Characterization of eight CBL genes expressions in ... - Springer Link

Acta Physiol Plant (2014) 36:3307–3314 DOI 10.1007/s11738-014-1698-2

ORIGINAL PAPER

Characterization of eight CBL genes expressions in maize early seeding development Chuntian Wang • Zhiheng Yuan • Shipeng Li Wei Wang • Ruili Xue • Fuju Tai

•

Received: 18 June 2014 / Revised: 7 September 2014 / Accepted: 30 September 2014 / Published online: 8 October 2014 Ó Franciszek Go´rski Institute of Plant Physiology, Polish Academy of Sciences, Krako´w 2014

Abstract Calcium (Ca2?) has been firmly established as ubiquitous second messengers functioning in plant growth development and response to environmental conditions. Calcineurin B-like (CBL) proteins, a unique group of calcium sensors, play a key role in plant response to various abiotic stresses. Here, eight ZmCBLs genes were retrieved. In terms of the gene structure, maize CBL gene had greater variability compared with rice and Arabidopsis CBLs. Phylogenetic analysis revealed that ZmCBL proteins display a close relation to OsCBLs and a little far relation to AtCBLs. Expression analysis indicated that all the eight ZmCBLs expressions were regulated by low potassium and in a tissue-dependent manner. In general, the ZmCBLs expressions in roots were more sensitive under low potassium environment, especially for ZmCBL5, 6 and 8. In

Communicated by M. Hajduch. C. Wang Z. Yuan S. Li W. Wang R. Xue F. Tai (&) State Key Laboratory of Wheat and Maize Crop Science, Collaborative Innovation Center of Henan Grain Crops, College of Life Science, Henan Agricultural University, 63, Road Nongye, Zhengzhou 450002, China e-mail: [email protected] C. Wang e-mail: [email protected] Z. Yuan e-mail: [email protected] S. Li e-mail: [email protected] W. Wang e-mail: [email protected] R. Xue e-mail: [email protected]

leaves, only ZmCBL3, 8 and 10 expressions were upregulated. Moreover, the expression patterns of the ZmCBLs in tissues of germinated seeds and seedlings were also analyzed. The results showed that all the expressions of ZmCBLs were tissue specific except for ZmCBL6, suggesting that they may involve in seed germination and seedlings’ early growth. Keywords potassium

Zea mays CBL Gene expression Low

Introduction Calcium (Ca2?) is a ubiquitous second messenger in all eukaryotes. Almost every biological process in eukaryotic organisms is controlled by Ca2? (Berridge et al. 1998). In plant, various stress factors have been shown to bring out changes in the intracellular Ca2? concentration in different cell types (Harper 2001; Knight and Knight 2001). Calcium sensors and their interacting proteins mediate and relay the Ca2? signal to stimulate cellular responses. Calcineurin B-like (CBL) proteins,a group of plant calcium sensor proteins, was initially identified from Arabidopsis thaliana (Liu and Zhu 1998; Kudla et al. 1999). CBL proteins harbor a conserved core region containing four EF-hand motifs as structural basis for calcium binding and function by interacting with a group of Ser/Thr protein kinases designated CBL-interacting protein kinases (CIPKs; Luan et al. 2002; Shi et al. 1999; Kim et al. 2000). In plants, both CBL and CIPK are encoded by a multigene family and share similar structural domains with some variations in the coding regions. Previous studies showed that CBL-CIPK plays important roles in plant response to various abiotic stresses, including cold, salt, and drought

