by myzus persicae

Journal of Plant Pathology (2016), 98 (3), 581-585 Edizioni ETS Pisa, 2016 581 Short Communication

TRANSMISSION OF VIRUSES ASSOCIATED WITH CARROT MOTLEY DWARF BY MYZUS PERSICAE M.T. Naseem1,2,3, M. Ashfaq4, A.M. Khan5, Z. Kiss3, K.P. Akhtar6 and S. Mansoor1,2 1 National

Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan Institute of Engineering and Applied Sciences, Islamabad, Pakistan 3 Department of Plant Pathology, University of California, Davis, California, USA, 95616 4 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada 5 Department of Biotechnology, University of Sargodha, Sargodha, Pakistan 6 Nuclear Institute for Agriculture and Biology, Faisalabad, Pakistan 2 Pakistan

SUMMARY

Co-infection of Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV) and Carrot red leaf virus associated RNA (CtRLVaRNA) causes Carrot motley dwarf (CMD) disease. This study examined the capacity of the aphid Myzus persicae at transmitting viruses associated with CMD. M. persicae exposed to CMD-infected chervil plants transmitted CtRLV-, CMoV- and CtRLVaRNA to diseasefree chervil, fennel, celery, carrot, cilantro, and parsley, as shown by RT-PCR using specific primers. Recipient plants developed typical CMD symptoms. Sequence analysis of the amplified virus genes showed high sequence diversity with corresponding sequences available in GenBank. This study expands on Cavariella aegopodii, the only previously recognized aphid vector of CMD-causing viruses. Keywords: Carrot red leaf virus, Carrot mottle virus, Polerovirus, Umbravirus, Apiaceae.

Carrot motley dwarf (CMD) is caused by a complex of three viruses: Carrot red leaf virus (Family Luteoviridae; Genus Polerovirus; CtRLV), Carrot mottle virus (Family Tombusviridae; Genus Umbravirus; CMoV) and Carrot red leaf virus associated RNA (Grouped under: Virusdependent nucleic acids: Polerovirus-associated RNAs: CtRLVaRNA) (King et al., 2012). CMD affects members of the family Apiaceae (Watson et al., 1964) and its typical symptoms include stunted growth, pronounced reddening, chlorotic mottling, and overall yellowing of the foliage (Krass and Schlegel, 1974; Watson and Falk, 1994). Two members of the virus complex, CMoV and CtRLVaRNA, are capable of replicating independently but are dependent on CtRLV for their transmission to new plant hosts. This Corresponding author: M.T Naseem E-mail: [email protected]

is because CMoV and CtRLVaRNA do not encode a coat protein (CP) and are encapsidated by the CtRLV CP (Falk et al., 1999; Murant, 1974; Murant et al., 1985; Waterhouse and Murant, 1983). CMoV is transmissible via mechanical inoculation (Elnagar and Murant, 1978; Watson et al., 1964) but mechanical transmission of CtRLVaRNA is not known (Falk et al., 1999). The viruses triggering CMD are transmitted by Cavariella aegopodii (Hemiptra: Aphididae) in a persistent, nonpropagative manner (Elnagar and Murant, 1978; Watson et al., 1964; Watson et al., 1998). Prior reports on other aphid species, including Myzus persicae, Cavariella pastinacae and C. theobaldi, do not support their involvement in the transmission of CtRLV and/or CMoV (Murant, 1974; Stubbs, 1952; Watson et al., 1964). The current study examined the involvement of M. persicae in transmission of the three components of the virus complex (CtRLV, CMoV, CtRLVaRNA) and causation of CMD in plants of the family Apiaceae. The virus source used for the transmission study was obtained from naturally infected parsley (Petroselinum crispum) plants, considering that CtRLV is the only known polerovirus that infects parsley and is transmitted by C. aegopodii (Chan et al., 1991; Brunt et al., 1997). Naturally infected parsley plants with typical symptoms of CMD and presence of the three viruses confirmed by RT-PCR using redundant primers (Vercruysse et al., 2000) were tagged in fields in Salinas Valley, California, USA. Aphids, C. aegopodii, were collected from tagged symptomatic parsley plants and released onto healthy chervil (Anthriscus cerefolium) plants for disease development and virus multiplication, whilst M. persicae were collected from celery plants. The adults were allowed to feed on parafilm embedded 20% sucrose to gain virus-free progeny. The colonies of non-viruliferous C. aegopodii and M. persicae were reared on reported non-host plants, celery (Apium graveolens) and radish (Raphanus sativus), maintained in a glasshouse in separate cages. The experimental plants were kept in a controlled growth chamber at 24 ± 1°C and 70% R.H and the transmission experiments were set up according to Watson and Falk (1994).

