Characterization of IS1501 mutants of Leptospira interrogans serovar ...

FEMS Microbiology Letters 248 (2005) 199–205 www.fems-microbiology.org

Characterization of IS1501 mutants of Leptospira interrogans serovar pomona Richard L. Zuerner *, Gabriel A. Trueba

1

National Reference Center for Leptospirosis, Bacterial Diseases of Livestock Research Unit, National Animal Disease Center, USDA, ARS, P.O. Box 70, Ames, IA 50010, United States Received 17 February 2005; received in revised form 17 May 2005; accepted 20 May 2005 First published online 15 June 2005 Edited by R.Y.C. Lo

Abstract Leptospira interrogans is a diverse species in which individual serovars have distinctive restriction fragment length polymorphisms that are useful in strain identification. Many of these polymorphisms can be detected using hybridization probes derived from insertion sequences; an observation that suggests these IS elements are active and can transpose in L. interrogans. Two spontaneous mutants of L. interrogans serovar Pomona strain RZ11 were isolated by immune selection and characterized. Changes in the size and antigenicity of LPS from these mutants were detected. Genetic analysis showed that both mutants have additional copies of an IS3-like element, designated IS1501, that are not present in the parental strain. One mutant, GT211, has a single additional copy of IS1501, whereas the other mutant, GT210 has three additional copies of IS1501 relative to strain RZ11. IS1501 transposition generated 3-bp direct repeats from target sequences flanking the insertion site. RT-PCR analysis of transcripts at altered loci showed IS1501 transcripts extended into adjacent sequences. These data are the first to show spontaneous transposition of an endogenous Leptospira insertion sequence, and suggest that IS1501 may be capable of gene activation. Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. Keywords: Spirochete; Insertion sequence; Transposition

1. Introduction Leptospira interrogans is one of several species that causes leptospirosis, one of the most widespread zoonotic diseases in the world [1]. Leptospirosis persists by chronic infection of mammalian maintenance hosts that exhibit few clinical signs of disease. Passage to non-maintenance hosts can result in a wide range of clinical symptoms, ranging from a mild disease to an acute infection resulting in multiple organ failure and *

Corresponding author. Tel.: +515 663 7392; fax: +515 663 7458. E-mail address: [email protected] (R.L. Zuerner). 1 Present address: Institute of Microbiology, University of San Francisco de Quito, Quito, Ecuador.

death [2]. L. interrogans is a diverse species with many antigenic types (serovars), each having its preferred maintenance host [2]. Genetic diversity among L. interrogans isolates can often be detected by identifying serovar-specific restriction fragment length polymorphisms (RFLPs) using probes to endogenous insertion sequences (IS) [3]. Insertion sequences are mobile genetic elements that can disrupt genes by insertion or alter gene organization via chromosomal rearrangements [4]. IS-specific RFLPs may arise by transposition or recombination events. There are several different types of IS elements in L. interrogans and large rearrangements within the genome coincide with the locations of some of these elements [5–7]. Although the copy number and distribution of

0378-1097/$22.00 Ó 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.femsle.2005.05.039

200

R.L. Zuerner, G.A. Trueba / FEMS Microbiology Letters 248 (2005) 199–205

endogenous IS elements varies between serovars, transposition of these elements to new sites has not been demonstrated in L. interrogans. Genetic analysis of pathogenic Leptospira has been impeded by the lack of tools to create mutants, complement genes, or develop selectable markers. Several investigators have used immune selection as a means to isolate Leptospira strains with altered phenotypes [8–13]. In this study, immune selection was used to isolate L. interrogans mutants, and the mutants were characterized. Additional copies of an IS3-like element, IS1501, were detected in two mutants, demonstrating that this element transposes in L. interrogans. Comparison of parental and mutant loci showed that transcripts from within IS1501 extended into sequences adjacent to the insertion site.

