Bovine paramphistomes in Ireland

G Model VETPAR-7260; No. of Pages 10

ARTICLE IN PRESS Veterinary Parasitology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Bovine paramphistomes in Ireland Annetta Zintl a,∗ , Andres Garcia-Campos a , Alan Trudgett b , Andreas L. Chryssafidis a , Silvia Talavera-Arce a , Yan Fu a , Simon Egan a , Amanda Lawlor a , Carmen Negredo a , Gerard Brennan b , Robert E. Hanna c , Theo De Waal a , Grace Mulcahy a a b c

UCD School of Veterinary Medicine, University College Dublin, Ireland School of Biological Sciences, Queens University Belfast, UK Veterinary Sciences Division, Agri-Food and Biosciences Institute, Stormont, Belfast, UK

a r t i c l e

i n f o

Article history: Received 21 March 2014 Received in revised form 8 May 2014 Accepted 11 May 2014

Keywords: Paramphistomosis Calicophoron daubneyi Epidemiology Faecal egg count Phylogenetic analysis Network analysis

a b s t r a c t Paramphistome infections have been associated with significant morbidity, caused chiefly by the activity of juvenile flukes in the intestine of the ruminant final host. Most cases have been reported in tropical and sub-tropical areas. However, recent reports of an apparent increase in the incidence of rumen fluke and its geographical range in Europe have renewed interest in a parasite previously thought to be of little significance in temperate regions. Moreover, the identity of rumen flukes present in the British Isles is currently being revised. As a result, work is underway throughout Europe to review and re-assess the clinical and economic significance of rumen flukes. During the present study, historical diagnostic laboratory records were interrogated for recent changes in the incidence of rumen fluke in Ireland. Three cattle herds were monitored for the presence of paramphistome eggs using coprological analysis over a period of 2 months (in the case of a group of housed steers) and 14 months (in the case of two extensively operated farms), respectively. Adult rumen fluke collected following slaughter were weighed and typed in two loci. We found that Calicophoron daubneyi is the most common if not only paramphistome species present in Ireland and that infections in cattle are now much more prevalent than was the case five or six years ago. The pylogenetic relationship of our isolates to the only published sequence and to C. daubneyi isolates from Northern Ireland was analysed. Genetic heterogeneity was similar all over the island and comparable to that of Fasciola hepatica, a fact that may have implications for the parasite’s ability to develop resistance to the very limited number of drugs currently available for treatment. The same haplotypes predominated throughout the island. Although the clinical significance of C. daubneyi is still uncertain, considering the apparent pervasiveness of the parasite, rumen fluke should be considered a differential diagnosis when treating scour or ill-thrift in young calves, and goats and sheep of any age. © 2014 Elsevier B.V. All rights reserved.

1. Introduction

∗ Corresponding author. Tel.: +353 1716 6121; fax: +353 17166185. E-mail addresses: [email protected], [email protected] (A. Zintl).

Paramphistomes are trematode parasites which infect all ruminant livestock including cattle, sheep, goats and deer. Their life cycle is very similar to that of the liver fluke, Fasciola hepatica. Motile ciliated miracidia that hatch

http://dx.doi.org/10.1016/j.vetpar.2014.05.024 0304-4017/© 2014 Elsevier B.V. All rights reserved.

Please cite this article in press as: Zintl, A., et al., Bovine paramphistomes in Ireland. Vet. Parasitol. (2014), http://dx.doi.org/10.1016/j.vetpar.2014.05.024