582

Journal of Plant Pathology (2016), 98 (3), 581-585

Virus transmission by Myzus persicae

Table 1. Primers used in RT-PCR to verify the presence of viruses in plants. Internal Primers based on obtained sequencea Primer CtRLVaRNA aRNA F aRNA R2 CMoV MTN-21 F MTN-21 R CtRLV RLV-F2 RLV-R2

Sequence

Product Tm size (bp) (°C)

CTCTCAAGTTCCAGTACTTGG TGGACATGCTCAATTGGTG

309

55

CAACTCCCTCAAGAACCTCGT GGTCAGGTTTGGCTGTGAAG

321

55

ACACCTTCGTGCTGTCTGGTT CGAGAATTTGTGGACGACGTATT

150

55

a Primers

were designed on bases of sequences obtained from cloned product of each virus by using Vector NTI® software.

C. aegopodii and M. persicae were identified through morphological characteristics using the taxonomic key from Blackman and Eastop (2000). DNA was isolated by DNeasy blood and tissue kit (Cat. No. 69506, Qiagen) and aphid species identities were further confirmed by DNA barcoding using the universal COI primers (LCO-1490 and HCO-2198) (Foottit et al., 2008; Hebert et al., 2003) and phylogenetic analysis. Plant material for the host range study included members of the family Apiaceae [viz. chervil (Anthriscus cerefolium L.), fennel (Foeniculum vulgare M.), celery (Apium graveolens L.), carrot (Daucus carota L.), cilantro (Coriandrum safivum L.), and parsley (Petroselinum crispum M.)]. Radish (Raphanus sativus L.) and Nicotiana benthamiana D. were included as negative controls. Ten to fifteen non-viruliferous, adult apterous aphids of each species (C. aegopodii and M. persicae), starved for two hours (h), were allowed to feed separately on virusinfected detached leaves of chervil in 6 cm petri dishes for a 24 h acquisition access period (AAP) (Powell, 1993). The aphids were then transferred to healthy seedlings of the test plants separately. A total of 48 h of inoculation access period (IAP) was granted for virus transmission. Aphids were then killed by spraying an insecticide (Pounce® 3.2EC: FMC) and plants were retained and grown inside insect proof cages at 24 ± 1°C with 16 h light/8 h dark photoperiod. Disease symptoms were observed and virus transmission rates were estimated as described (Gibbs and Gower, 1960). Virus transmission by both aphid species was also performed by membrane feeding. For this purpose, virions were partially purified from host plants following the protocol adapted from Almeida et al. (2005) with minor modifications. Purification was accomplished by flash-freezing 100 g of infected leaf tissue in liquid nitrogen followed by homogenization using a mortar and a pestle and the addition of 5 ml of extraction buffer (0.1 M KPO4, 0.01 M glycine, pH 7.0) for stirring for five min at room temperature. Following thorough mixing the crude extract was filtered through cheese cloth, and the filtrate was subjected to

Fig. 1. Transmission rate calculations based on symptoms by visual observation of the infected plants, infested by viruliferous aphid species, Cavariella aegopodii and Myzus persicae.

