prevalent phenotypes are the most damaging ones (Bar-Joseph et al., 1989; ...... Nicolosi E, Deng ZN, Gentile A, La Malfa S, Continella G and Tribulato E (2000) ...
ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA Y DEL MEDIO NATURAL
Citrus tristeza virus: serological diagnosis and variability analysis of genep23 in Cretan isolates Memoria presentada por AURORA LOZANO OMEÑACA Director RICARDO FLORES PEDAUYÉ Co-director IOANNIS LIVIERATOS Tutor ISMAEL RODRIGO BRAVO
LICENCIATURA EN BIOTECNOLOGÍA Valencia, septiembre de 2014
ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA Y DEL MEDIO NATURAL
Anexo 4 Autorización del director/a, codirector/a o tutor/a
Datos del trabajo de fin de carrera Autor: Aurora María Lozano Omeñaca
DNI: 16812710D
Título: Citrus tristeza virus: serological diagnosis and variability analysis of gene p23 in Cretan isolates. Área o áreas de conocimiento a las que corresponde el trabajo: Biología Molecular, Virología, Fitopatología Titulación:Licenciatura en Biotecnología
A cumplimentar por el director/a, codirector/a o tutor/a del trabajo (Que imparte docencia en la ETSIAMN) Nombre y apellidos: Ismael Rodrigo Bravo Departamento: Biotecnología En calidad de:
director/a
codirector/a
tutor/a
Autorizo la presentación del trabajo de fin de carrera cuyos datos figuran en el apartado anterior y certifico que se adecua plenamente a los requisitos formales, metodológicos y de contenido exigidos a un trabajo de fin de carrera, de acuerdo con la normativa aplicable en la ETSIAMN.
(Firma)*
,
de
de 200
En el caso de codirección, han de firmar necesariamente los que sean profesores de esta Escuela; si existe tutor o tutora, tiene que ser éste quien firme esta autorización. DIRECCIÓN DE LA ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA Y DEL MEDIO NATURAL
ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA Y DEL MEDIO NATURAL
Anexo 5 Ficha resumen del Trabajo Fin de Carrera
Datos personales Nombre y apellidos: Aurora María Lozano Omeñaca Datos del trabajo de fin de carrera Título del TFC:
Citrus tristeza virus: serological diagnosis and variability analysis of gene p23 in Cretan
isolates. Lugar de realización: Mediterranean Agronomic Institute of Chania Titulación: Licenciatura en Biotecnología Especialidad: Director/a: Ricardo Flores Pedauyé Codirector/a: IoannisLivieratos Tutor/a: Ismael Rodrigo Bravo
Fecha de lectura: Septiembre 2014
Resumen
La tristeza de los cítricos es un conjunto de enfermedades que suponen una de las mayores amenazas para la economía de regiones citrícolas como Creta (Grecia) y otras regiones del Mediterráneo. Está causada por el virus de la tristeza de los cítricos (CTV), un closterovirus de RNA de cadena simple positiva, que infecta el floema de plantas de la familia Rutaceae y es transmitido por áfidos y por injerto. La infección con CTV puede resultar en una gran variedad de síntomas, desde leves hasta muy severos. El tipo de síntomas desarrollados durante una infección con CTV depende de la variedad del huésped, de la combinación patrón/injerto y del genotipo(s) de CTV presente(s). Por ello la identificación y caracterización de los aislados de CTV es crucial para entender la dinámica de la población viral presente en determinadas áreas, así como para establecer las medidas específicas de contención a implementar. En este trabajo, 395 muestras de cítricos procedentes de distintas regiones de Creta fueron analizadas mediante immunoimpresión directa y DAS-ELISA para determinar la presencia de CTV. Seis de las muestras analizadas resultaron positivas para CTV, todas ellas procedentes de cultivos de la región de Chania, al oeste de Creta. Concretamente, una de las muestras infectadas provenía de Koufos, donde ya se habían registrado casos de infección, mientras que el resto eran originarias de Vatolakkos, un nuevo foco de infección, lo que sugiere la propagación del virus hacia nuevas áreas. Considerando la relación propuesta entre el gen p23 de CTV con el desarrollo de los síntomas, y los polimorfismos específicos del mismo asociados a los distintos grupos genotípicos de CTV, p23 fue amplificado mediante RT-PCR en tres de las muestras y subsiguientemente clonado y secuenciado. El análisis filogenético de la secuencia de p23 de los aislados de CTV de Creta, junto con la de otros 21 aislados de distintos países, reveló la gran similitud de los tres aislados Cretenses con el aislado de tipo severo Pum/SP/T1 de Taiwán. Este hallazgo respalda la idea de una reciente introducción de una cepa agresiva de CTV que coexistiría con el aislado suave T385 de España identificado anteriormente por otros autores en Creta.
Palabras clave Virus tristeza cítricos, closterovirus, gen p23.