123

3308

(Luan et al. 2002; Kim et al. 2007; Piao et al. 2010; Cheong et al. 2010). Mutation of CBL1 impairs plant responses to drought and salt stresses and affects gene expression of cold-regulated genes, but does not affect abscisic acid (ABA) responsiveness (Albrecht et al. 2003; Cheong et al. 2003). Increasing evidence showed that CBL1 is involved in cold response by interacting with CIPK7 in Arabidopsis thaliana (Huang et al. 2011). BnCBL1/CIPK6 component is involved in the plant response to abiotic stress and ABA signaling (Chen et al. 2012). The CBL1/9-CIPK26 complex regulated the Arabidopsis NADPH oxidase RBOHF and involved in ROS production (Drerup et al. 2013). In the salt-tolerance pathway, both CBL10 and CBL4/SOS3 interacts with and seems to function through CIPK24/SOS2 (Guo et al. 2001; Quan et al. 2007). Similarly, the complex of OsCIPK24 and OsCBL4, the homologs of AtSOS2 and AtSOS3, forms a functional module in response to sodium stress in rice (Marti´nez-Atienza et al. 2007). OsCBL2 is upregulated by GA in the aleurone layer and plays a key role in promoting vacuolation of barley aleurone cells following treatment with GA (Hwang et al. 2005). The cbl2 cbl3 double mutant was stunted with leaf tip necrosis, underdeveloped roots, shorter siliques and fewer seeds (Tang et al. 2012). In addition, more evidence showed that CBL-CIPK involved in potassium (K) uptake and modulates plant growth. CBL1 and CBL9 play important functions in the regulation of potassium (K) uptake and stomata movements (Li et al. 2006; Xu et al. 2006; Cheong et al. 2007). Increasing evidence showed that the CBL4-CIPK6 complex modulates the activity and plasma membrane (PM) targeting of the K? channel AKT2 from Arabidopsis thaliana by mediating translocation of AKT2 to the PM in plant cells (Held et al. 2011). In addition, the CBL3-CIPK9 complex in the vacuole membrane is also involved in low potassium stress (Lee et al. 2007; Liu et al. 2013). In spite of the extensive studies and remarkable progress in the Arabidopsis CBL-CIPK calcium signaling pathways, information about these protein functions in other plant species is still quite limited. So far, only ZmCBL4 and ZmCIPK16 were investigated and involved in response to salt stress (Wang et al. 2007; Zhao et al. 2009). Forty three putative ZmCIPKs expressions under abiotic stress were analyzed by RT-PCR (Chen et al. 2001). Our previous studies also revealed that several ZmCIPKs expressions under drought stress were involved in ABA and H2O2 (Tai et al. 2013). In the present study, eight ZmCBLs were retrieved and the expressions of them in maize seedlings were characterized. They have the close relation to OsCBLs and are expressed differentially in roots and leaves under low potassium condition. In addition, the expressions of them are tissue specific in germinated seeds and seedlings.

123

Acta Physiol Plant (2014) 36:3307–3314

Materials and methods Obtaining the maize CBL cDNAs To obtain maize CBL genes, the MaizeGDB (http://www. maizegdb.org) and GenBank (http://www.ncbi.nlm.nih. gov) were searched using the Arabidopsis CBL gene sequences and the BLAST algorithm. Finally, eight maize CBL genes were obtained. Sequence and phylogenetic analysis Nucleotide sequences were analyzed using a software package (DNAStar and DNAMAN). The exon–intron organizations of the maize CBL genes were determined by comparing the full-length cDNA or predicted CDSs with their corresponding genomic sequences. The position of each gene in the maize genome was determined by a BLASTN search against the genomic sequences of the maize chromosomes available in the PlantGDB database (http://www.plantgdb.org). The protein structural domain was analyzed in the online database (http://www.expasy.ch/ prosite). For phylogenetic analysis, a phylogenetic tree of eight CBL genes was constructed using MEGA6 software. Plant materials and treatments The selected maize (Zea mays cv. Zhengdan 958) seeds were surfaced sterilized with 75 % ethyl alcohol for 1 min and with sodium hypochlorite for 1 h. Then, they were washed with distilled water five times, soaked in distilled water for 20 h. A small part of the seeds were stripped to receive the embryo. The rest of the seeds were sown on to moistened filter papers and incubated for 3 days to germinate. The radicles and germs were obtained from the small part of the germinated seeds. The rest of germinated seeds were cultured in Hoagland’s nutrient solution in a light chamber (day 28 °C/night 23 °C, relative humidity 75 %) with a 16/8 h day/night cycle. When the second leaves were fully expanded, the roots, stems and leaves of the maize seedlings were sampled. When the fifth leaves were fully expanded, the maize seedlings were treated with low potassium Hoagland’s nutrient solution for 0, 12 h, 2, 4, 8, and 12 days, respectively. The leaves and roots of the treated seedlings were harvested. All the obtained materials were immediately frozen in liquid nitrogen and stored at -80 °C until further analyses. The low potassium Hoagland’s nutrient solution was modified from the normal Hoagland’s nutrient solution (Liu et al. 2013). Briefly, 2.99 mM CaCl2 and 1.25 mM KH2PO4 were replaced by 2.99 mM Ca(NO3)2 and 1.25 mM NH4H2PO4, 18.79 mM KNO3 and 20.6 mM NH4NO3 were removed, and 1.5 mM MgSO4 was unchanged. For making