centrifugation at 8,000 g for 5 min at 4°C. The supernatant was subjected to ultracentrifugation by using 1 ml of 20% sucrose (in extraction buffer) as a cushion to ensure efficient pelleting of the virions. The ultracentrifugation was carried out at 50,000 g for one h at 4°C and the pellet was resuspended in 250 µl buffer (0.05 M KPO4, 0.01 M glycine, pH 7.0) and transferred into a 1.5 ml centrifuge tube. Purified virions were mixed with 15% sucrose for aphid feeding for 24 h after a 2-h pre-acquisition starvation. Viruliferous aphids were then transferred to healthy test plant seedlings for inoculation. The experiment was repeated three times and at least ten plants per repeat for each plant species were used for inoculation. RNA was isolated from inoculated-plant leaves using TRIzol® Reagent (Life Technologies Inc., Cat. No: 10296028). The RNA was used for one-step reverse transcriptase polymerase chain reaction (RT-PCR) (Khan et al., 2013) using redundant primers (Vercruysse et al., 2000) and the following amplification conditions: 42°C for 50 min, 95°C for 10 min, 95°C for 30 s, 45 s at the appropriate annealing temperature, 72°C for 30 s, and for final extension 72°C for 10 min. The amplification cycle was repeated 35 times. The PCR products were separated by electrophoresis on 2% agarose gels, stained with ethidium bromide, and visualized on a UV platform. The target PCR products were cloned into pGEM-T Easy® vector (Promega, Cat. No. A1360) following the manufacturer’s protocol and positive clones were sequenced at the UC Davis Sequencing Facility. The sequences were analyzed using Basic Local Alignment Search Tool (BLAST) on NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The amino acid sequence of RNA-dependent RNA polymerase (RdRp) gene of the respective viruses was retrieved from UniProt (http://www.uniprot.org) and aligned with the translated amino acids of amplified RdRp gene sequences using Clustal Omega (Sievers et al., 2011). For the specific detection of transmitted viruses, primers were designed within amplified regions from the obtained virus sequences for one step RT-PCR (Table 1). Typical CMD symptoms were observed in chervil, fennel, celery, carrot, cilantro and parsley plants in all the trials with C. aegopodii and M. persicae (Fig. 1). The negative controls, radish and N. benthamiana, did not


Naseem et al.

583

Table 2. RT-PCR verification of virus transmission by aphids in different instances after the same acquisition access period and inoculation access period through plant leaves and membrane feeding. Acquisition through viruliferous plant leavesa

Plants

Chervil Fennel Celery Carrot Cilantro Parsley N. benthamianac Radishc

CtRLV M.p 9d 7 5 8 4 6 0 0

CMoV C.a 8 4 7 8 7 5 0 0

M.p 7 4 6 6 5 6 0 0

Acquisition through membraneb

CtRLVaRNA C.a 7 3 7 6 4 6 0 0

M.p 8 0 8 8 7 7 0 0

C.a 8 0 5 9 6 4 0 0

CtRLV M.p 8 5 7 8 7 5 0 0

CMoV C.a 7 4 6 6 5 6 0 0

M.p 8 5 5 9 6 4 0 0

CtRLVaRNA C.a 9 7 5 8 4 6 0 0

M.p 7 3 7 6 4 6 0 0

C.a 8 4 8 8 7 7 0 0

a Inoculation

of virus from infected detached leaves to healthy plants. of virus were performed in lab conditions and inoculations in greenhouse growth chambers. c N. benthamiana and radish were used as negative controls. d Number of infected plants per ten plants. M.p. = Myzus persicae; C.a. = Cavariella aegopodii. b Acquisition