Resum La tristesa dels cítrics és un conjunt de malalties que suposen una de les majors amenaces per a l'economia de regions citrícoles com Creta (Grècia) i altres regions del Mediterrani. Està causada pel virus de la tristesa dels cítrics (CTV), un closterovirus de RNA de cadena simple positiva, que infecta el floema de plantes de la família Rutaceae i és transmès per áfids i per empelt. La infecció amb CTV pot resultar en una gran varietat de símptomes, des de lleus fins a molt severs. El tipus de símptomes desenvolupats durant una infecció amb CTV depèn de la varietat de l'hoste, de la combinació patró/empelt i del genotip(s) de CTV present(s). Per açò la identificació i caracterització dels aïllats de CTV és crucial per a entendre la dinàmica de la població viral present en determinades àrees, així com per a establir les mesures específiques de contenció a implementar. En aquest treball, 395 mostres de cítrics procedents de diferents regions de Creta van ser analitzades mitjançant immunoimpresió directa i DAS-ELISA per a determinar la presència de CTV. Sis de les mostres analitzades van resultar positives per a CTV, totes elles procedents de cultius de la regió de Chania, a l'oest de Creta. Concretament, una de les mostres infectades provenia de Koufos, on ja s'havien registrat casos d'infecció, mentre que la resta eren originàries de Vatolakkos, un nou focus d'infecció, la qual cosa suggereix la propagació del virus cap a noves àrees. Considerant la relació proposada entre el gen p23 de CTV amb el desenvolupament dels símptomes, i els polimorfismes específics del mateix associats als diferents grups genotípics de CTV, p23 va ser amplificat mitjançant RT-PCR en tres de les mostres i subsegüentment clonat i seqüenciat. L'anàlisi filogenètica de la seqüència de p23 dels aïllats de CTV de Creta, juntament amb la d'altres 21 aïllats de diferents països, va revelar la gran similitud dels tres aïllats Cretenses amb l'aïllat de tipus sever Pum/SP/T1 de Taiwan. Aquesta troballa recolza la idea d'una recent introducció d'un cep agressiu de CTV que coexistiria amb l'aïllat suau T385 d'Espanya identificat anteriorment per altres autors a Creta.
Paraulesclau Virus tristesacítrics, closterovirus, gen p23.
Abstract
The tristeza, a complex of citrus diseases, is a major threat for the economy of citrus productive regions such as Crete (Greece) and other Mediterranean areas. Its causal agent, Citrus tristeza virus (CTV), is a single-stranded positive-sense RNA closterovirus that infects the phloem of plants of the family Rutaceae and is transmitted by aphids or plant propagation material. CTV populations can display a wide divergence of genotypes resulting in different symptoms, from mild to severe. Which symptoms are expressed during CTV infection depends on the citrus host, the scion/rootstock combination and the CTV genotype; thus, reliable identification and differentiation of virus isolates is crucial to understand the dynamics of viral populations in an infected area, as well as the symptoms and possible management. In this work, 395 citrus trees from different farms of three Cretan prefectures were analyzed by direct immunoprinting-ELISA and DAS-ELISA techniques in order to check for CTV infection. Six of the analyzed samples were found infected with CTV, all coming from farms of the Chania prefecture in Western Crete. Specifically, one of the infected samples came from Koufos, where CTV had been previously detected, and the others from Vatolakkos, a new locus of infection, thus suggesting the spread of the virus into new areas either by infected plant material exchange, or by aphid propagation. Considering the proposed association of CTV gene p23 with
symptom development, and the presence of polymorphisms specific for CTV genotype groups reported in this gene, RT-PCR amplification of gene p23 from three of the infected samples was implemented for posterior cloning and sequencing. The phylogenetic analysis of gene p23 sequence of the Cretan CTV isolates in comparison with other 21 worldwide representative isolates revealed a high similarity of the Cretan isolates analyzed with the severe stem pitting isolate Pum/SP/T1 from Taiwan. This findings support the idea of the recent introduction of a severe strain of CTV, the Taiwan-Pum/SP/T1 isolate, that would be coexisting with the mild isolate T385 from Spain found previously in Crete. Key words Citrus tristeza virus, closterovirus, gene p23.
INDEX
INDEX 1. INTRODUCTION………………………………………………………………………………………………………………....
3
1.1. Citrus fruit production……………………………………………………………………………...................
3
1.2. The tristeza disease…………………………………………………………………………………………………..
6
1.3. The CTV genome………………………………………………………………………………………………………. 11 1.4.
The CTV p23 gene…………………………………………………………………………………………………….