3309

Table 1 The eight putative ZmCBL genes in maize genome and gene-specific primers used for RT-PCR Gene

Accessiona

Positionb

cDNAe

Amino acidf

Primers(50 –30 )g

ZmCBL1

EU907931

94985578-94989245

1

8

1,642

213

1

11

678

225

29393213-29394731

2

6

1,077

194

EU907935

223083084-223085629

3

8

657

218

ZmCBL6

EU907936

7727855-7730539

10

8

672

223

ZmCBL8

EU907937

29393213-29394533

2

7

762

253

ZmCBL9

EU960527

114456947-114461755

9

9

1,226

213

ZmCBL10

EU961768

220520899-220524490

3

8

1,512

293

F : CCATATGATGGGGTGCTTCCATTCC: R : CGGATCC TCACGTGACGAGATCGTC F : CGGAATTCATGTTGCAGTGCCTGGAT R : CGGAGCTCTCAGGTATCATCGACCTG F : AAGAATTCATGGGGTGTGTGTCCTCC R : AAGAGCTCTTACTTGAGGTATGGGAG F : CCATATGATGGGCTGTCTGCAAACAAAG R : CGAGCTCTTAGACAGCCATGTCTGTTTCA F : CCATATGATGGTGGACTTTGTTCGACGG R : CCATATGATGGTGGACTTTGTTCGACGG F : ATGAATTCATGCATGCATGCATGCCA R : ATGAGCTCCTACAACTCGTCGTCACT F : CGCCATATGATGGGATGCTTCCATTCC R : CCGCTCGAGTCACGTCACGAGATCATC F : AAGAATTC ATGCCACGAGCCACTGA R : AAAGGATCC CTAATCTTCCACCGCC

ZmCBL3

EU907934

167197565-167209040

ZmCBL4

EU973091

ZmCBL5

a b c d e f g

Chrc

Exonsd

Accession numbers of full-length cDNA sequences from NCBI (http://www.ncbi.nlm.nih.gov) Gene position on the corresponding maize bacterial artificial chromosome clone Chromosome in which the ZmCBL gene is located No. of exons for putative ZmCBL genes Length of the cDNA (coding region) in basepairs No. of amino acids of the predicted protein The highlighted 6 bp is the restriction endonuclease site of the gene-specific primer

the low potassium Hoagland’s nutrient solution, the actual and final K? concentration in Hoagland’s nutrient solution was adjusted to 100 ± 10 lM by adding KCl. RNA extraction and reverse transcription Total RNA was extracted from maize seedling roots and leaves under different treatments by TRIZOL according to the manufacturer’s protocol. Total RNA concentrations were measured with a UV-spectrophotometer (Eppendorf Biophotometer) to normalize the nucleic acid concentrations for subsequent cDNA synthesis and PCR amplifications. All RNA samples had an OD260/OD280 of between 1.8 and 2.0, which indicated that they were high-quality samples. The RNA quality was also checked by 1.0 % agarose gel electrophoresis, stained with l lg ml-1 ethidium bromide. The total RNA samples were treated by DNaseI (Promega, USA) to eliminate any DNA contamination. Then, the RNA (2 lg) was reversely transcribed into cDNAs by AMV reverse transcriptase (Promega) according to the manufacturer’s instructions. Expression of ZmCBLs by semi-quantitative RT-PCR The expression pattern of the ZmCBLs gene in maize under different treatments was analyzed by semi-quantitative RT-

PCR. The above-described cDNA was used as template in RT-PCR with gene-specific primers (Table 1). The maize Actin2 gene was used as a standard control in RT-PCR. The multiplex PCR reactions were performed in a total volume of 20 ll containing 2 ll of 10 9 PCR buffer, 1.5 ll dNTP mix (2.5 mmol L-1), 1 ll of each primer (10 lmol L-1), 0.5 ll Taq DNA polymerase (2.5 U lL-1, TaKaRa, Japan), 1 ll cDNA and 14.3 ll distilled water and using thermal cycler equipped with a ‘‘hot bonnet’’. The PCR cycling profile was denaturation at 94 °C for 3 min, annealing at 53 °C for 1 min and an extension at 72 °C for 1 min for 30 cycles, followed by a final extension step of 10 min at 72 °C. The amplification products were separated by electrophoresis on 1 % agarose gels. All RTPCR images were the representative results from the biological replicates.