2. Methods 2.1. Bacterial strains L. interrogans serovar Pomona strain RZ11 was colony purified on solid EMJH media [14–16] and propagated at 29 °C. Escherichia coli INV a 0 (Invitrogen Corp.) was propagated in DYT medium [17]. When needed, kanamycin was used at a final concentration of 50 lg ml1. 2.2. Immune selection of mutants Spontaneous mutants of strain RZ11 were selected by growth in the presence of immune sera prepared in rabbits against L. interrogans serovar Pomona and fresh guinea pig serum (as a source of complement), each at a final dilution of 1:100. Bacteria were transferred to fresh media containing 1:50 dilutions of immune rabbit and fresh guinea pig sera, followed by two passages in media containing immune rabbit sera alone. Each passage was carried out for 1 week. Bacteria were passed twice in media lacking immune sera, and the antigenicity of cultures was determined using the microscopic agglutination test (MAT) following established techniques [18]. Strains were colony purified on solid EMJH as described previously [14]. 2.3. Analysis of Leptospira outer membrane components Outer membrane (OM) fractions were prepared from L. interrogans cells as described [19,20]. SDS–polyacrylamide gel electrophoresis, staining, Western immunoblotting, and immune detection were performed as previously described [19]. LPS was stained with silver as described by Tsai and Frasch [21]. LPS was prepared from detergent extracts using a modification of the method described by Hitchcock and Brown [22], where-

by OM samples were treated with proteinase K (0.5 lg per 1 lg OM protein) for 1 h at 37 °C. Immune sera were prepared in New Zealand white rabbits using OM fractions mixed with adjuvant according to the manufacturers instructions (Corixia Corp.). 2.4. DNA techniques Methods for genomic DNA isolation, agarose gel electrophoresis, Southern blotting, and hybridization analysis were performed as previously described [14]. Hybridization probes corresponded to the complete IS1500 element [5] and the first 656 bp of IS1501 [Accession number AF038932]. Sequences adjacent to IS insertions were amplified by a genome walking technique as described previously [23] using IS1501-specific primers 1501-G3p and 1501-G5p paired with a linker specific primer AP1 (Table 1). PCR products were either cloned into pCR2.1 (Invitrogen Corp.) or gel purified prior to sequencing. PCR primers that anneal to sequences flanking mutant-specific IS1501 insertions (Table 1) were used to amplify homologous sites from samples of RZ11, GT210, and GT211 DNA. PCR reactions were done using AccuTaq (Sigma–Aldrich Corp.) with the program: 94 °C, 2 min, followed by 37 cycles of 94 °C for 15 s, 60 °C for 30 s, and 68 °C for 7 min. DNA sequencing was performed by dye termination reactions separated on ABI Prism sequence analyzers at the Iowa State University Nucleic Acid Facility (Ames, IA) and on an ABI 3700 at the NADC Genomics Laboratory. Sequence data were complied using Sequencher v. 4.1 (GeneCodes), and the data analyzed using Clone Manager 7 and Primer Designer 5 (Scientific and Educational Software), BLAST [24], and BPROM (http://www.softberry.com/). New sequence data was submitted to GenBank under the accession number AY919671. 2.5. RNA techniques Total genomic RNA was isolated from L. interrogans and analyzed by reverse-transcriptase (RT) PCR reactions as previously described [25] using primers listed in Table 1. Each RT PCR reaction was paired with an identical reaction lacking reverse transcriptase to confirm that residual genomic DNA had been removed.

3. Results and discussion 3.1. Immune selection and initial characterization of L. interrogans mutants Immune selection is useful in obtaining mutants of Leptospira having altered antigenic compositions


201

Table 1 Primers used for PCR in this study Target

Primer

PCR walk IS1501 1501-G3p IS1501 1501-G5p Linker AP1 Amplification of insertion site OrfP35 OrfP35-Af OrfP35 OrfP35-Ar mta Mta-Af mta Mta-Ar GGDEF Ggdef-Af GGDEF Ggdef-Ar RT-PCR IS1501 1501-R3p OrfP35 OrfP35-Rf OrfP35 OrfP35-Rr OrfP34 OrfP34-Rf OrfP34 OrfP34-Rr mta Mta-R1r mta Mta-R2f mta Mta-R2r

Target (position)a

Sequenceb

332 341 C Not relevant

CTTTCCCGCGAACAGAATC CTTCAATCGGGATTCTGTTC GTAATACGACTCACTATAGGGC

161 963 C 2035 3206 C 1483575 1484128 C

CACTAACTGGAGCCTTATTATTGAGTG TTTGCCTGAGTAGTCGACATAATC GATTATAGAAGGCTCCACTA AAAGCCTTTAGCCTCAAAGTCAATAGG GAAACATGATATTCCAGCTAGA CCAAACGAGAATTCGACTTTA