13
1.5. The CTV genomic diversity………………………………………………………………………………………… 15 1.6. CTV in Crete……………………………………………………………………………………………………………… 17 2. OBJECTIVES…………………………………………………………………………………………………………………………. 23 3. MATERIALS AND METHODS………………………………………………………………………………………………... 27 3.1. Plant material……………………………………………………………………………………………………………. 27 3.2. Direct immunoprinting-ELISA (Enzyme-Linked ImmunoSorbent Assay)………………………. 27 3.3. Double Antibody Sandwich (DAS)-ELISA…………………………………………………………………….. 28 3.4. Total RNA extraction and quantification………………………………………………………………….... 29 3.5. Reverse Transcription and Polymerase Chain Reaction (RT-PCR)………………………………… 30 3.6. Cloning of RT-PCR products……………………………………………………………………………………….. 31 3.7. Sequencing and phylogenetic analysis…………………………………………………………………….…. 33 4. RESULTS AND DISCUSSION………………………………………………………………………………………………..… 38 4.1. Routine CTV diagnostic in citrus samples by direct immunoprinting-ELISA................... 38 4.2. Detection of CTV infection in suspicious citrus samples by DAS-ELISA…………………….…. 38 4.3. Amplification and cloning of gene p23 of selected Cretan CTV isolates………………………. 41 4.4. Phylogenetic analysis of Cretan CTV isolates based on their p23 gene sequences………. 43 5. CONCLUSIONS……………………………………………………………………………………………………………….……. 51 6. REFERENCES……………………………………………………………………………………………………………………..… 55 7. ANNEXES…………………………………………………………………………………………………………………………….. 70
INTRODUCTION
2
1. INTRODUCTION 1.1. Citrus fruit production
Citrus fruits refer to the fruits of the botanical genus Citrus belonging to the Rutaceae family, Aurantioideae subfamily. Citrus are large shrubs or small trees with spiny shoots and evergreen entire margin leaves. Flowers are white and small (2-4 cm of diameter), and they are specially characterized for their strong scent. The citrus fruit is a hesperidium, a modified berry or a specialized form of berry resulting from a single ovary. In addition to citrus, this type of fruit is observed in five more related genera: Poncirus (trifoliate orange), Fortunella (kumquats), Microcitrus, Eremocitrus, and Clymenia in the subfamily Aurentioidae of family Rutacae. The citrus fruits consist of a though, leathery and bitter rind which interior is composed of 8-16 separate fleshy sections, carpels, in which seeds and juice sacs grow (Ladaniya, 2007). Citrus can be propagated both sexually and asexually. The sexual reproduction, by seeds, results in rustic, vigorous and long life plants, but also in a high variability of the progeny affecting the commercial value of the crop. Furthermore, many commercial varieties are seedless so the sexual reproduction system is unsuitable and it is only used to obtain rootstocks for grafting. In contrast, vegetative multiplication results in plants with better fruit quality that reproduce all the characteristics of the mother plant and in which the multiplication process is fastened. Grafting is the most commonly used method for citrus cultivation. In this technique the tissues from one plant are inserted into those of another in order to join the two sets of vascular tissue allowing the growth and development of those as one plant. The scion is the short piece of detached shoot containing several dormant buds, which, when united with the rootstock, comprises the upper portion of the graft and from which will grow the stem and branches of the grafted plant. It should be of the desired cultivar variety in order to develop its fruits. The rootstock is the lower portion of the graft, which develops into the root system. The best form of grafting for the propagation of citrus trees is bud grafting or ‘budding’ (Figure 1). The scion is a bud, along with some bark (budwood), and it is inserted 3
beneath the bark of the rootstock, generally a seedling with good growing properties (Hartmann et al., 1990).
Figure 1. On the left, schematic procedure of bud grafting technique: (1) scion is a cut bud with a small piece of bark and cambium, (2) rootstock is given a T-shaped cut and its bark is lifted to expose cambium, (3) bud is inserted into the rootstock and the bark is allowed to come back to its original position (only the bud is exposed), (4) the joint is treated with grafting wax and bandaged, (5) bud sprouts after 3-5 weeks. On the right, a picture of completed bud grafting in citrus.
The citrus fruit commercial species and varieties included by the Codex Commission of Food and Agriculture Organization (FAO) in the international standards of fruit quality (FAO, 2004, 2005) are: oranges grown from the species of Citrus sinensis; mandarins and tangerines grown from species of C. reticulata Blanco, Satsuma, Clementines, common mandarins (C. deliciosa) and their hybrids including ‘Kinnow’ (C. nobilis x C. deliciosa); grapefruits (C. paradisi); limes grown from species of C. aurantifolia Swingle (small-fruited) known as ‘Key’, ‘Mexican’ and ‘Kagzi’ lime and its hybrids, and limes from C. latifoliata (large-fruited) or Persian lime and its hybrids; and lemons (C. limon) and its hybrids. The origins of the actual citrus species and varieties are attributed ultimately to the hybridization between ancestral species of Citrus genus. Which are the ancestral species is a very controversial topic and, while some authors maintain as the ancestors the three citrus species citron (C. medica), mandarin (C. reticulata) and pummelo (C. 4
maxima) (Scora, 1975; Barrett and Rhodes, 1976), others include C. micrantha (Nicolosi et al., 2000). Although the citrus ancient relatives are native to Asian South-East countries (Galati, 2005), nowadays citrus production is spread all over the world. As shown in Figure 2, main citrus producer countries are China and Brazil, followed by United States, India, Mexico and Spain.
Figure 2. Global citrus fruit production in tonnes for 2012. Source: Own work using ChartsBin tool based on FAOSTAT data.
Most of the current commercial citrus species are perfectly adapted to the Mediterranean mild and frost-free climate, which allows perfectly their cultivation and diffusion. According to FAOstat data for 2012, Mediterranean countries (including European Union (EU) countries and non-European Mediterranean Partner Countries) cover 18.3% of the world citrus production and exporting is slightly more than half of the overall citrus fruits exchange in the world. Harvested citrus production in these countries consists mainly of oranges (58.6%), small citrus fruits as tangerines, mandarins and clementines (23.2%), and, in smaller proportion, lemons and limes (13.6%). The majority of citrus productive areas in the Mediterranean basin belongs to just four countries that provide about 71% of the entire area supply being Spain the most productive one (23.7%) followed by Egypt (16.7%), Turkey (15.7%) and Italy (15.6%). 5
Citrus fruits production of the Mediterranean countries in value terms amount on average to 5.3 billion international dollars in the 2009-10 biennium, representing 17.3% of world value (Schimmenti et al., 2013). Apart from the economic importance, the citrus sector has a significant social value in Mediterranean countries as a source of employment and income for thousands of families, especially in rural areas. Work is provided not only by the production at the farms, the nurseries and the packing houses, but also by the commercialization of agricultural supplements, transportation, manufacturing and sales.