ARTICLE IN PRESS

2

A. Zintl et al. / Veterinary Parasitology xxx (2014) xxx–xxx

from eggs passed in the faeces of an infected host, invade amphibious or aquatic snails where they multiply asexually and develop to cercariae. These are shed continuously for up to one year, encysting on vegetation as metacercariae (De Waal, 2010). Upon ingestion by the final host, juveniles excyst in the small intestine where they attach firmly to the gastrointestinal lining by drawing plugs of mucosa into their ventral sucker or acetabulum (Singh et al., 1984). Eventually the flukes move to the rumen where they mature and start to produce eggs which are very similar in their morphology to liver fluke eggs. Currently, there is considerable confusion over the classification of paramphistomes as many previously described species appear to be synonymous (Sey, 1980; Taylor et al., 2007; De Waal, 2010). Moreover, the identity of rumen flukes present in some parts of Europe is being revised (Gordon et al., 2013). As a result, there is a level of uncertainty in the published literature as to the identity of the snail intermediate host, the length of the prepatent period and the pathogenicity of paramphistomes. Calicophoron daubneyi (formerly known as Paramphistomum daubneyi) appears to infect the same intermediate host as F. hepatica, the amphibious snail, Galba truncatula (Augot et al., 1996). There is disagreement, however, whether G. truncatula can sustain concurrent infections of both parasites (Abrous et al., 2000; Martínez-Ibeas et al., 2013). According to some reports Lymnaea fuscus and Lymnaea pallustris can also serve as intermediate hosts for C. daubneyi (Abrous et al., 2000). Aquatic snail Planorbis and Bulinus spp. serve as intermediate hosts for other paramphistome species including Paramphistomum cervi, Paramphistomum ichikawai, Calicophoron calicophoron and Paramphistomum (Calicophoron) microbothrium (Rolfe et al., 1991; Spence et al., 1996; Mavenyengwa et al., 2010; Pavlovic´ et al., 2012). Pathology is mostly associated with the activity of immature flukes in the intestine, with severity of disease apparently chiefly determined by how far juveniles burrow into the mucosa and submucosal layers. This in turn depends not only on the paramphistome species present, but also the species, age and immune status of the host. As a result clinical disease in cattle is usually confined to young stock, while sheep and goats are susceptible throughout their lives (Taylor et al., 2007). For example, goats infected with P. cervi, suffer severe inflammation as immature flukes penetrate the mucosa, submucosa and even the muscularis mucosa underneath (Singh et al., 1984). Similarly, juvenile P. micobothrium in sheep cause strangulation and necrosis of the intestinal mucosa resulting in severe gastroenteritis (reviewed in Mavenyengwa et al., 2010). Infection with immature C. daubneyi flukes has been associated with villous atrophy resulting in scour in sheep (Mason et al., 2012) and young cattle (Millar et al., 2012). Adult flukes in the rumen, on the other hand, seem to be well tolerated even if present in large numbers (Spence et al., 1996; Millar et al., 2012), although some reports have found an association with subclinical anaemia, lowered feed conversion, weight loss and decreased milk yields (Rangel-Ruiz et al., 2003; Mavenyengwa et al., 2010). Reported prepatent periods range from 5 to 11 weeks (Boray, 1959; Singh et al., 1984; Mavenyengwa et al., 2010).

For many years, interest in paramphistomes was confined to the tropics and subtropics, as the group was considered relatively non-pathogenic and unimportant in temperate regions. However, more recently reports of clinical paramphistomosis associated with considerable morbidity and mortality have been emerging, particularly in Britain and Ireland (Murphy et al., 2008; Murray et al., 2010; Mason et al., 2012; Millar et al., 2012). At the same time, there is evidence that, mirroring changes in the epidemiology of F. hepatica, paramphistome incidence and geographical range may be increasing (reviewed by Martínez-Ibeas et al., 2013; Gordon et al., 2013). To compound the issue further, a recent molecular study has shown that C. daubneyi, and not P. cervi as previously thought, is the most common species in the UK (Gordon et al., 2013). It is unclear at this point whether the two species have always coexisted on the British Isles or whether the recent apparent increase in incidence and clinical disease is due to the introduction and spread of this new species. Our study collates epidemiological and molecular information about paramphistomes in Ireland. This background information will be useful for evaluating the likely significance of rumen fluke for the livestock industry at present and into the future. 2. Materials and methods 2.1. Diagnostic laboratory records The electronic clinical records of University College Dublin Veterinary Hospital (UCDVH) were queried for the number of paramphistome-positive cases as a percentage of all bovine and ovine faecal samples that were screened for the presence of rumen fluke eggs by sedimentation (described below) between 2004 and 2013. 2.2. Field study Faecal samples from three cattle herds, situated in the south east of the Republic of Ireland in counties (A) Kildare, (B) Wexford and (C) Tipperary were regularly screened for the presence of paramphistome eggs. The three herds represented different types of farming operations, i.e. herd A was a small herd composed entirely of young steers (11–16 months), herd B was a beef herd and herd C a dairy operation. Herds B and C were on pasture between spring and autumn and housed during winter. Herd A was housed throughout. F. hepatica is known to be present on farms B and C but thought to be absent from A. The animals were not treated for either liver fluke or rumen fluke. For each sample approx. 5 g faeces were examined by sedimentation, followed by staining with 5% methylene blue and counting of eggs under a low power stereomicroscope (Taylor et al., 2007). For comparison of faecal egg counts between sampling locations and occasions, counts were categorised into 0, + (50 epg faeces). Numbers of animals and sampling schedules on the various farms are outlined in Table 1.