show CMD symptoms. RT-PCR results revealed that, except for fennel where CtRLVaRNA transmission from infected leaves failed, all the host plants showed successful transmission of the three members of the CMD causing virus complex (CtRLV, CMoV, CtRLVaRNA) by both aphid species and from both virus-acquisition sources (Table 2). The nucleotide sequences of the three viruses showed maximum similarities with the RdRp gene from CtRLV (210 bp, 72%), CMoV (408 bp, 75%) and CtRLVaRNA (484 bp, 94%) particularly with CtRLV-UK1 (GenBank accession No. AY695933), CMoV_H8 (KF533713), and CtRLVaRNA clone sigma (KM486093), respectively. At the amino acid level, identities were 80%, 82% and 97% with CtRLV-UK1 (Q670I5), CMoV-Weddel (B6UQC5) and CtRLVaRNA-sigma (A0A0C5BW25), respectively. Phylogenetic trees were constructed in Mega 6.0 (Tamura et al., 2013) using nucleotide sequences under Maximum Likelihood method based on the Kimura 2-parameter model with 1,000 bootstrap value (Fig. 2A-C). The partial nucleotide sequences of RdRp gene were submitted to the European Nucleotide Archive (ENA) with accession numbers LN554261, LN554262 and LN554263 for CMoV, CtRLV and CtRLVaRNA, respectively. M. persicae transmits more than 180 plant viruses (Mandrioli, 2012). In previous studies, M. persicae, C. pastinacae, C. theobaldi and several other aphid species have been tested for their ability to transmit CtRLV and CMoV but no transmission has been documented (Murant, 1974; Stubbs, 1952; Waterhouse, 1985; Watson et al., 1964). In the current study, the capacity of M. persicae to transmit viruses associated with CMD was found almost similar to that of C. aegopodii. Plant species that are reported to be non-hosts for these viruses (Watson and Falk, 1994) were also tested, and found to be hosts for CMD-causing viruses transmitted by the aphid species, C. aegopodii and M. persicae. Fennel was the exception because CtRLVaRNA was not detected when aphids were subjected to virus

acquisition through detached leaves. Aphid biotypes are known to differ in their ability to transmit viruses and the vector competency has also been linked to host preference. For example, a study by Gray et al. (2007) showed that two biotypes of wheat aphid, Schizaphis graminum varied in their ability to transmit Barley yellow dwarf virus-PAV and Cereal yellow dwarf virus-RPV in wheat and concluded that the successful transmission of closely related viruses is regulated by different sets of aphid genes. Variation in virus-transmission ability among genotypes/biotypes has also been observed in other insect species, as illustrated for begomoviruses by Bemisia tabaci (Chowda-Reddy et al., 2012) and tospoviruses by Scirtothrips dorsalis (Dickey et al., 2015). There are numerous reports on vector-virus associations for which a certain insect was initially considered as a non-vector for a particular virus, but later investigations proved its role in transmission of the same virus. For example, BYDV-GAV is transmissible by Schizaphis graminum and Sitobion avenae (Du et al., 2007), which was earlier reported to be transmitted by S. avenae only (Zhou et al., 1987; Wang et al., 2001). Similarly, the originally characterized isolate of Soybean dwarf virus (SbDV) was known to be specifically transmitted by Aulacorthum solani but later studies showed that the virus was also transmissible by Aphis glycines (Damsteegt et al., 2011). The role of differing aphid genotypes/populations, virus isolates, and plant hosts/cultivars in virus-transmissibility has been well documented (Gray et al., 2007; Damsteegt et al., 2011; Watson, 1956). The fact that purified virus preparations were used in the current study compared to plant sap extracts used in the prior studies might explain an enhanced virus transmissibility (Weber and Hampton, 1980). CtRLV is the only component of the CMD complex responsible for aphid transmission of the three viruses, as the other components are encapsidated by the CtRLV CP. The sequence differences observed between the isolates characterized in this study and those for which information

584

Virus transmission by Myzus persicae


sequences obtained in the current study are divergent from those reported in the database and surpass ICTV demarcation criteria for different virus species, sequences from relatively small fragment sizes may not justify their status as new isolates or viruses. However, the observed divergence in the gene fragments may hint at the presence of new isolates/viruses. We suggest that distribution of CMD in the fields should be re-surveyed and the whole genome of the relevant viruses may also be sequenced to understand the background of vector shift and sequence divergence.