1.2. The tristeza disease
Tristeza is a complex of diseases caused by Citrus tristeza virus (CTV), a phloem limited virus from the genus Closterovirus, family Closteroviridae, which natural hosts are mostly included in the genus Citrus except for kumquats (Fortunella spp) and few other citrus relatives (Timmer et al., 2000). Tristeza is a graft-transmissible disease but not seed-transmitted. Bud grafting is a commonly used technique in modern citriculture and consists on grafting a budwood of the selected commercial variety into a seed-obtained rootstock. Sour orange (C. aurantium) is the predominant citrus species employed as a rootstock due to its resistance to the infection with Phytophthora spp and its good adaptability and productive properties, being however, susceptible to CTV infection. Since the nineteenth century when navigation improved, the transport of infected plants and propagation materials led to the global distribution of CTV causing huge damages to the citrus industry. While the introduction of the virus into new regions takes part by the exchange of virus-infected buds, CTV can be also locally spread by aphid vectors, being Toxoptera citricidus and Aphis gossypii the main transmitting species of CTV (Figure 3).T. citricida has been proved to transmit the virus 6 to 25 times more efficiently than A. gossypii. T. citricida is well established in Asian, Australian, sub-Saharan African, Central and South American, and different Caribbean countries, whereas A. gossypii is the main
6
CTV vector in Mediterranean basin and areas of North America (Moreno et al., 2008).
Figure 3. Toxoptera citricida (left) and Aphis gossypii (right), main species of aphid CTV vectors. Source: National Bureau of Agricultural Important Insects.
CTV interaction with the host plant begins when the virus enters a plant cell and activates the plant defense mechanisms in order to program and use the plant cellular machinery for viral multiplication (Culver and Padmanabhan, 2007). CTV systemically infects the plant mainly by using long-distance movement through the sieve elements of the phloem, but also using cell-to-cell movement to enter adjacent companion or phloem parenchyma cells where virus replication occurs (Dawson et al., 2013). As seen in Figure 4, the cytopathology of CTV infections includes characteristic paracrystalline and amorphous inclusion bodies in the phloem elements of infected citrus (Gowda et al., 2000). Different plant responses can result from the different Citrus species interaction with the diverse CTV genotypes: disease development, asymptomatic infection or resistance (Garnsey et al., 1987, 1996, 2005). The CTV-host biochemical interactions can influence also the suitability of the aphid vectors of the virus, modulating their own spread and connecting pathogenicity with effective viral transmission (Fereres and Moreno, 2009).
7
Figure 4. Azure A stained citrus tristeza inclusion bodies in citrus tissue as viewed through a compound light microscope. The purple-stained inclusion bodies are clearly visible in the area of the phloem (250X). Source: FAO Corporate Document Repository.
CTV displays three different syndromes and a huge range of symptoms depending on CTV strain and on citrus variety or scion/rootstock combination. The most devastating disease is Tristeza or Quick decline (QD) that eventually causes death of the tree. This syndrome affects most of the commercial species grafted on sour orange rootstock (Figure 5.A), highly susceptible to CTV (Bar Joseph and Dawson, 2008, Moreno et al., 2008). The overgrowth of the scion at the bud union is distinctive from this syndrome and it is caused by the collapse and necroses of the sieve tubes and companion cells of this area, producing an excessive accumulation of non-functional phloem (Schneider, 1959). This causes a progressive loss of function of the root system resulting on wilting, leaf chlorosis and dieback. Trees affected with QD can also show drought sensitivity, stunting, poor growth and small unmarketable fruits (Moreno et al., 2008) (Figure 5.B). The QD pathotype is distributed all around the world and its destructive symptoms cause important economic damages. The alternative to avoid this syndrome is using tolerant CTV rootstocks instead of sour orange, which involves different agronomic disadvantages as water logging, damages from soil salinity and fungi, and lower fruit yield. However, tolerant and resistant rootstocks can be affected by highly virulent CTV strains developing the second syndrome called Stem pitting (SP). SP is characterized by deep pits in the wood under depressed areas of the bark (Figure 5.C-G). Although SP
8
does not involve tree death, the symptoms are severe enough to cause important economic losses because of the reduction of plant vigor, stunting and low fruit yield (Figure 5.D). SP is restricted to Asian, Australian, South American and South African regions and affects commercial lime, sweet orange and grapefruit trees grafted on any kind of rootstock. This CTV pathotype has been recently found in some regions of California, Florida and Mediterranean basin (Bar Joseph & Dawson, 2008; Moreno et al., 2008) what states the importance of trading with healthy certified plant materials and the genotype characterization in CTV epidemics. The third CTV syndrome has been identified mainly in greenhouses but also in topgrafted plants in the field and it is known as Seedling yellows (SY). Sour orange, grapefruit and lemon are the most susceptible varieties to this CTV pathotype (Fraser, 1952) that produces stunting, yellow leaves, reduction of root system and sometimes complete cessation of growth (Figure 5.E). Its importance lies on its diagnostic value to differ among CTV pathotypes (Garnsey et al., 2005). Apart from the CTV isolates that cause these three syndromes, there are mild CTV isolates that cause a complete lack of symptoms in almost all varieties of citrus (AlbiachMartí et al., 2000) but historically, when the CTV vector T. citricida is present, the prevalent phenotypes are the most damaging ones (Bar-Joseph et al., 1989; reviewed in Roistacher and Moreno, 1991) (Figure 5.F). Depending on the CTV syndrome and its incidence level, different measures could be applied to control the virus. In all cases, the availability of sensitive, reliable, rapid and cost-effective diagnostic protocols is of principal importance. In those countries were tristeza is not endemic, strict quarantine is necessary to prevent the virus entry. Once several trees are found to be infected, they must be eradicated (reviewed in Roistacher and Moreno, 1991). In this case, CTV surveys must be carried out regularly and should be combined with systematic monitoring of the aphid vectors involved in the virus propagation. Budwood certification programs, use of tolerant rootstock and cross protection with mild isolates, are preventive measures that should be efficiently promoted.