1181 658 852 C 4095 4361 C 2832 C 2831 3125 C

AACATTGAAGAAGCGGAGCATC CTTGCTATAGGAGCCGAACAATTTG AGAGGTCATACCAACCTGAAGTAAC TATGGGCTATCTTGGCAGTTAATTC GGCGACATTCCATTGATGTTTATAC TAAAGGTCCTTATTTGCCTTAAGAAGAG TCTCTTCTTAAGGCAAATAAGGACC AACTCATCAGCAAATTACGCAATTC

a Target positions are given for each primer at the 5 0 end of the reference sequence in GenBank. Accession numbers are: IS1501, AF038932; LPS locus (OrfP35 and OrfP34), AF316500; mta, AY919671; and GGDEF, NC_004342, the genome sequence of L. interrogans serovar Lai. b Primer sequences are presented in 5 0 –3 0 orientation.

[8–13]. This approach was used to isolate spontaneous mutants of L. interrogans serovar Pomona strain RZ11 with altered phenotype. Two mutants with stable antigenic profiles distinct from the parental strain were isolated and designated GT210 and GT211. Serological analysis showed that both mutants were not agglutinated by immune sera to the parental strain (data not shown). Outer membrane fractions were prepared from RZ11, GT210, and GT211, separated by SDS–PAGE, and characterized. The OM protein profiles of all three strains appear identical (data not shown), but the LPS of both mutants appears to be shorter than LPS from the parental strain (Fig. 1A). Western immunoblot analysis of OM samples was used to identify altered antigens, and to differentiate carbohydrate from protein antigens. The results of these studies are presented in Fig. 1B, and show that immune sera prepared to either strain recognized common protein antigens. Many of the antigens that cross-react between the parental strain and the mutants were removed by proteinase K digestion. This finding suggests that changes in carbohydrate constituents resulted in the altered antigenicity and smaller size of the mutant LPS. 3.2. Mutants contain additional copies of IS1501 In a previous study, the 1236-bp IS3-like element, IS1500 was used to differentiate L. interrogans strains [3], leading us to hypothesize that GT210 and GT211 may have RFLPs that distinguish them from RZ11.

However, hybridization analysis using probes to IS1500 failed to detect any differences between strains RZ11, GT210, or GT211 (Fig. 2A). During the course of these studies, we discovered a second IS3-like element in the L. interrogans genome which we designated IS1501 (Accession number AF038932). IS1501 is 1230-bp in length with 32-bp terminal inverted repeats (Fig. 3). Copies of IS1501 are well conserved, exhibiting about 98% sequence identity, and have at least 30% sequence divergence from copies of IS1500 (data not shown). Despite the sequence differences between IS1500 and IS1501, these elements share a common organization, with both elements encoding two overlapping open reading frames, orfA and orfB, and like other IS3-like elements, have potential-1 frameshift sequences that may direct the synthesis of an orfAB fusion protein [4,5]. Hybridization analysis of strains RZ11, GT210, and GT211 using probes to IS1501 detected RFLPs that differentiated the mutants from the parental strain (Fig. 2B). All IS1501-hybridizing bands in strain RZ11 are retained in the two mutants, but the mutants have additional copies of IS1501 not detected in the parental strain. Strain GT211 has one additional copy of IS1501 that is not present in strain RZ11 (Fig. 2B). Strain GT210 has two additional copies of IS1501 that were not detected in the parental strain by hybridization analysis (Fig. 2B), and has a third additional copy of IS1501 that was not resolved by hybridization, but isolated in subsequent studies (see below). To

202


Fig. 1. Alterations in LPS of in vitro-selected mutants. OM fractions from RZ11, GT210, and GT211 were separated by SDS–PAGE and stained with silver to detect LPS (A), or transferred to PVDF membranes (B). Samples either were treated with proteinase K (+) prior to electrophoresis or were left untreated () to differentiate protein from carbohydrate antigens. Antigens were detected using immune sera prepared against RZ11, GT210, or GT211 as indicated. The source of OM samples are identified above each lane. The migration of molecular mass markers is noted. Arrows show the migration of LPS in proteinase K-treated samples.