G Model

ARTICLE IN PRESS

VETPAR-7260; No. of Pages 10


3

Table 1 Location and sizes of herds screened for evidence of paramphistome infections. Herd and location

Type

Number of cattle in the herd

Sampling schedules

A, Kildare

Beef, housed throughout

47

B, Wexford

Beef, housed during the winter

60 (at the start) to 26 (at the end of sampling)a

C, Tipperary

Dairy, housed during the winter

89 (at the start) to 69 (at the end of sampling)a

Bi-weekly from June 2013 to July 2013 Initial sample: November 2012; Bi-monthly from March 2013 to January 2014 As for B

a

These were commercial herds and attrition was due to animals going to slaughter.

2.3. Collection of rumen fluke specimens, size and PCR A total of 196 rumen flukes were collected from Herds A and B following slaughter. An additional 48 flukes were collected from other cattle that arrived in the abattoir at the same time. All flukes were cleaned in saline, blotted dry on tissue paper and individually weighed. The weights of flukes collected from animals in herds A and B and from ‘other cattle’ were compared using one-way ANOVA. Seventy flukes (25 each from farms A and B and 20 from ‘other’ cattle) were further processed for molecular analysis as follows. DNA was extracted from whole flukes using the High Pure PCR template preparation kit (Roche). All isolates were amplified in two loci, the second internal transcribed spacer (ITS-2) of ribosomal RNA gene together with fragments of the two flanking conserved sequences, 5.8 S and 28 S (according to Rinaldi et al., 2005) and the mitochondrial DNA encoding transfer RNA (tRNA-Thr) with partial sequences from the flanking cytochrome oxidase subunit I (Cox1) gene and the large subunit ribosomal RNA gene as described by Martínez-Ibeas et al. (2013). All PCR products were treated with exonuclease 1 (New England Biolabs) and Tsap (Promega) to remove free primer and dNTP’s prior to sequencing in both directions (GATC Biotech). Both PCR reactions were carried out in a total volume of 50 ␮l. For ITS-2 amplification, primers were added at 250 nM, dNTP’s at 0.2 mM each, MgCl at 2 mM and Taq (Go-Taq Flexi, Promega) at 2.5 U. For tRNA-Thr/Cox1 amplification the reaction mix contained primers (400 nM), dNTP’s (0.2 mM), MgCl (2.5 mM) and Taq (1.25 U). One and 2 ␮l DNA template (at an approx. concentration of 60 ng/␮l) were added to the two amplification reactions respectively.

Primers, PCR and ExoTsap treatment conditions are summarised in Table 2. Sequences from the 2 loci were aligned with each other (Clustal Omega) and compared to the GenBank database (Blast analysis). 2.4. Phylogenetic analysis The level of heterogeneity between amplicons of the tRNA-Thr/Cox1 locus and JQ815200, the single corresponding published sequence, was analysed by constructing a neighbour-joining tree (MEGA 5.2.2, Kumar et al., 2004). Tree reliability was assessed by the bootstrap method with 1000 pseudoreplicates. The percentage of replicate trees resulting in the same clusters is shown next to the branches. A Median Joining Network was constructed using Network 4.5 (Flexus Technology Ltd.) software in order to investigate frequency and distribution of the various haplotypes further. For this analysis, the dataset also included tRNA-Thr/Cox1 27 sequences amplified from infected cattle autopsied at the Veterinary Sciences Division (AFBI) in Northern Ireland. They contained isolates from counties Antrim, Armagh and Down. Haplotype and nucleotide diversity (Hd and ␲) were calculated using DnaSP V5 (Librado and Rozas, 2009). For network and genetic diversity analyses, the 70 sequences from herds A, B and ‘other cattle’ were trimmed to the same length as the slightly shorter isolate sequences from Northern Ireland. Nucleotide sequence data for the haplotypes sequenced in this study, designated as IE1–IE16, are available in EMBL, GenBankTM and DDJB databases under Accession numbers KJ574046 to KJ574061.

Table 2 Details of PCR and ExoTsap protocols. Protocol

Fragment size (bp)

Primers (5 -3 )/enzymes

Conditions

ITS-2

428

Fw: TGTGTCGATGAAGAGCGCAG Rev: TGGTTAGTTTCTTTTCCTCCGC

tRNA-Thr/Cox1

885

Fw: TGGAGAGTTTGGCGTCTTTT Rev: CCATCTTCCACCTCATCTGG

95 ◦ C 10 min 35 cycles: 94 ◦ C 1 min, 53 ◦ C 90 s, 72 ◦ C 1 min 72 ◦ C 10 min 92 ◦ C 2 min 38 cycles: 95 ◦ C 30 s, 65 ◦ C 30 s, 72 ◦ C 90 s 72 ◦ C 10 min 37 ◦ C 15 min 80 ◦ C 15 min 10 ◦ C 30 min

ExoTsap treatment

0.5 U exonuclease 1 & 0.1 U TSAP per 20 ␮l PCR product



ARTICLE IN PRESS

4


paramphistome eggs and 70% of faecal samples contained in excess of 50 epg (category +++) (Fig. 2c). In fact, in July, over 200 epg were counted in 32.5% of samples. Again during late autumn and winter, egg numbers declined, however, all animals continued to shed rumen fluke eggs. 3.3. Morphometric and molecular aspects of rumen fluke isolates

Fig. 1. Percentage of faecal diagnostic UCDVH submissions that were positive for paramphistome eggs between 2004 and 2013. Blue bars indicate bovine (n = 667), red bars ovine samples (n = 272). Figures under the xaxis indicate the number of cattle and sheep faecal samples examined each year.