9
Figure 5. Different syndromes induced by CTV in different citrus varieties and scion/rootstock combinations. (A) Quick decline syndrome in a sweet orange tree propagated on sour orange rootstock. (B) Different stages of decline of three trees of the same scion/rootstock combination, in comparison with non-declined neighbor trees (dark green color). (C) Severe stem pitting symptoms in the trunk of a grapefruit on Poncirus trifoliata rootstock. (D) Smallsized fruits from a grapefruit tree on Poncirus trifoliata rootstock severely affected by stem pitting, in comparison with a normal grapefruit (left). (E) Stunted growth and small yellow leaves in a sour orange seedling inoculated with a seedling yellows isolate of CTV (left), in comparison with a similar plant inoculated with a mild non-seedling yellows isolate (right). (F) Vein clearing in a young leaf of Citrus macrophylla (upper) and vein corking in a leaf of Mexican lime (lower), inoculated with a mild and a severe CTV isolate, respectively. (G) Stem pitting in the trunk of CTV-infected Mexican lime seedlings grown in the greenhouse. Source: Moreno et al., 2008.
10
1.3. The CTV genome
CTV is a filamentous plant virus composed of a bipolar flexuous helicoidal particle encapsidated in both ends by two different coat proteins (Kitajima et al., 1964; Satyanarayana et al., 2004) (Figure 6). The viral genome consist of a single-stranded positive-sense RNA molecule (gRNA) of around 19.3 kbp (Karasev et al., 1995), being the largest known plant virus. It encodes twelve open reading frames (ORF), which potentially express at least seventeen proteins, and contains two non-translated terminal regions (NTR) at the 5’ and 3’ ends (Sekiya et al., 1991; Pappu et al., 1994; Karasev et al., 1995). The ORFs 1a and 1b in the 5’ terminal are translated from genomic RNA, while the other ten ORFs located in the 3’ half are expressed through a set of 3’ coterminal subgenomic RNAs (sgRNA) (Hilf et al., 1995; Karasev et al., 1997).
Figure 6. Transmission electron micrograph of purified tristeza virus particles. These particles measure about 12nm in width and 2000nm in length. Source: Photograph by M. Bar-Joseph, Volcani Institute of Agricultural Research.
The 5’ half of the genome encodes the replication gene block which comprises the ORFs 1a and 1b (Figure 7). The first one encodes a polyprotein of 349 kDa that includes two papain-like protease (PRO) domains and characteristic domains of helicase (HEL) and methyltransferase (MT). The ORF 1b encodes a 54 kDa protein with RNA-dependent RNA polymerase (RdRp) domains (Karasev et al., 1995). The other ten ORFs are located at the 3’ half of the genome (Figure 7). Part of these 3’ ORFs are contained in the quintuple gene block, conserved in the family of 11
closteroviruses and related with virion assembly and movement. The proteins expressed by these five ORFs are: a small transmembrane protein (p6) probably related with translocation and necessary for systemic invasion of host plant (Tatineni et al., 2008); HSP70h, a 65 kDa protein homologous of the plant heat-shock proteins; p61, involved together with HSP70h in virion assembly; the major coat protein (CP of 25 kDa) that coats the 97% of CTV genome; and the minor capsid protein (CPm of 27 kDa) that encapsidates the remainder 3% (Karasev et al., 1995; Satyanarayana et al., 2000; Dolja et al., 2006). The rest of the 3’ consist of: the gene p20, homologous to p21 of Beet Yellows Virus (BYV) and main component of the CTV-induced amorphous inclusion bodies (Gowda et al., 2000); and four other genes encoding the proteins p33, p18, p13 and p23, with no reported homologues in other closteroviruses (Dolja et al., 2006). The proteins p33, p18 and p13 are CTV host range determinants (Tatineni et al., 2008). The p23 is a multifunction protein and its roles are explained in the next section.
Figure 7. Schematic representation of CTV genome. Rectangles represent ORFs. NTR, nontranslated terminal region; PRO, papain-like protease; MT, methyltransferase; HEL, helicase; RdRp, RNA-dependent RNA polymerase; HSP70, homologous of HSP70 proteins; CPm, minor capsid protein; CP, major coat protein. Source: Albiach-Martí, 2013.