A

B

ACKNOWLEDGEMENTS

MTN is grateful to Dr. Bryce W. Falk, University of California, Davis, for hosting him under the IRSIP fellowship from the Higher Education Commission (HEC) Pakistan. HEC support to MTN and MA under Indigenous Fellowship and Foreign Faculty Hiring Program, respectively is acknowledged. Authors are thankful to Dr. G.W. Watson (USDA, Sacramento) for the slide preparation and verification of aphid species. MTN is thankful to Xiao-Han Mo, (Yunnan Academy of Tobacco Agricultural Sciences, China) for his expert direction to this work during his stay at UC Davis. The helpful comments of two anonymous reviewers are also acknowledged. REFERENCES

C Fig. 2. Phylogenetic trees illustrating the relationship of RdRp nucleotide sequences with other members of their respective genus/group. (A) CtRLV, (B) CMoV, (C) CtRLVaRNA. Tomato chocolate spot virus (ToChSV) RNA-1 was used as outgroup. Sequences used in this study are marked with asterisk.

is available in GenBank may also be responsible for the shift in vector species. This study provides evidence for the involvement of M. persicae in the transmission of the virus complex responsible for CMD. The ability of M. persicae along with C. aegopodii to spread CMD represents an increasing risk of introducing the viral complex in areas with high incidence of M. persicae or C. aegopodii. Although the virus

Almeida Á.M., Sakai J., Hanada K., Oliveira T.G., Belintani P., Kitajima E.W., Souto E.R., Novaes T.G.d., Nora P.S., 2005. Biological and molecular characterization of an isolate of Tobacco streak virus obtained from soybeans in Brazil. Fitopatologia Brasileira 30: 366-373. Blackman R.L., Eastop V.F., 2000. Aphids on the world’s crop: an identification and information guide. 2nd edition. John Wiley & Sons, Inc., UK. Brunt A.A., Crabtree K., Dallwitz M.J., Gibbs A.J., Watson L., Zurcher E.J., 1997. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 16th January 1997. Available at: http://biology.anu.edu.au/Groups/MES/vide/. Chan C.K., Forbes A.R., Raworth D.A., 1991. Aphid-transmitted viruses and their vectors of the world, Research Branch, Agriculture Canada. Chowda-Reddy R.V., Kirankumar M., Seal S.E., Muniyappa V., Valand G.B., Govindappa M.R., Colvin J., 2012. Bemisia tabaci phylogenetic groups in India and the relative transmission efficacy of Tomato leaf curl Bangalore virus by an indigenous and an exotic population. Journal of Integrated Agriculture 11: 235-248. Damsteegt V.D., Stone A.L., Kuhlmann M., Gildow F.E., Domier L.L., Sherman D.J., Tian B., Schneider W.L., 2011. Acquisition and transmissibility of U.S. Soybean dwarf virus isolates by the soybean aphid, Aphis glycines. Plant Disease 95: 945-950.

Journal of Plant Pathology (2016), 98 (3), 581-585 Dickey A.M., Kumar V., Hoddle M.S., Funderburk J.E., Morgan J.K., Jara-Cavieres A., Shatters R.G. Jr., Osborne L.S., McKenzie C.L., 2015. The Scirtothrips dorsalis species complex: endemism and invasion in a global pest. PLoS ONE 10: e0123747. Du Z.Q., Li L., Liu L., Wang X.F., Zhou G., 2007. Evaluation of aphid transmission abilities and vector transmission phenotypes of Barley yellow dwarf viruses in China. Journal of Plant Pathology 89: 251-259. Elnagar S., Murant A., 1978. Relations of carrot red leaf and carrot mottle viruses with their aphid vector, Cavariella aegopodii. Annals of Applied Biology 89: 237-244. Falk B.W., Tian T., Yeh H-H., 1999. Luteovirus-associated viruses and subviral RNAs. In: Vogt P.K., Jackson A.O. (eds). Satellites and Defective Viral RNAs, pp.159-175. Springer, Germany. Foottit R., Maw H., Von Dohlen C., Hebert P., 2008. Species identification of aphids (Insecta: Hemiptera: Aphididae) through DNA barcodes. Molecular Ecology Resources 8: 1189-1201. Gibbs A., Gower J., 1960. The use of a multiple‐transfer method in plant virus transmission studies-some statistical points arising in the analysis of results. Annals of Applied Biology 48: 75-83. Gray S.M., Caillaud M.C., Burrows M., Smith D.M., 2007. Transmission of two viruses that cause Barley yellow dwarf is controlled by different loci in aphid, Schizaphis graminum. Journal of Insect Science 7: 25. Hebert P.D., Cywinska A., Ball S.L., 2003. Biological identifications through DNA barcodes. Proceedings of the Royal Society of London of Biological Sciences 270: 313-321. Khan A.M., Ashfaq M., Kiss Z., Khan A.A., Mansoor S., Falk B.W., 2013. Use of recombinant tobacco mosaic virus to achieve RNA interference in plants against the citrus mealybug, Planococcus citri (Hemiptera: Pseudococcidae). PLoS ONE 8: e73657. King A.M., Adams M.J., Lefkowitz E.J., 2012. Virus taxonomy: classification and nomenclature of viruses: Ninth Report of the International Committee on Taxonomy of Viruses, Elsevier Inc., USA. Krass C., Schlegel D., 1974. Motley dwarf virus disease complex of California carrots. Phytopathology 64: 151-152. Mandrioli M., 2012. Green peach aphid (Myzus persicae): Information on green peach aphid. Encyclopedia of Life. Available at: http://eol.org/pages/588681/overview. Murant A., 1974. Carrot mottle virus. Commonwealth Mycological Institute/Association of Applied Biologists Descriptions of Plant Viruses 134: 4. Murant A., Waterhouse P.M., Raschke J., Robinson D., 1985. Carrot red leaf virus and Carrot mottle viruses observation on composition of the particles in single and mixed infections. Journal of General Virology 66: 1575-1579.