3. Results 3.1. Historical incidence of paramphistomes according to UCDVH records Between 2004 and 2013, the overall number of diagnostic bovine samples that were assessed for the presence of paramphistome eggs by sedimentation was 667. Laboratory records show that from about 2009, the percentage of positive samples started to increase from a baseline of approx. 3–9% to around 20% with peaks in 2010 (32%) and 2013 (28%) (Fig. 1). In sheep samples, the increased prevalence from 2009 was even more pronounced, however, the overall number of ovine faecal samples examined (n = 272) during the period was much lower. 3.2. Prevalence and intensity of rumen fluke infections in three cattle herds Herd A, Kildare: On the first sampling occasion, 32% of animals in herd A were found to shed paramphistome eggs. By the 5th sampling occasion, 8 weeks later, prevalence had increased to almost 62% (Fig. 2a). Generally, numbers of epg faeces were low (the highest count of approx. 13 epg, was recorded on the last sampling occasion), with no sample exceeding the limit for category +. Herd B, Wexford: The percentage of positive samples increased gradually from 15% in the first sample to 57% in the May and July samples (Fig. 2b). In autumn, prevalence started to drop off again and reached about 42% by January of the following year. The peak in prevalence was mirrored by intensities of infection with 28% of faecal samples in category +++ (>50 epg) recorded in July. On this occasion 10% of samples contained over 200 epg. Animals that remained negative throughout belonged to a single age cohort of bulls that were grazed separately. Herd C, Tipperary: As in herd B prevalence and intensity increased steadily from the first sampling occasion in November 2012 (60% of samples positive, 10% in category +++) to July/September when all animals were shedding

Rumen flukes collected from slaughtered animals varied considerably in size, ranging from 6 to 68 mg (Fig. 3). Parasites from cattle in herds A and B were significantly larger (mean 42.6 mg ± 8.3 s.d. and 44.7 mg ± 13.0 s.d., respectively) than those from ‘other’ cattle (mean 28.7 mg ± 12.8 s.d.) (One-way ANOVA, p < 0.0001, df 2; f: 33.37). Amplification of the ITS-2 region yielded identical products in all isolates, matching the published C. daubneyi sequence (AY790883) 100%. In contrast, there was a considerable degree of heterogeneity in the amplified region of mitochondrial DNA amongst our isolates (greatest discrepancy was 2.35%) as well as in comparison with the published sequence, JQ815200 (up to 2.21%). Overall 16 different haplotypes were identified which had a leptokurtic distribution, i.e. there was a relatively small number of very common haplotypes. Eight isolates were recorded only once (Fig. 4a). The greatest variety of haplotypes was recorded for herd A (n = 11), followed by B (n = 8) and ‘other cattle’ (n = 6). In addition, ‘infrequent’ and ‘rare haplotypes’ were most commonly identified in herd A, and least often in ‘other cattle’ (Fig. 4b). Phylogenetic analysis indicated three main clades with bootstrap support over 50% (Fig. 5). The haplotypes that were most similar to JQ815200 were IE1, the most commonly identified haplotype in this study, and IE12 which was only amplified once. In fact, sequence JQ815200 contains 3 R’s indicating positions either occupied by bases A or G. With this taken into account, IE1 only differed by two single base deletions, and IE12 by an additional single nucleotide polymorphism (SNP) from JQ815200. There was no obvious clustering of haplotypes in individual hosts or herds. 3.4. Phylogenetic relationship of bovine paramphistomes collected throughout the island of Ireland Analysis of isolates from Northern Ireland yielded an additional two haplotypes that had not been detected in Herds A, B or ‘other cattle’. The Median Joining Network constructed from a total of 97 isolates, shows the interrelationships, frequency and diversity of all haplotypes recorded throughout the island (Fig. 6). Following trimming of all sequences to the same length, a SNP that differentiated two haplotypes (IE9 and IE10) was lost. As a result sequences with these two haplotypes were combined with IE7 and IE8, respectively. Again there was no obvious clustering by region, with five out of eight common and infrequent haplotypes from the Republic also recorded in Northern Ireland. With one exception (IE16), none of the ‘rare’ haplotypes (IE9–15) were detected in Northern Ireland. Overall the network had a linear rather than star-like appearance. Regarding genetic diversity, the northern and the southern paramphistome populations



ARTICLE IN PRESS A. Zintl et al. / Veterinary Parasitology xxx (2014) xxx–xxx

5

Fig. 2. Faecal egg counts in herds A (a), B (b) and C (c). The figures show the percentages of faecal samples categorised as 0, + (250 eggs counted, i.e. in excess of 50 epg faeces).