The 5’ NTR is the most variable sequence region among some CTV isolates but its secondary structure is similar even for divergent genotypes (López et al., 1998). The secondary structure, two stem-loops separated by a short spacer region, contains the sequences necessary for both replication and particle assembly (Gowda et al., 2003). On the other hand, 3’ NTR sequences are almost identical for CTV identified isolates (López et al., 1998).The 3’ half of the genome is relatively conserved with 90% sequence
12
identity, compared to the 5’ half with less than 70% sequence identity (Ayllón et al., 2001).
1.4. The CTV p23 gene
CTV p23 is a multifunctional protein of 209 amino acids with a molecular weight of approximately 23 kDa. It is expressed in early stages of cell infection (Navas-Castillo et al., 1997) and CTV p23 RNA transcripts are accumulated at highest levels compared with those from other CTV genes, reaching a maximum in the flowers and the lowest in the leaves (Shegani et al., 2012). It has no homologues among other closteroviruses, suggesting its possible evolution for specific interactions with its citrus hosts (Dolja et al., 2006). Biochemically, p23 displays an asymmetrical charge distribution where the Nterminal region has a net positive charge and the C-terminal region has a negative charge (López et al., 1998).This protein has a putative zinc finger domain (López et al., 1998), a conserved motif between amino acids 68 and 85 with three cysteine residues and one histidine, which are responsible for the coordination of the Zn 2+ ion. These amino acids are strictly conserved as well as the flanking basic amino acids between positions 50-86 and 100-157 (Sambade et al., 2003) (Figure 8).
Figure 8. Amino acid sequence of p23 protein from strain T36 with the putative zinc-finger domain. The cysteines and the histidine involved in Zn ion coordination are highlighted with colored background, and the arginines and lysines of the motifs rich in basic amino acids highlighted with bold font.
13
The presence of this domain and the accumulation of p23 in early stages of infection suggested a regulatory role for this protein. López et al. (2000) confirmed in vitro that p23 binds RNA in a non-sequence specific manner and demarcated this ability to the segment of the protein containing the putative zinc-finger domain and the motifs rich in basic amino acids. Additionally, p23 has been demonstrated to regulate the asymmetrical accumulation of plus and minus RNA strands required for CTV replication (Satyanarayana et al., 2002). Similarly to p20 and CP proteins encoded in the 3’ term of CTV genome, p23 blocks the plant RNA silencing, the regulatory and defense mechanism against invading nucleic acids. These proteins are RNA silencing suppressors (RSS) acting at different levels: p23 operates intracellularly, whereas CP works systemically and p20 at both levels; thus revealing a sophisticated viral defense strategy that targets the host RNA silencing pathway at different levels making infection with such a large genome virus successful (Lu et al., 2004). The intervention of this CTV mechanism by preventing the expression of the RSS genes of the virus has been reported to provide complete resistance against viral infection. This resistance was achieved via transformation of Mexican lime with an intron-hairpin vector carrying full-length untranslatable versions of the genes CP, p20 and p23 from CTV strain T36 (Soler et al., 2012). The results shown by Ruiz-Ruiz et al. (2013) unveiled the involvement of most of the p23 motifs for the RSS activity of the protein. The ectopic expression of p23 as a transgene in Citrus spp. has revealed its role in CTV pathogenicity displaying CTV-like symptoms (Ghorbel et al., 2001) and most likely, its function as the CTV determinant of seedling yellows syndrome in sour orange and grapefruit (Albiach-Martí et al., 2010). Additionally, ectopic expression of p23 enhances CTV systemic infection and enables the virus to escape from phloem cells (Fagoaga et al., 2011). As reported by Ruiz-Ruiz et al. (2013), p23 preferentially accumulates in the nucleolus and in nucleolar bodies comparable to Cajal bodies, as well as plasmodesmata. A bipartite nucleolar localization signal (NoLS) appeared to be
14
associated with the zinc finger domain and some basic motifs previously described. The nucleolar subcellular localization seems to be unique to p23 CTV protein among closterovirus species. Both pathogenicity and RSS activity are related with nucleolar localization of the protein (Ruiz-Ruiz et al., 2013). The association of p23 with symptom development and the sequence information of different CTV isolates are used for CTV isolate characterization and discrimination between mild and severe isolates. The association of specific polymorphisms of p23 gene with mild or severe phenotypes inferred from the analyses carried by Sambade et al. (2003) could be employed in the future for quick detection of potentially damaging sequence variants and for monitoring cross-protection. Furthermore, qRT-PCR performed on infected trees showed that CTV p23 transcripts accumulated at the highest levels in all tissues and therefore these RNA transcripts might represent one of the most suitable targets for molecular diagnosis of CTV (Shegani et al., 2012).