Fig. 3. Schematic of IS1501 organization. (A) The structural organization of IS1501 is shown by a line with terminal inverted repeats represented as triangles. Open reading frames orfA and orfB are shown with a potential-1 translational frameshift sequence located where these genes overlap. (B) The locations of primers used in PCR-based genome walking experiments are indicated. (C) Alignment of the left (IRL) and right (IRR) terminal inverted repeat sequences is shown.

Fig. 2. Detection of IS1500 and IS1501 insertions in mutants. Genomic DNA digested with Bgl II was separated by agarose gel electrophoresis then blotted to a nylon membrane. Samples were hybridized with probes to IS1500 (A) or IS1501 (B). Arrows on the right show additional copies of IS1501 in strains GT210 and GT211, not detected in strain RZ11. The migration of size markers is shown.

determine if the additional copies of IS1501 detected in the mutants were the result of transposition events, mutant-specific copies of IS1501 were isolated and characterized.


3.3. Isolation of mutant-specific copies of IS1501 Sites containing IS1501 insertions in GT210 and GT211 were isolated using a PCR-based walking technique. Linkers attached to genomic digests were used as templates for PCR reactions using a linker specific primer (AP1) paired with an outward facing primer from within IS1501 (primers 1501-G3p or 1501-G5p). These reactions generated products with a portion of the IS element flanked by genomic DNA. Mutant-specific PCR products were identified by comparing amplicons produced from RZ11, GT210, or GT211 DNA by agarose gel electrophoresis. These mutant-specific PCR products were purified and their nucleotide sequences determined. To confirm the initial PCR-walking results, primers designed to anneal with sequences flanking each insertion site were used to generate PCR products from RZ11, GT210, and GT211 DNA templates. Sequence comparison of these PCR products confirmed that each of the mutant-specific copies analyzed resulted from transposition of IS1501 into additional locations in the genome. Each additional copy of IS1501 in strains GT210 and GT211 is flanked by a 3-bp direct repeat derived from the target sequence (Fig. 4). The formation of short direct repeats of the target sequence is common to insertions generated by IS3-like elements [4]. Comparison of hybridization and sequence data of PCR products generated from GT210 showed this strain has three additional copies of IS1501 as compared to the parental strain RZ11. In contrast, strain GT211 has only

203

one additional copy of IS1501, as compared to strain RZ11. The single, mutant-specific, copy of IS1501 in strain GT211 also occurs in strain GT210. Genomic loci altered by IS1501 in these mutants are shown schematically in Fig. 4. Strains GT210 and GT211 share a common, mutantspecific IS1501 insertion in OrfP35 (Fig. 4). OrfP35 encodes a protein of unknown function, and is located upstream of the L. interrogans serovar Pomona LPS locus [26]. OrfP35 homologs are found within, or adjacent to clusters of LPS biosynthetic genes in L. interrogans serovars Ballico, Copenhageni, Lai, Naam, and Pyrogenes [26]. However, the presence of OrfP35 homologs is not a consistent feature of Leptospira LPS loci and in some cases it may be a non-functional pseudogene [26]. These data suggest that OrfP35 may not be essential for LPS synthesis. Our understanding of LPS biosynthesis in L. interrogans is complicated by the fact that this process involves many gene products, many of which are poorly characterized and have no known functional homologs [27]. Because there are no methods for complementation analysis in L. interrogans, a cause-effect relationship between the IS1501 insertional inactivation of OrfP35 and altered LPS biosynthesis cannot be established. Strain GT210 has two additional copies of IS1501 that were not present in strains RZ11 or GT211. One of the GT210-specific IS1501 insertions disrupts a gene encoding a potential signaling protein belonging to the GGDEF family. Although members of this protein family occur in many bacterial genera, their function is not well defined. Strain GT210 also has an IS1501 copy inserted upstream of a putative methyltransferase (mta) gene. This region of the serovar Pomona genome is interesting because it is not found in the genome sequences of other L. interrogans serovars [7,28]. The presence of a transposase-like gene (tnp) similar to one encoded by ISPg3 of Porphyromonas gingivalis upstream of mta suggests serovar Pomona may have acquired this locus by lateral transfer. Further characterization of this locus may help determine possible origins of the sequence. The impact of IS1501 insertions into mta and the GGDEF-encoding gene on phenotype is unknown. 3.4. RT-PCR analysis of transcription