ARTICLE IN PRESS

6


Fig. 3. Frequency histogram showing weights [mg] of flukes collected from animals in herd A (black line), herd B (red line) and ‘other’ cattle slaughtered during the abattoir visit (green line). (For interpretation of the references to color in figure legend, the reader is referred to the web version of the article.)

were comparable with haplotype diversities (Hd) of 0.806 and 0.885 and nucleotide diversities () of 0.00743 and 0.00839, respectively. 4. Discussion In 1950, Willmott reported that out of several hundred cattle in abattoirs in Britain and Ireland, only a very small

number were heavily infected with rumen fluke (Willmott, 1950), indicating that paramphistomes were not common in cattle at that time. It is possible that even ten years ago, rumen fluke infection rates were higher than that (laboratory records indicate prevalence rates of 4–5% on average). However, there was a much more significant and sudden rise in 2009, when the percentage of paramphistomepositive faecal samples increased five-fold on average.

Fig. 4. (a) Frequency of tRNA-Thr/Cox1 haplotypes and (b) distribution of common, occasional and rare haplotypes in herds A, B and in ‘other’ cattle.


G Model

ARTICLE IN PRESS

VETPAR-7260; No. of Pages 10


63

7

IE8RF14.17.19 (146. 177.197) IE9RF18 (187 )

12

IE7RF40.41.43.50 (4014.4114.4315.5017)

29

85

RF42 IE10 (4214)

IE11 (62) RF6

63 16 90

IE3RF10.23.24.25.27.34.44.53.54.58 (104.239.249.259.2710.3412.4414.53.54.58) IE4RF5.8.9.32.57.59.70 (52.84.94.3211.57.59.70) JQ815200

IE1RF11.12.13.28.45.49.52.56.60.61.62.63.66.67.69 (115.125.135.2810.4515.4917.52.56.60.61.62.63.66.67.69)

87 38

RF64 IE12 (64)

95

IE5RF1.3.15.16.20.21 (11.31.156.166. 208.218)

RF7 IE13 (73) RF22 IE14 (228) RF39 IE15 (3913)

57

IE2RF2.26.30.31.36.37.38.46.47.48.55.65 (21.2610.3010.3111.3612.37.13.3813.4616.4716.4816.55.65)

47

RF4 IE16 (42)

21 65

IE6RF29.33.35.51.68 (2917.3311.3512.51.68)

Fig. 5. Phylogenetic relationship of rumen fluke isolates (IE1–IE16 and published sequence JQ815200) according to mtDNA fragments tRNA-Thr/Cox1. Plain black figures indicate flukes collected from animals in herd (A) bold black figures indicate flukes from cattle in herd (B) while grey numbers are isolates from ‘other’ cattle. Superscripts refer to individual host animals.

Regional veterinary laboratories elsewhere in Ireland and the UK reported a similar increase in paramphistome eggs in bovine samples (Foster et al., 2008; Murphy et al., 2008). Moreover, reports of outbreaks of clinical paramphistomosis in both sheep and cattle started to emerge (Murphy et al., 2008; Murray et al., 2010; Mason et al., 2012; Millar et al., 2012). Whether this apparent change in the epidemiology of rumen fluke was due to the accidental importation and spreading of a second, more vigorous paramphistome species or whether it was due to changed environmental conditions that enhanced the transmission of a species that was always present, is difficult to say. Based on morphology, Willmott identified all flukes found in Britain and Ireland as Paramphistomum spp. (1950). The first time flukes from the region were typed was in 2013, when parasites collected from a cow imported from Ireland into Scotland were identified as C. daubneyi (Gordon et al., 2013). These workers also found that, C. daubneyi, rather than P. cervi as previously thought, was the most common rumen fluke of domestic ruminants in Scotland. Likewise, our study indicates C. daubneyi is the dominant, if not only species present in cattle in Ireland. Moreover, the parasite was found to be extremely common in our study areas, with peak levels of prevalence (57 and 100% in herds B and C respectively) far exceeding those reported in cattle in Northwestern Spain (6–20%; Díaz et al., 2007; González-Warleta et al., 2013; Ferreras et al., 2014) or Central France (20%; Szmidt-Adjidé et al., 2000). Infection intensities on the other hand, were comparable in these countries, with very high fluke burdens (8–11,000 per animal) and extremely high egg outputs reported in individual cattle (700–2700 epg). In contrast to herds B and C, animals in herd A were housed throughout the study. As with intensive systems elsewhere (Ferreras et al., 2014) their fluke burdens were low as indicated by faecal egg count. Ferreras and colleagues suggested that housed cattle may acquire rumen fluke infections from