Results Sequence and structure analysis of ZmCBLs Eight full-length sequences belonging to the CBL family were retrieved from MaizeGDB (http://www.maizegdb.org) and GenBank (http://www.ncbi.nlm.nih.gov) by BLAST search. The eight ZmCBL genes were located on chromosome 1, 2, 3,

123

3310

9 and 10, respectively. ZmCBL 1 and 3 were located on chromosome 1, ZmCBL4 and 8 were located on chromosome 2, ZmCBL5 and 10 were located on chromosome 3, ZmCBL6 was located on chromosome 10 (Table 1). A comparison of the full-length cDNAs and the predicted coding sequence (CDS) with the genomic sequences of ZmCBL genes revealed a little variation in intron number (from 5 to 10) (Table 1). Most introns in the coding region position are relatively fixed and the lengths of the exons are equal (Fig. 1). For example, in ZmCBL1, ZmCBL5, 6 and 9, from the second to the seventh exon, the six exons have the same length. They are 83, 60, 109, 53, 81 and 113 bp, respectively. In ZmCBL4 and CBL8, from the second to the fifth exon, all the four exons have the same length. They are 143, 109, 53 and 81 bp, respectively. For ZmCBL10, from the third to the seventh exon, the length of them are 83, 109, 53, 81, and 113 bp, respectively. Comparatively speaking, organization of the extron and intron of the eight ZmCBL genes shows that ZmCBL3 is the longest gene because of a long intron. In addition, the one intron of ZmCBL3 and ZmCBL9 was located at untranslated region (Fig. 1). The analysis of the protein structure shows that the eight ZmCBLs contain four EF-hand structural domains, and the size of each EF hand is completely consistent. Except for ZmCBL10, the connected region length of EF hands is more consistent, only the length of both terminals of sequence has differences (Fig. 2a). Among them, the function domain of ZmCBL1 is most similar to ZmCBL9, four EF-hand positions in the amino acid sequence are exactly the same, for example, the first EF-hand structure domain appears in the 43 amino acid place. The four EF hands of ZmCBL4 and ZmCBL1, 9 are slightly different; the first EF-hand appears in the 44 amino acid place. Furthermore, four ZmCBLs, including ZmCBL1, ZmCBL4, ZmCBL5 and ZmCBL9, harbor a conserved myristoylation motif (MGCXXS/T) in their N-terminal, but not for the other ZmCBLs (Fig. 2b).

Fig. 1 The structures of the and eight ZmCBL genes. represent introns and exons, respectively. represent UTR regions

123


Phylogenetic analysis of CBLs from maize and other plant kingdom Phylogenetic analysis was performed to infer the clustering patterns and evolutionary ancestry of the CBLs. The phylogenetic tree consisted of 28 members of the plant CBL family and contained two groups (Fig. 3). Group I contained ZmCBL1, 3, 6, 9 and 10, which were most closely related to OsCBL1, OsCBL3, OsCBL6, AtCBL9 and OsCBL9, respectively. Group II contained ZmCBL4, 5 and 8, among them ZmCBL4 and ZmCBL5 have the closest relationship. These results showed that maize and rice both belonging to the monocots have a closer relationship, and have the slightly far phylogenetic relationships with dicot Arabidopsis. The expression patterns of ZmCBLs in different tissues of seed germination and seedlings To analyze the expression pattern of ZmCBLs in early seeding development, the embryos, radicles, germs and roots, stems and leaves of fifteen-day-old seedlings were used for analysis (Fig. 4). RT-PCR results showed that the expression pattern of ZmCBL1 was similar to ZmCBL9, both of which were lower in stems, higher in embryos. But ZmCBL1 expression was higher than that of ZmCBL9 in germs. The expression of ZmCBL3 was almost not detected in embryos, germs, roots and leaves, except for in radicles and stems. This is similar to ZmCBL8, which is detected only in radicle. The expression of ZmCBL4 was higher in radicles, germs, roots and leaves but not expressed in embryos and stems. The expressions of ZmCBL5 and ZmCBL6 were higher in all the tested tissues, especially for ZmCBL5 in embryos and radicles. The expression of ZmCBL10 was similar to ZmCBL6; the only difference was that the former was not detected in embryo. Therefore, except for ZmCBL6,