Received January 24, 2016 Accepted June 16, 2016

Naseem et al.

585

Powell G., 1993. The effect of pre-acquisition starvation on aphid transmission of potyviruses during observed and electrically recorded stylet penetrations. Entomologia Experimentalis et Applicata 66: 255-260. Sievers F., Wilm A., Dineen D., Gibson T.J., Karplus K., Li W., Lopez R., McWilliam H., Remmert M., Söding J., 2011. Fast, scalable generation of high quality protein multiple sequence alignments using Clustal Omega. Molecular systems biology 7: 539. Stubbs L., 1952. Further host range and transmission studies with a virus disease of carrot endemic in Australia. Australian Journal of Biological Sciences 5: 399-408. Tamura K., Stecher G., Peterson D., Filipski A., Kumar S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30: 2725-2729. Vercruysse P., Gibbs M., Tirry L., Höfte M., 2000. RT-PCR using redundant primers to detect the three viruses associated with Carrot motley dwarf disease. Journal of Virological Methods 88: 153-161. Wang X., Chang S., Jin Z., Li L., Zhou G., 2001. Nucleotide sequences of the coat protein and readthrough protein genes of the Chinese GAV isolate of barley yellow dwarf virus. Acta Virologica 45: 249-252. Waterhouse P.M., 1985. Isolation and identification of Carrot red leaf virus from carrot and dill growing in the Australian Capital Territory. Australasian Plant Pathology 14: 32-34. Waterhouse P., Murant A., 1983. Further evidence on the nature of the dependence of Carrot mottle virus on Carrot red leaf virus for transmission by aphids. Annals of Applied Biology 103: 455-464. Watson M.A., 1956. The effect of different host plants of Potato virus C in determining its transmission by aphids. Annals of Applied Biology 44: 599-407. Watson M., Serjeant E., Lennon E.A., 1964. Carrot motley dwarf and Parsnip mottle viruses. Annals of Applied Biology 54: 153-166. Watson M.T., Falk B.W., 1994. Ecological and epidemiological factors affecting carrot motley dwarf development in carrots grown in the Salinas Valley of California. Plant Disease 78: 477-481. Watson M.T., Tian T., Estabrook E., Falk B.W., 1998. A small RNA resembling the Beet western yellows luteovirus ST9associated RNA is a component of the California carrot motley dwarf complex. Phytopathology 88: 164-170. Weber K.A., Hampton R.O., 1980. Transmission of two purified carlaviruses by the pea aphid. Phytopathology 70: 631-633. Zhou G., Zhang S., Qian Y., 1987. Biological and serological identification of four strains of Wheat yellow dwarf viruses. Agricultural Sciences in China 20: 7-12.