Fig. 4. Schematic of additional IS1501 insertions in mutant strains. The position and orientation of IS1501 insertions in in vitro-selected mutants are compared to homologous loci in the parental strain. (A) Insertion in OrfP35 occurs in both GT210 and GT211. (B) Insertion upstream of a methyltransferase (mta) gene in GT210. (C) Insertion in the GGDEF-encoding gene in GT210. Insertion sites are shown for the parental strain and relevant mutants. Sequences forming direct repeats at IS1501-genomic DNA junctions are shown in upper case. Primers used for PCR and RT-PCR studies are shown below corresponding loci. Symbols are described in the legend. The drawing is to scale.

Bacterial IS elements can either have a polar effect on transcription by inserting sequences that behave as transcriptional terminators, or they may have the opposite effect by activating genes adjacent to the insertion site by providing outward facing promoters [4]. The effect of IS1501 insertions at the OrfP35 and mta loci were determined by comparing products generated from mutant or parental strain RNA by RT-PCR reactions. The effects of IS1501 on transcription of the GGDEF gene were not studied because this insertion occurs near the 3 0 end of the gene, making analysis difficult, and it is

204


Fig. 5. RT-PCR analysis of transcripts. RNA was isolated from L. interrogans strains RZ11, GT210, and GT211, and analyzed by RT-PCR. Reactions lacked () or contained (+) reverse transcriptase. The source strain of the RNA is labeled for each pair of reactions. The amplification products are identified below each gel. (A) RT-PCR analysis of the OrfP35 and Orf34 portions of the LPS locus. (B) RT-PCR analysis of the mta locus. Size standards are shown on the right.

unlikely that this copy of the IS has a downstream effect as the nearest neighbor is over 1 kb downstream. To determine if IS1501 transcripts extend into adjacent sequences, a primer set using an IS-specific primer paired with a downstream gene-specific primer was used to analyze RNA samples from the parental strain and relevant mutant(s). A pair of gene-specific primers was used to detect transcription downstream of the insertion site at the two loci. PCR reactions without added RT were included to detect the presence of residual genomic DNA. RT-PCR analysis showed that IS1501 directs transcription downstream of the insertion, resulting in hybrid transcripts containing IS and flanking sequences at mutant loci (Fig. 5). RT-PCR reactions generated products using an IS1501-specific primer paired with gene specific primers at both the OrfP35 and mta loci using RNA from strain GT210, but no hybrid products were detected using RNA from strain RZ11. RNA from strain GT211 also generated a hybrid IS1501-OrfP35 product. Control reactions using gene specific primer pairs for OrfP35 and mta produced products from RNA isolated from parental and mutant strains. Although OrfP35 is 1728-bp upstream of OrfP34, and it is unlikely that these two genes are co-transcribed, both genes are part of a large conserved LPS biosynthetic locus [26]. Therefore, the potential effect of IS1501 insertion in OrfP35 on OrfP34 transcription was also analyzed by RT-PCR. OrfP34 transcripts were detected in RNA from RZ11, GT210, and GT211, thus, downstream LPS biosynthetic genes were transcribed in both mutants. The extension of IS1501 transcripts into adjacent sequences is consistent with the presence of an outward facing promoter near the 3 0 end of the element and a lack of potential transcription termination structures near the inverted repeats.

4. Concluding remarks Insertion sequences can have a significant impact on how pathogens interact with their hosts [4], so understanding the consequences of transposition in L. interrogans should provide insight into the role these elements have on phenotypic diversity. This report is the first to demonstrate transposition of an endogenous IS element in L. interrogans. The coding regions of two genes were disrupted by IS1501 in mutants selected in this study. However, transcripts extending from IS1501 into adjacent sequences were detected; suggesting that this IS may activate genes. Gene activation resulting from transposition of an IS element is not unique; several transposable elements can activate genes adjacent to insertion sites, including other members of the IS3-family [4,29]. Few sites containing IS1501 have been characterized in L. interrogans, thus the impact of this element on gene expression is not known. Future studies comparing the distribution of IS1501 should provide insight into how this element influences L. interrogans phenotypic diversity.