3311

Fig. 2 Protein structure of the eight ZmCBLs. a represent common sequence; represent EF-hand1; represent EF-hand2; represent EF-hand3; represent EF-hand4. b Comparison of the N-terminal amino acids of the ZmCBL and AtCBL proteins. MGCXXS/T, myristoylation motif, conserved in the N-terminal amino acids of CBL1, CBL4, CBL5, and CBL9. Amino acids that are identical in at least three of the compared sequences are highlighted in black

the other ZmCBLs were tissue specific in the germinated seeds and seedlings. ZmCBLs were regulated by Potassium RT-PCR analysis indicated that all the eight ZmCBLs expressions were regulated to varying degrees in maize under low potassium stress. Further analysis revealed that the expression patterns of ZmCBLs in leaves and roots were different. In the leaves (Fig. 5), the expressions of ZmCBL1 and 9 were almost unchanged in the leaves of maize seedlings; the expression of ZmCBL3 and 6 was increased and reached a maximum at 8 days low potassium stress. The expression of ZmCBL4 was low but showed the obviously changes, at the first 4 days, there was almost no observation, and then the expression was significantly enhanced at 8 and 12 days treatment. The expression of ZmCBL5 was unchanged at the beginning of the 2 days, and then the expressions were slightly decreased. ZmCBL8 and 10 were almost not detected in the leaves of maize seedlings at the initial stage of treatment, and then the expressions were significantly upregulated and kept the higher level until 12 days. In the roots (Fig. 5), the expressions of ZmCBL1, 3 and 4 were gradually enhanced and reached a maximum at 8 days; and then the expressions were significantly declined and were not detected at 12 days. The expressions of ZmCBL5, 6 and 8 were almost not detected in the control; the expressions obviously increased and reached a maximum at 8 days with the treated time extension. The expression of ZmCBL9 was almost unchanged at the treated

12 h compared with the control. But it was enhanced rapidly at 2 days and kept the higher level until 8 days. The expression of ZmCBL10 was not obviously changed under low potassium treated, but at 4 and 12 days, it was slightly enhanced.

Discussion Subsequent genomics analyses showed that the Arabidopsis and rice genomes each encode a complement of ten distinct CBL proteins that form an interaction network with 25 (Arabidopsis) or 30 (rice) CIPKs, respectively (Kolukisaoglu et al. 2004). Recently, 43 putative ZmCIPK (Zea mays CIPK) genes in the genome of maize inbred line B73 were also identified by bioinformatic analysis (Chen et al. 2011). Here, eight CBL genes were isolated from maize genome in the present study. Sequences analysis revealed that all the ZmCBLs have more introns (Fig. 1 and Table 1), which are the same as CBLs from other plant species. For example, ten AtCBLs have six or seven introns; ten OsCBLs have seven or eight introns; (Kolukisaoglu et al. 2004); ZmCBLs contain five, six, seven, eight or ten introns, respectively (Table 1). ZmCBL1 and 9 have different numbers of introns but encode the highest homology and the same length peptide. Therefore, in terms of the gene structure, maize CBL gene had greater variability compared with rice and Arabidopsis CBLs. However, ZmCBL10 protein is different from other ZmCBLs because of containing a long N-terminal (Fig. 2); its gene exon lengths are similar with other ZmCBLs

123

3312


Fig. 4 RT-RCR analysis of the eight ZmCBLs expression patterns in different tissues of maize seedlings. 1 embryo, 2 radicle, 3 germ, 4 root, 5 stem, 6 leaf

Fig. 3 Phylogenetic tree analysis of the eight ZmCBLs and CBLs from Arabidopsis and rice. The different species are indicated by the following codes: Zm (Maize); At (Arabidopsis thaliana); Os (Oryza sativa). Phylogenetic analyses were performed as described in ‘‘Materials and methods’’. Scale shows evolutionary distance, the number at the nodes represents the reliability percent (%) of bootstraps values based on 1,000 replications. The accession numbers are presented as follows : OsCBL2, DQ201196; OsCBL3, DQ201197; ZmCBL3, EU907934; OsCBL6, DQ201200; ZmCBL6, EU907936; AtCBL6, AF192884; AtCBL2, AF076252; AtCBL3, AF076253; AtCBL7, AF290434; AtCBL1, AF076251; AtCBL9, AF411958; OsCBL1, DQ201195; ZmCBL1, EU907931; ZmCBL9, EU960527; AtCBL10, AF490607; OsCBL10, DQ201204; OsCBL9, DQ201203; ZmCBL10, EU961768; AtCBL4, AF192886; AtCBL8, AF411957; AtCBL5, AF192885; OsCBL5, DQ201199; ZmCBL5, EU907935; OsCBL4, DQ201198; OsCBL7, DQ201201; OsCBL8, DQ201202; ZmCBL4, EU973091; ZmCBL8, EU907937