contaminated fodder (2014), however we think it more likely that they had become infected prior to purchase at the mart. Although the calves were only 3–8 months of age at the time, infection rates according to faecal egg count were as high as 62%. In the literature, seasonal patterns of paramphistomosis are consistently linked to precipitation as highest infection levels usually follow soon after periods of heavy rainfall associated with waterlogged pasture and flooding (Cringoli et al., 2004; Díaz et al., 2006; Mason et al., 2012; Millar et al., 2012; González-Warleta et al., 2013). It is likely that frequent and persistent spring rainfall, typical for Ireland, caused the gradual accumulation of metacercariae on pasture resulting in peak infection levels in July. On the next sampling occasion in September infections had started to decline, although animals were not housed for another two months. Whether this drop-off in prevalence and egg output was due to the unusually dry and warm weather in summer 2013 causing suitable snail habitat to dry out, or whether this is a typical feature of paramphistome epidemiology on the island, is yet to be determined. As previously mentioned, herd A was housed upon purchase, presumably precluding any further infection from taking place, and slaughtered nine months later, at which point flukes were collected for morphological and molecular analysis. Nonetheless, the sizes of flukes collected from these animals, though ranging widely, were the same on average as those collected from herd B, indicating that many of the flukes in that herd may also have been acquired some time ago, possibly even during the previous year. In contrast, flukes collected from ‘other cattle’ during the abattoir visits were significantly smaller on average, indicating that these animals continued to accumulate rumen flukes well into the summer and possibly autumn. In addition to molecular identification to species level, flukes were further analysed by amplification and sequencing of a mitochondrial DNA fragment (tRNA-Thr/Cox1). The locus showed a high level of genetic diversity. IE1, the



ARTICLE IN PRESS

8


Fig. 6. Median Joining Network for 18 C. daubneyi haplotypes from Ireland. Open areas indicate isolates from the Republic of Ireland (Herd A, Kildare, Herd B, Wexford and ‘other cattle), closed areas indicate Northern Ireland isolates (from counties Antrim, Down, Armagh). Each circle is a haplotype, size is proportional to the number of samples with that haplotype and the red numbers indicate sites at which nucleotide changes differentiate between the haplotypes. (For interpretation of the references to color in figure legend, the reader is referred to the web version of the article.)

most commonly identified haplotype resembled the only published sequence, JQ815200 most closely, suggesting a genetic bottleneck through introduction, the latter having been amplified from flukes collected from bovine rumens in Spain (Martínez-Ibeas et al., 2013). However, the second and third most common haplotypes each clustered within separate clades. In F. hepatica, another very common trematode in the region, the corresponding mitochondrial locus is also of high genetic diversity, with 92 haplotypes having been

observed in a total sample size of 422 liver fluke adults collected from Dutch cattle, and 35 haplotypes in 154 F. hepatica recovered from a single Irish calf (Walker et al., 2007 and 2011). By comparison, we identified 18 haplotypes in a total of 96 paramphistomes, suggesting that the genetic diversity in rumen fluke is similar to that of liver fluke. This was also indicated by our calculated haplotype and nucleotide diversity (for comparison Hd and -values recorded for F. hepatica in the Dutch study were 0.872 and 0.00379, respectively). As with liver fluke, this high level of