Acknowledgements The authors thank Dr. David Alt for help with the sequencing, and Ami Frank, John Foley, Richard Hornsby, and Amanda Toot for technical assistance. No endorsement of commercial products is herein implied.

References [1] World Health Organization, Leptospirosis worldwide, 1999. Weekly Epidemiological Report 74, pp. 237–244.

R.L. Zuerner, G.A. Trueba / FEMS Microbiology Letters 248 (2005) 199–205 [2] Faine, S., Adler, B., Bolin, C. and Perolat, P. (1999) Leptospira and Leptospirosis, 2nd edn. MediSci, Melbourne, Australia. [3] Zuerner, R.L. and Bolin, C.A. (1997) Differentiation of Leptospira interrogans isolates by IS1500 hybridization and PCR analysis. J. Clin. Microbiol. 35, 2612–2617. [4] Mahillon, J. and Chandler, M. (1998) Insertion sequences. Microbiol. Molec. Biol. Rev. 62, 725–774. [5] Boursaux-Eude, C., Saint Girons, I. and Zuerner, R.L. (1995) Isolation and characterization of an IS3-like element from Leptospira interrogans. Microbiology 141, 2165–2173. [6] Zuerner, R.L., Herrmann, J.L. and Saint Girons, I. (1993) Comparison of genetic maps for two Leptospira interrogans serovars provides evidence for two chromosomes and intraspecies heterogeneity. J. Bacteriol. 175, 5445–5451. [7] Nascimento, A.L.T.O., Ko, A.I., Martins, E.A.L., MonteiroVitorello, C.B., Ho, P.L., Haake, D.A., Verjovski-Almeida, S., Hartskeerl, R.A., Marques, M.V., Oliveira, M.C., Menck, C.F.M., Leite, L.C.C., Carrer, H., Coutinho, L.L., Degrave, W.M., Dellagostin, O.A., El-Dorry, H., Ferro, E.S., Ferro, M.I.T., Furlan, L.R., Gamberini, M., Giglioti, E.A., Goés-Neto, A., Goldman, G.H., Goldman, M.H.S., Harakava, R., Jeroˆnimo, S.M.B., Junqueira-de-Azevedo, I.L.M., Kimura, E.T., Kuramae, E.E., Lemos, E.G.M., Lemos, M.V.F., Marion, C.L., Nunes, L.R., de Oliveira, R.C., Pereira, G.G., Reis, M.S., Schriefer, A., Siqueira, W.J., Sommer, P., Tsai, S.M., Simpson, A.J.G., Ferro, J.A., Camargo, L.E.A., Kitajima, J.P., Setubal, J.C. and Van Sluys, M.A. (2004) Comparative genomics of two Leptospira interrogans serovars reveals novel insights into physiology and pathogenesis. J. Bacteriol. 186, 2164–2172. [8] Bessemans, A., Wittebolle, P. and Niemegeers, L. (1943) Modification expe´rimentale durable de la structure antigeńique des leptospires. Bull. Acad. R. Med. Belg. 8, 442–456. [9] Bakoss, P. (1966) Contribution a` la variabilite´ de la structure antigeńique des leptospires. Ann. Soc. Belge. Med. Trop. 46, 97– 100. [10] Yanagawa, R. and Takashima, I. (1974) Conversion of serotype in Leptospira from hebdomadis to kremastos. Infect. Immun. 10, 1439–1442. [11] Saito, T., Ono, E., Yanagawa, R., Cacciapuoti, B. and Ciceroni, L. (1987) Selection of antigenic variants from Leptospira interrogans serovar canicola by means of anti-canicola monoclonal antibody. Zbl. Bakt. Hyg. A 265, 290–298. [12] Ito, T., Takimoto, T. and Yanagawa, R. (1988) Presence of a variety of antigenic variants belonging to at least 4 different serovars in a population of Leptospira interrogans serovar hebdomadis. Zbl. Bakt. Hyg. A 269, 15–25. [13] Cacciapuoti, B., Ciceroni, L. and Hookey, J.V. (1993) Chromosomal rearrangement and serovar conversion in Leptospira biflexa strains. Zentralbl. Bakteriol. 278, 479–499. [14] Zuerner, R.L. (1991) Physical map of chromosomal and plasmid DNA comprising the genome of Leptospira interrogans. Nucl. Acids Res. 19, 4857–4860. [15] Ellinghausen, H.C. and McCullough, W.G. (1965) Nutrition of Leptospira pomona and growth of 13 other serotypes: fraction-