(Fig. 1). The characteristic of ZmCBLs CDS structures maybe lead to the protein conservative. CBLs contain four EF-hand motifs for Ca2? binding that is predicted to possess characteristic Ca2? affinities (Batistic and Kudla 2004). In the present studies, all the ZmCBLs have the conservative four EF hands, but the EFhand positions are different (Fig. 2). Of course, there are

123

also differences existing in the EF-hand composition (data not shown). A similar variation of EF-hand sequences appears to occur in rice and Arabidopsis CBLs (Kolukisaoglu et al. 2004). Maybe, these differences in the EFhand position and composition in individual CBLs could lead to different affinities toward calcium ions in response to various stresses (Kolukisaoglu et al. 2004). Specific targeting signals, a conserved myristoylation motif (MGCXXS/T), in the N-termini of CBLs, plays an important role for protein-membrane localization (Batistic and Kudla 2004; Kolukisaoglu et al. 2004; Batistic et al. 2008). Four Arabidopsis CBLs including CBL1, CBL4, CBL5, and CBL9 harbor the conserved myristoylation motif. In this study, the four ZmCBLs are also modified by the fatty acid myristate, which is similar to the AtCBLs (Batistic et al. 2008). Localization studies using green fluorescent protein (GFP)-fusions of different CBLs revealed that CBL1 and CBL9 are localized to the plasma membrane (our unpublished data). The predicted ZmCBL10 protein lacks N-terminal myristoylation and palmitoylation motifs, but harbors a unique long N-terminal extension, which was not shared by other CBLs, suggesting that ZmCBL10 might have distinct functions (Batistic and Kudla 2009). In phylogenetic analysis using the Clustal X algorithm, these proteins cluster with the other plant CBL proteins and display a slightly far phylogenetic relation to Arabidopsis and a closer relationship with rice. These suggested that CBL proteins exist prior to the separation of the lineages of monocotyledons and dicotyledons. From the protein


3313

Fig. 5 RT-PCR analysis of the eight ZmCBL genes in leaves and roots of maize under low potassium

structures and phylogenetic tree, we found that CBL proteins are very conservative, especially for ZmCBL1 and ZmCBL9. However, the existence of strikingly similar proteins does not necessarily result in their functional redundancy (Kolukisaoglu et al. 2004; Pandey et al. 2004). The Arabidopsis CBL1 and CBL9 calcium sensors share 90 % sequence identity (Kolukisaoglu et al. 2004). Although having distinct response to exogenous ABA, the expressions of both AtCBL1 and AtCBL9 were highly inducible by salt, cold and drought stresses. Further comparison found that, CBL1 and CBL9 possess overlapping functions. This has been demonstrated by studies showing that CBL1 and CBL9 both target CIPK23, which functions in the regulation of potassium (K) uptake and stomatal movements (Xu et al. 2006; Cheong et al. 2007). In addition, they also play roles in pollen development (Ma¨hs et al. 2013) and response to salt stress (Cheong et al. 2003; Pandey et al. 2004). In the present study, eight ZmCBLs expressions were regulated to varying degrees by low potassium and in a tissue-dependent manner, suggesting ZmCBLs play roles in early seedlings development and in response to low potassium. Comparing CBL1 and CBL9, we found that the expressions of them are very similar and there is only a little difference (Figs. 4 and 5). Over expression of ZmCBL9 can promote Arabidopsis seeds germination under low potassium and osmotic stress, but over-expressed ZmCBL1 transgenic lines seem to have no obviously changes compared with control (our unpublished data). May be these differences in expression pattern and function mainly because the difference of genes structures, including the introns and the 5-terminal regulatory regions. Author contribution Chuntian Wang, carried out most of the experiments, prepared the manuscript. Zhiheng

Yuan, carried out the experiments, analyzed the results. Shipeng Li, carried out the experiments. Wei Wang, provided scientific advice, analyzed the results, correction, and final revision of the manuscript. Ruili Xue, provided the guidance and proof reading of the manuscript. Fuju Tai, designed and carried out the experiments, analyzed the results, and prepared the manuscript. Acknowledgments This work was supported by the National Natural Science Foundation of China (31100200), the Fund of the State Key Laboratory of Crop Biology in Shandong Agricultural University (2014KF04) and the technology Key Project of the Henan Educational Committee (14A180005).

