Bulfone, A., Ghattas, I., Meneses, J. J., Christensen, L., Sharpe, P. T., Presley, R., Pedersen, R. A. and Rubenstein, J. L. R. (1997). Role of the Dlx homeobox genes in proximodistal patterning of the branchial

arches: mutations of Dlx-1, Dlx2 and Dlx-1 and -2 alter morphogenesis of proximal skeletal and soft tissue structures derived from the first and second arches. Dev. Biol. 185, 165-184. Reardon, W., Winter, R. M., Rutland, P., Pulleyn, L. J., Jones, B. M. and Malcolm, S. (1994). Mutations in the fibroblast growth factor receptor 2 gene cause Crouzon syndrome. Nature Genet. 8, 98-103. Riable, D. W. and Eisen, J. S. (1994). Restriction of neural crest cell fate in the trunk of the embryonic zebrafish. Development 120, 495-503. Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dolle, P. and Chambon, P. (1993). A homeotic transformation is generated in the rostral branchial region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell 75, 1333-1349. Rivera-Pérez, J., Mallo, M., Gendron-Maguire, M., Gridley, T. and Behringer, R. R. (1995). Goosecoid is not an essential component of the mouse gastrula organizer but is required for craniofacial and rib development. Development 121, 3005-3012. Saint-Jeannet, J.-P., He, X., Varmus, H. E., and Dawid, I. B. (1997). Regulation of dorsal fate in the neuraxis by Wnt-1 and Wnt-3a. Proc. Natl. Acad. Sci. USA 94, 13713-13718. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press Selleck, M. A. J. and Bronner-Fraser, M. (1995). Origins of the avian neural crest: the role of neural plate-epidermal interactions. Development 121, 525538. Selleck, M. A. J., García-Castro, M. I., Artinger, K. B. and BronnerFraser, M. (1998). Effects of Shh and Noggin on neural crest formation demostrate that BMP is required in the neural tube but not ectoderm. Development 125, 4919-4930. Serbedzija, G. N., Bronner-Fraser, M. and Fraser, S. E. (1992). Vital dye analysis of cranial neural crest cell migration in the mouse embryo. Development 116, 297-307. Sieber-Blum, M. (1989). Commitment of neural crest cells to the sensory neuron lineage. Science 243, 1608-1611. Smith, W. C. and Harland, R. M. (1992). Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70, 829-840. Solloway, M. J. and Robertson, E. J. (1999). Early embryonic lethality in Bmp5;Bmp7 double mutant mice suggests functional redundancy within the 60A subgroup. Development 126, 1753-1768. Song, J., Oh, S. P., Schrewe, H., Normura, M., Lei, H., Okano, M., Gridley, T. and Li, E. (1999). The type II activin receptors are essential for egg cylinder growth, gastrulation and rostral head development in mice. Dev. Biol. in press. Stoner, C. M. and Gudas, L. J. (1989). Mouse cellular retinoic acid binding protein: cloning, complementary DNA sequence, and messenger RNA expression during the retinoic acid-induced differentiation of F9 wild-type and RA-3-10 mutant teratocarcinoma cells. Cancer Res. 49, 1497-1504. Wall, N. A. and Hogan, B. L. M. (1995). Expression of bone morphogenetic protein-4 (BMP-4), bone morphogenetic protein-7 (BMP-7), fibroblast growth factor-8 (FGF-8) and sonic hedgehog (SHH) during branchial arch development in the chick. Mech. Dev. 53, 383-392. Watanabe, Y., Duprez, D., Monsoro-Burq, A.-H., Vincent, C. and Le Douarin, N. M. (1998). Two domains in vertebral development: antagonistic regulation by SHH and BMP4 proteins. Development 125, 2631-2639. Wilkinson, D. G. (1992). Whole mount in situ hybridization of vertebrate embryos. In Situ Hybridization: a Practical Approach (ed. D. G. Wilkinson), pp. 75-83. Oxford: IRL Press. Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L. M. (1995) Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev. 9, 2105-2116. Yamada, G., Mansouri, A., Torres, M., Stuart, E. T., Blum, M., Schultz, M., De Robertis, E. M. and Gruss, P. (1995). Targeted mutation of the murine goosecoid gene results in craniofacial defects and neonatal death. Development 121, 2917-2922. Zhang, H. and Bradley, A. (1996). Mice deficient for BMP2 are nonviable and have defects in amnion/chorion and cardiac development. Development 122, 2977-2986. Zimmerman, L. B., De Jesús-Escobar, J. M. and Harland, R. M. (1996). The Spemann organizer signal noggin binds and inactivates Bone Morphogenetic Protein 4. Cell 86, 599-606. Zou, H. and Niswander, L. (1996). Requirement for BMP signaling in interdigital apoptosis and scale formation. Science 272, 738-741.