[16]

[17]

[18] [19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

205

ation of oleic albumin complex and medium bovine albumin and polysorbate 80. Am. J. Vet. Res. 26, 45–51. Johnson, R.C. and Harris, V.G. (1967) Differentiation of pathogenic and saprophytic leptospires. I. Growth at low temperatures. J. Bacteriol. 94, 27–31. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Ryu, E. (1970) Rapid microscopic agglutination test for Leptospira without non-specific reaction. Bull. Off. Int. Epizoot. 73, 49–58. Zuerner, R.L., Knudtson, W., Bolin, C.A. and Trueba, G. (1991) Characterization of outer membrane and secreted proteins of Leptospira interrogans serovar Pomona. Microb. Pathog. 10, 311– 322. Werts, C., Tapping, R.I., Mathison, J.C., Chuang, T.-H., Kravchenko, V., Saint Girons, I., Haake, D.A., Godowski, P.J., Hayashi, F., Ozinsky, A., Underhill, D.M., Kirschning, C.J., Wagner, H., Aderem, A., Tobias, P.S. and Ulevitch, R.J. (2001) Leptospiral lipopolysaccharide activates cells through a TLR2dependent mechanism. Nature Immunol. 2, 346–352. Tsai, C.M. and Frasch, C.E. (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119, 115–119. Hitchcock, P.J. and Brown, P. (1983) Morphological heterogeneity among Salmonella lipopolysaccharide chemotypes in silverstained polyacrylamide gels. J. Bacteriol. 154, 269–277. Zuerner, R.L., Hartskeerl, R.A., van de Kemp, H. and Bal, A.E. (2000) Characterization of the Leptospira interrogans S10-spc-a operon. FEMS Microbiol. Lett. 182, 303–308. Altschul, S.F., Warren, G., Miller, W., Myers, E. and Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Zuerner, R.L. and Huang, W.M. (2002) Analysis of a Leptospira interrogans locus containing DNA replication genes and a new IS, IS1502. FEMS Microbiol. Lett. 215, 175–182. de la Pena-Moctezuma, A., Bulach, D.M. and Adler, B. (2001) Genetic differences among the LPS biosynthetic loci of serovars of Leptospira interrogans and Leptospira borgpetersenii. FEMS Immunol. Med. Microbiol 31, 73–81. Bulach, D.M., Kalambaheti, T., de la Pena-Moctezuma, A. and Adler, B. (2000) Lipopolysaccharide biosynthesis in Leptospira. J. Mol. Microbiol. Biotechnol 2, 375–380. Ren, S.X., Fu, G., Jiang, G., Zeng, R., Miao, Y.G., Xu, H., Zhang, Y.X., Xiong, H., Lu, G., Lu, L.F., Jiang, H.Q., Jia, J., Tu, Y.F., Jiang, J.X., Gu, W.Y., Zhang, Y.Q., Cai, Z., Sheng, H.H., Yin, H.F., Zhang, Y., Zhu, G.F., Wan, M., Huang, H.L., Qian, Z., Wang, S.Y., Ma, W., Yao, Z.J., Shen, Y., Qiang, B.Q., Xia, Q.C., Guo, X.K., Danchin, A., Saint Girons, I., Somerville, R.L., Wen, Y.M., Shi, M.H., Chen, Z., Xu, J.G. and Zhao, G.P. (2003) Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing. Nature 422, 888–893. Charlier, D., Piette, J. and Glansdorff, N. (1982) IS3 can function as a mobile promoter in E. coli. Nucl. Acids Res. 10, 5935–5948.