References Albrecht V, Weinl S, Blazevic D, D’Angelo C, Batistic O, Kolukisaoglu U, Bock R, Schulz B, Harter K, Kudla J (2003) The calcium sensor CBL1 integrates plant responses to abiotic stresses. Plant J 36:457–470 Batistic O, Kudla J (2004) Integration and channeling of calcium signaling through the CBL calcium sensor/CIPK protein kinase network. Planta 219:915–924 Batistic O, Sorek N, Schultke S, Yalovsky S, Kudla J (2008) Dual fatty acyl modification determines the localization and plasma membrane targeting of CBL/CIPK Ca2? signaling complexes in Arabidopsis. Plant Cell 20:1346–1362 Batistic O, Kudla J (2009) Plant calcineurin B-like proteins and their interacting protein kinases. Biochim Biophys Acta 1793: 985–992 Berridge MJ, Bootman MD, Lipp P (1998) Calcium a life and death signal. Nature 395:645–648 Chen X, Gu Z, Xin D, Hao L, Liu C, Huang J, Ma B, Zhang H (2011) Identification and characterization of putative CIPK genes in maize. J Genet Genomics 38:77–87 Chen L, Ren F, Zhou L, Wang QQ, Zhong H, Li XB (2012) The Brassica napus Calcineurin B-Like 1/CBL-interacting protein kinase 6 (CBL1/CIPK6) component is involved in the plant

123

3314 response to abiotic stress and ABA signaling. J Exp Bot 63:6211–6222 Cheong YH, Kim KN, Pandey GK, Gupta R, Grant JJ, Luan S (2003) CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis. Plant Cell 15:1833–1845 Cheong YH, Pandey GK, Grant JJ, Batistic O, Li L, Kim BG, Lee SC, Kudla J, Luan S (2007) Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis. Plant J 52:223–239 Cheong YH, Sung SJ, Kim BG, Pandey GK, Cho JS, Kim KN, Luan S (2010) Constitutive overexpression of the calcium sensor CBL5 confers osmotic or drought stress tolerance in Arabidopsis. Mol Cells 29:159–165 Drerup MM, Schlu¨cking K, Hashimoto K, Manishankar P, Steinhorst L, Kuchitsu K, Kudla J (2013) The calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the Arabidopsis NADPH oxidase RBOHF. Mol Plant 6:559–569 Guo Y, Halfter U, Ishitani M, Zhu JK (2001) Molecular characterization of functional domains in the protein kinase SOS2 that is required for plant salt tolerance. Plant Cell 13:1383–1400 Harper JF (2001) Dissecting calcium oscillators in plant cells. Trends Plant Sci 6:395–397 Held K, Pascaud F, Eckert C, Gajdanowicz P, Hashimoto K, Corratge-Faillie C, Offenborn JN, Lacombe B, Dreyer I, Thibaud JB, Kudla J (2011) Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the CBL4/CIPK6 calcium sensor/protein kinase complex. Cell Res 21:1116–1130 Huang C, Ding S, Zhang H, Du H, An L (2011) CIPK7 is involved in cold response by interacting with CBL1 in Arabidopsis thaliana. Plant Sci 181:57–64 Hwang Y, Bethke PC, Cheong YH, Chang HS, Zhu T, Jones RL (2005) A Gibberellin-regulated calcineurin B in rice localizes to the tonoplast and is implicated in vacuole function. Plant Physiol 138:1347–1358 Kim KN, Cheong YH, Gupta R, Luan S (2000) Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant Physiol 124:1844–1853 Kim BG, Waadt R, Cheong YH, Pandey GK, Dominguez-Solis JR, Schultke S, Lee SC, Kudla J, Luan S (2007) The calcium sensor CBL10 mediates salt tolerance by regulating ion homeostasis in Arabidopsis. Plant J 52:473–484 Knight H, Knight MR (2001) Abiotic stress signalling pathways: specificity and crosstalk. Trends Plant Sci 6:262–267 Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J (2004) Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL–CIPK signaling networks. Plant Physiol 134:43–58 Kudla J, Xu Q, Harter K, Gruissem W, Luan S (1999) Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proc Natl Acad Sci 96:4718–4723 Lee SC, Lan WZ, Kim BG, Li L, Cheong YH, Pandey GK, Lu G, Buchanan BB, Luan S (2007) A protein phosphorylation/ dephosphorylation network regulates a plant potassium channel. Proc Natl Acad Sci 104:15959–15964