ARTICLE IN PRESS A. Zintl et al. / Veterinary Parasitology xxx (2014) xxx–xxx

diversity may have important implications for the development of anthelmintic resistance, as it is likely to render the parasite highly adaptable. The leptokurtic distribution of haplotypes observed here has also been noted for F. hepatica (Walker et al., 2011). However, when Dutch liver fluke haplotypes were analysed by Median Joining Network analysis, a star-like formation emerged represented by apparent ancestral nodes surrounded by derived haplotypes that differed by only one or two nucleotide changes (Walker et al., 2011). In contrast, the network constructed with rumen fluke isolates, showed a more linear morphology consistent with either the recent expansion of a relatively small but dispersed (established) population or multiple introductions from a larger parent population. To conclude, we found that the paramphistome C. daubneyi was extremely common in cattle in Ireland. No other rumen fluke species was identified. While in our study areas, pasture contamination gradually increased during spring and early summer, resulting in peak infection levels in July, this is probably not universally the case as it is likely to depend on whether waterlogged patches on pasture dry out during the summer or not. Due to the longevity of the parasite, we found that intensively reared cattle may continue to harbour rumen flukes acquired prior to housing, for considerable periods of time. Historical records of paramphistomes in Ireland and Britain suggest that the epidemiology of the parasite has changed dramatically in the last number of years. It is still debatable whether this change is due to the introduction of a new species or an expansion of a pre-existing population. The very high level of genetic diversity with common haplotypes throughout the island, is more consistent with the recent expansion of an established population. On the other hand, if the same haplotypes are present (and dominant) elsewhere, then our results could also be explained by multiple introductions from this large parent population. Walker and colleagues (2007, 2011) reported extensive genetic diversity of liver flukes collected from a single animal. Therefore even a very small number of infected animals brought into Ireland could give rise to a very divergent field population. The clinical and economic significance of paramphistomes for Irish livestock is yet to be determined. In our study, no obvious clinical signs were observed in spite of very considerable paramphistome burdens in individual cattle. However, reports from elsewhere suggest that C. daubneyi can cause serious morbidity and mortality in young cattle and sheep of any age (Mason et al., 2012; Millar et al., 2012). Furthermore, potential hidden cost due to reduced milk yield or impaired food conversion, particularly in co-infections with F. hepatica, with which it appears to share an intermediate host, warrant further investigation.

Conflict of interests The authors declare no conflict of interest.

9

Acknowledgements Work in the authors’ laboratories is funded by the EU Commission FP7 (PARAVAC – FP & Project Number 265862) and SFI Principle Investigator Grants (09/IN.1/B2625). References Abrous, M., Rondelaud, D., Dreyfuss, G., 2000. A field study of natural infections in three freshwater snails with Fasciola hepatica and/or Paramphistomum daubneyi in central France. J. Helminthol. 74, 189–194. Augot, D., Abrous, M., Rondelaud, D., Dreyfuss, G., 1996. Paramphistomum daubneyi and Fasciola hepatica: the redial burden and cercarial shedding in Lymnaea truncatula subjected to successive unimiracidial cross-exposures. Parasitol. Res. 82, 623–627. Boray, J.C., 1959. Studies on intestinal amphistomes in cattle. Aust. Vet. J. 35, 282–287. Cringoli, G., Taddei, R., Rinaldi, L., Veneziano, V., Musella, V., Cascone, C., Sibilio, G., Malone, J.B., 2004. Use of remote sensing and geographical information systems to identify environmental features that influence the distribution of paramphistomosis in sheep from the southern Italian Apennines. Vet. Parasitol. 122, 15–26. De Waal, T., 2010. Paramphistomum – a brief review. Irish Vet. J. 63, 313–315. Díaz, P., Lomba, C., Pedreira, J., Arias, M., Sánchez-Andrade, R., Suárez, J.L., ˜ P., Morrondo, P., Paz-Silva, A., 2006. Analysis of the IgG Díez-Banos, antibody response against Paramphistomidae trematoda in naturally infected cattle. Application to serological surveys. Vet. Parasitol. 140, 281–288. Díaz, P., Pedreira, J., Sánchez-Andrade, R., Suárez, J.L., Arias, M.S., ˜ P., Morrondo, P., PazFrancisco, I., Fernández, G., Díez-Banos, Silva, A., 2007. Risk periods of infection by Calicophoron daubneyi (Digenea:Paramphistomidae) in cattle from oceanic climate areas. Parasitol. Res. 101, 339–342. Ferreras, M.C., González-Lanza, C., Pérez, V., Fuertes, M., Benavides, J., Mezo, M., González-Warleta, M., Giráldez, J., Martínez-Ibeas, A.M., Delgado, L., Fernández, M., Manga-González, M.Y., 2014. Calicophoron daubneyi (Paramphistomidae) in slaughtered cattle in Castilla y León (Spain). Vet. Parasitol. 199, 268–271. Foster, A.P., Otter, A., O’Sullivan, T., Cranwell, M.P., Twomey, D.F., Millar, M.F., Taylor, M.A., 2008. Rumen fluke (paramphistomosis) in British cattle. Vet. Rec. 162, 528. González-Warleta, M., Lladosa, S., Castro-Hermida, J.A., Martínez-Ibeas, ˜ F., López-Quílez, A., Manga-González, Y., A.M., Conesa, D., Munoz, Mezo, M., 2013. Bovine paramphistomosis in Galicia (Spain): prevalence, intensity, aetiology and geospatial distribution of the infection. Vet. Parasitol. 191, 252–263. Gordon, D.K., Roberts, L.C., Lean, N., Zadoks, R.N., Sargison, N.D., Skuce, P.J., 2013. Identification of the rumen fluke, Calicophoron daubneyi, in GB livestock: possible implications for liver fluke diagnosis. Vet. Parasitol. 195, 65–71. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150–163. Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451–1452. Martínez-Ibeas, A.M., González-Warleta, M., Martínez-Valladares, M., ˜ B., Ferreras, C., Castro-Hermida, J.A., González-Lanza, C., Minambres, Mezo, M., Manga-González, M.Y., 2013. Development and validation of a mtDNA multiplex PCR for identification and discrimination of Calicophoron daubneyi and Fasciola hepatica in the Galba truncatula snail. Vet. Parasitol. 195, 57–64. Mason, C., Stevenson, H., Cox, A., Dick, I., Rodger, C., 2012. Disease associated with immature paramphistome infection in sheep. Vet. Rec. 170, 343–344. Mavenyengwa, M., Mukaratirwa, S., Monrad, J., 2010. Influence of Calicophoron microbothrium amphistomosis on the biochemical and blood cell counts of cattle. J. Helminthol. 84, 355–361. Millar, M., Colloff, A., Scholes, S., 2012. Disease associated with immature paramphistome infection. Vet. Rec. 171, 509–510. Murphy, T.M., Power, E.P., Sanchez-Miguel, C., Casey, M.J., Toolan, D.P., Fagan, J.G., 2008. Paramphistomosis in Irish cattle. Vet. Rec. 162, 831. Murray, G., Joyce, C., Fagan, J., O’Donovan, J., Gaffney, K., Casey, M., Hanna, R., Sammin, D., 2010. Clinical paramphistome infestation in ruminants in Ireland. In: 64th Annual Meeting of the Association for Veterinary Teaching and Research Work, York, March 29–31, 2010.