1.5. CTV genomic diversity
CTV, as other viruses, is capable of rapid evolution (Domingo and Holland, 1994) and this happens in parallel to host plant evolution (Gibbs, 1999). RNA replication of CTV is error-prone, resulting in numerous sequence variants of the virus (Drake and Holland, 1999). Additionally, frequent recombination events occur (Sambade et al., 2003; Vives et al., 2005; Martín et al., 2009) and thus defective RNAs (dRNAs) and chimeric genotypes are produced (Lai, 1995). The related genotype members of a distinct phylogenetic lineage, which implies a high level of sequence identity and a shared evolutionary history, are considered as strains (Harper, 2013). Amongst the Closteroviridae, the existence of multiple strains is a rarity being CTV the only closterovirus species to possess multiple phylogenetically distinct strains (Moreno et al., 2008). Characterization of CTV isolates presents diverse difficulties due to the large RNA genome of the virus, its fragile particles, its genetic complexity, the influence of aphid
15
transmission and host-virus combination, and the low concentrations in which the virus is found. In addition, it is possible to find different genotypes as members of mixed populations within a single host plant (Bar-Joseph and Dawson, 2008; Moreno et al., 2008). Characterized CTV isolates could consist of mixed populations of numerous different CTV genotype-related groups and dRNAs (Mawassi et al., 1995), but other isolates are mainly constituted by a single genotype and its quasispecies (Albiach-Martí et al., 2000; Ayllón et al., 2006). It is not known if symptoms are induced by the predominant sequence of an isolate, the complete viral population, the combination of gRNAs and dRNAs or other factors. However the acquired knowledge about the virus and the progresses on molecular technologies are helping to overcome these inner difficulties. Traditionally, CTV isolate characterization has been carried through observation and comparison of symptoms induced in inoculated plant hosts (Garnsey et al., 1991). Serological techniques using monoclonal antibodies, such as MCA13, have been also used to discriminate between severe and mild isolates (Permar et al., 1990; Moreno et al., 2008) or to identify isolates that may induce specific symptoms, such as severe stem pitting in sweet orange (Pappu et al., 1993). Sequence comparison of a single gene or genome region can be used effectively to discriminate between CTV isolates, even if it may not be representative of the entire genome (reviewed in Hilf and Garnsey, 2000). The sequencing of the first complete genomes of CTV isolates T36 from Florida (Karasev et al., 1995; GenBankU16304), VT from Israel (Mawassi et al., 1996; GenBankU56902) and T385 from Spain (Vives et al., 1999; GenBankY18420) together with its near homolog T30 from Florida (Albiach-Marti et al., 2000; GenBankEU937520), demonstrated the notable divergence among these three strains. Sequencing of novel isolates from all over the world during the last years indicates that the global CTV diversity is much higher than previously thought (Ruiz-Ruiz et al., 2006; Harper et al., 1999, Melzer et al., 2010; Roy and Brlansky, 2010). It is possible that new genotypes may have diverged from the ancestral population, or may have been originated through recombination of previously described strains (reviewed in Harper, 2013).
16
It may be proposed that the existence of multiple strains is responsible for the wide range of phenotypes observed within and between different citrus cultivars and species, particularly when multiple strains are in a mixture (Scott et al., 2013). The implementation of a quick method of CTV isolate characterization is of capital importance in order to prevent the introduction of severe strains that could cause huge damages and to apply the adequate containment measures to control the spread of the virus.
1.6. CTV in Crete
Greece is the third citrus producer country in the EU after Spain and Italy, and the sixth among the Mediterranean partner countries (FAOstat data in Schimmenti et al., 2013) with an annual production of approximately 1.3 million tons of citrus fruits (EuroMedCitrusNet, 2007). The 70% of citrus production consist of oranges, mandarins making an 18%, lemons an 11% and other citrus making the remaining 1%. Although citrus crops are mainly located in Peloponnesus and West continental Greece, Crete represents a remarkable percentage of the Greek citrus production. The principal citrus species cultivated in the island are sweet orange (C. sinensis) and mandarin (C. reticulata), being the majority of the production located in the region of Chania in Western Crete. The main orange varieties grown were Washington Navel type, locally named as Merlin, but in the last years growers found themselves forced to change over other varieties in order to bear the marketing competition with other stronger producing countries of this variety as Spain and Morocco (EuroMedCitrusNet, 2007) and to obtain a better and longer production season (Dimou et al., 2002). Mandarins are mainly Willow-leaf variety, with an excellent taste but with a distribution problem because of the big number of the fruit seeds, thus promoting in the last years the introduction of clementine and Nova, Page and Encore mandarin (EuroMedCitrusNet, 2007).