123

Acta Physiol Plant (2014) 36:3307–3314 Li L, Kim BG, Cheong YH, Pandey GK, Luan S (2006) A Ca2? signaling pathway regulates a K? channel for low-K response in Arabidopsis. Proc Natl Acad Sci 103:12625–12630 Liu J, Zhu JK (1998) A calcium sensor homolog required for plant salt tolerance. Science 280:1943–1945 Liu LL, Ren HM, Chen LQ, Wang Y, Wu WH (2013) A protein kinase, calcineurin B-like protein-interacting protein kinase9, interacts with calcium sensor calcineurin B-like protein3 and regulates potassium homeostasis under low-potassium stress in Arabidopsis. Plant Physiol 161:266–277 Luan S, Kudla J, Rodriguez-Concepcion M, Yalovsky S, Gruissem W (2002) Calmodulins and calcineurin B-like proteins: calcium sensors for specific signal response coupling in plants. Plant Cell 14:S389–S400 Ma¨hs A, Steinhorst L, Han JP, Shen LK, Wang Y, Kudla J (2013) The calcineurin B-like Ca2? sensors CBL1 and CBL9 function in pollen germination and pollen tube growth in Arabidopsis. Mol Plant 6:1149–1162 Martı´nez-Atienza J, Jiang X, Garciadeblas B, Mendoza I, Zhu JK, Pardo JM, Quintero FJ (2007) Conservation of the salt overly sensitive pathway in rice. Plant Physiol 143:1001–1012 Pandey GK, Cheong YH, Kim KN, Grant JJ, Li L, Hung W, D‘Angelo C, Weinl S, Kudla J, Luan S (2004) The calcium sensor calcineurin B-like 9 modulates ABA sensitivity and biosynthesis in Arabidopsis. Plant Cell 16:1912–1924 Piao HL, Xuan YH, Park SH, Je BI, Park SJ, Park SH, Kim CM, Huang J, Wang GK, Kim MJ, Kang SM, Lee IJ, Kwon TR, Kim YH, Yeo US, Yi G, Son D, Han CD (2010) OsCIPK31, a CBLinteracting protein kinase is involved in germination and seedling growth under abiotic stress conditions in rice plants. Mol Cells 30:19–27 Quan R, Lin H, Mendoza I, Zhang Y, Cao W, Yang Y, Shang M, Chen S, Pardo JM, Guo Y (2007) SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. Plant Cell 19:1415–1431 Shi J, Kim KN, Ritz O, Albrecht V, Gupta R, Harter K, Luan S, Kudla J (1999) Novel protein kinases associated with calcineurin Blike calcium sensors in Arabidopsis. Plant Cell 11:2393–2405 Tai F, Wang Q, Yuan Z, Yuan Z, Li H, Wang W (2013) Characterization of five CIPK genes expressions in maize under water stress. Acta Physiol Plant 35:1555–1564 Tang RJ, Liu H, Yang Y, Yang L, Gao XS, Garcia VJ, Luan S, Zhang HX (2012) Tonoplast calcium sensors CBL2 and CBL3 control plant growth and ion homeostasis through regulating V-ATPase activity in Arabidopsis. Cell Res 22:1650–1665 Wang M, Gu D, Liu T, Wang Z, Guo X, Hou W, Bai Y, Chen X, Wang G (2007) Overexpression of a putative maize calcineurin B-like protein in Arabidopsis confers salt tolerance. Plant Mol Biol 65:733–746 Xu J, Li HD, Chen LQ, Wang Y, Liu LL, He L, Wu WH (2006) A protein kinase, interacting with two calcineurin B-like proteins, regulates K? transporter AKT1 in Arabidopsis. Cell 125: 1347–1360 Zhao J, Sun Z, Zheng J, Guo X, Dong Z, Huai J, Gou M, He J, Jin Y, Wang J, Wang G (2009) Cloning and characterization of a novel CBL-interacting protein kinase from maize. Plant Mol Biol 69:661–674