ARTICLE IN PRESS

10


´ ´ I., Savic, ´ B., Ivanovic, ´ S., Cirovi ´ D., 2012. First occurrence Pavlovic, c, of Paramphistomum microbothrium (Fischoeder 1901) in roe deer (Capreolus capreolus) in Serbia. J. Wildl. Dis. 48, 520–522. Rangel-Ruiz, L.J., Albores-Brahms, S.T., Gamboa-Aguilar, J., 2003. Seasonal trends of Paramphistomum cervi in Tabasco, Mexico. Vet. Parasitol. 116, 217–222. Rinaldi, L., Perugini, A.G., Capuano, F., Fenizia, D., Musella, V., Veneziano, V., Cringoli, G., 2005. Characterization of the second internal transcribed spacer of ribosomal DNA of Calicophoron daubneyi from various hosts and locations in southern Italy. Vet. Parasitol. 131, 247–253. Rolfe, P.F., Boray, J.C., Nichols, P., Collins, G.H., 1991. Epidemiology of paramphistomosis in cattle. Int. J. Parasitol. 21, 813–819. Sey, O., 1980. Revision of the amphistomes of European ruminants. Parasitol. Hung. 13, 13–25. Singh, R.P., Sahai, B.N., Jha, G.J., 1984. Histopathology of the duodenum and rumen of goats during experimental infections with Paramphistomum cervi. Vet. Parasitol. 15, 39–46. Spence, S.A., Fraser, G.C., Chang, S., 1996. Responses in milk production to control of gastrointestinal nematode and paramphistome parasites in dairy cattle. Aust. Vet. J. 74, 456–459.

Szmidt-Adjidé, V., Abrous, M., Adjidé, C.C., Dreyfuss, G., Lecompte, A., Cabaret, J., Rondelaud, D., 2000. Prevalence of Paramphistomum daubneyi infection in cattle in central France. Vet. Parasitol. 87, 133–138. Taylor, M.A., Coop, R.L., Wall, R.L., 2007. Veterinary Parasitology. Blackwell Publishing, Oxford, 799 pp. Walker, S.M., Prodöhl, P.A., Fletcher, H.L., Hanna, R.E., Kantzoura, V., Hoey, E.M., Trudgett, A., 2007. Evidence for multiple mitochondrial lineages of Fasciola hepatica (liver fluke) within infrapopulations from cattle and sheep. Parasitol. Res. 101, 117–125. Walker, S.M., Johnston, C., Hoey, E.M., Fairweather, I., Borgsteede, F., Gaasenbeek, C., Prodöhl, P.A., Trudgett, A., 2011. Population dynamics of the liver fluke, Fasciola hepatica: the effect of time and spatial separation on the genetic diversity of fluke populations in the Netherlands. Parasitology 138, 215–223. Willmott, S., 1950. On the species of Paramphistomum Fischoeder, 1901 occurring in Britain and Ireland with notes on some material from the Netherlands and France. J. Helminthol. 24, 155–170.