17
To avoid CTV introduction in Greece, importation of citrus propagating material from other countries was forbidden in 1959. This situation changed in 1995 when free entrance of plant material from European Community (EC) countries was allowed (EEC Directive 77/93, PD 332/1995, G.G.F.178/29.8.1995; Dimou et al., 2002). The implementation of a CTV survey program in 1995 by the Greek Ministry of Agriculture was required to comply with the new situation and the EC demands. The survey included mother, nursery and grove trees and was based on serological detection of the virus, at the beginning using Double Antibody Sandwich Enzyme-Linked ImmunoSorbent Assay (DAS-ELISA) but substituted in 1999 by direct immunoprinting-ELISA. By using this last method, prepared membranes may be stored until processing, it is easy to handle and the risk of contamination is reduced, and consist of a simple and rapid protocol. The survey has been accomplished in cooperation between the growers, the Ministry and local authorities, and specialized laboratories. Infection with CTV was reported in Greece for the first time in 2000 near Argos (North East Peloponnese) on one Lane Late navel orange grafted on the CTV tolerant rootstock Carrizo citrange. The tree was illegally imported from Spain in 1994, but was labelled Conformitas agrarian Communitatis (CAC) quality. At the same time another 18 trees of the initial illegal consignment of Lane Late navel were found in the area of Chania, Crete, and two, both CTV positive, had been used to establish an orchard of 50 trees which had in turn been used as a source of budwood. Consequent measures were undertaken being up to 3500 trees eradicated in the Chania region (Dimou et al., 2002). In a posterior survey in Crete during the years 2009 and 2010, a large number of trees were subjected to direct immunoprinting-ELISA for CTV detection. A total of 38 trees exclusively from the Western area of Crete were found to be infected. The infected trees included both grafted and non-grafted trees indicating that aphidmediated transmission had occurred since the original source of CTV was found in grafted trees. The samples from the infected trees TI, 342 and 802 were further analyzed and the complete nucleotide sequences of the CTV p23, CP and HSP70 ORFs
18
confirmed a 100% nucleotide identity to the Spanish mild isolate T385 (Vives et al., 1999; Y18420). In a recent study carried out by Owen et al. (2014), 32 full genome sequences of CTV isolates from Western Crete (Aghia, Koufos, Fournes and Platanias) and the Peloponnese (Nafplion) were compared together with other CTV isolates. The isolates from Koufos clustered together with other severe stem pitting isolates and shared a 99% nucleotide identity with the isolate Taiwan-Pum/SP/T1 (Su, 1981; JX266712). The other Cretan isolates and the mainland ones formed a group together with mild isolates including the T385 isolate from Spain. Field observations support these findings because at Koufos, CTV infection is severe, has spread rapidly and the containment measures applied have failed, while infections in other sites of the region had mild characteristics and had been successfully contained. CTV infections in Koufos came from independent introduction respect other loci of Western Crete. The low nucleotide distance within each genotype group, i.e. low level of genetic variation, could indicate that both introductions of CTV have occurred recently with no time enough for the accumulation of mutations, or that they correspond to multiple introductions (Owen et al., 2014). Production of citrus in Greece, as in other Mediterranean countries, represents an important fraction of the agricultural activity of the country. Despite the containment measures applied, infection by CTV threatens this sector, especially in Western Crete, causing important economic losses. Reliable identification and differentiation of virus isolates is crucial to understand the dynamics of viral populations in the infected area, as well as symptoms and possible management. It is also necessary to map the location of the different strains, and the introduction of exotic severe strains must be avoided.
19
20
OBJECTIVES
22
2. OBJECTIVES The current work, framed in the CTV survey program of the Ministry of Rural Development and Food of Greece carried out by the Mediterranean Agronomic Institute of Chania (MAICh), aims to analyze CTV infection in samples from different farms of the Crete island and to establish the current affecting strain(s). Considering the relationship with symptom development of CTV p23 and its specific polymorphisms associated to severe and mild isolates, the nucleotide sequence of 21 worldwide known variants of the corresponding gene will be compared with that of the CTV isolates found in Crete. Phylogenetic analyses of these sequences will be performed in order to identify CTV genotypes prevalent in this area that may permit the implementation of appropriate control measures. To implement this idea, the following specific objectives are defined:
- Routine diagnosis of CTV infection in citrus farms from different regions of Crete by serological techniques.
- Complementation of previous serological virus detection with molecular techniques such as RT-PCR with specific primers for the CTV p23 gene and subsequent cloning and sequencing.
- CTV genotype identification of Cretan isolates by phylogenetic analysis of their p23 gene sequences.
23
24
MATERIALS AND METHODS
26
3. MATERIALS AND METHODS 3.1. Plant material
Samples from a total of 395 citrus trees from private agricultural farms were provided by the Departments of Rural Development of Chania, Rethymno and Heraklion Prefectures, in the frame of the CTV survey conducted by the Ministry of Rural Development and Food of Greece. Sample collection for this project took place during September and October of 2013. Young fresh branches were selected from the middle part of the crown and stored at 4 °C until further analysis. Each sample consisted of four branches (one per each cardinal point) from the same tree. Geographic position system (GPS) data for each sample tree were registered and the location of the plots of origin is shown in Figure 9 as obtained using Google Earth.
Figure 9. Location of the citrus plots of origin of the samples analyzed by direct immunoprinting-ELISA. The plots in blue belong to the prefecture of Heraklion, in yellow to the prefecture of Rethymno and in green to the prefecture of Chania.
27
3.2. Direct immunoprinting-ELISA (Enzyme-Linked ImmunoSorbent Assay)
All samples were subjected to direct immunoprinting-ELISA analyses in seven nitrocellulose membranes. A smooth fresh cut was made with a razor blade in every branch and the cut surface was pressed gently against the membrane. A replication of each blot was made by a new cut of the branch and a new printing below the first one. As negative controls, printings from three new branches of two different CTV-free lemon trees from the laboratory gardens were included in each membrane. Orange trees from the Chania region (4180 and 4630 internal codes), whose infection with CTV was confirmed previously by DAS-ELISA and direct immunoprinting-ELISA, were used as positive controls. The membranes were developed with a tissue print-ELISA/immunoprinting-ELISA kit for CTV detection (PlantPrint Diagnostics S.L.) based on the alkaline phosphatase conjugated monoclonal antibodies 3DF1 and 3CA5 (Vela et al., 1986; Garnsey et al., 1993; Cambra et al., 2000). After membrane blocking with phosphate buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4) containing 1% (w/v) bovine serum albumin (BSA), the membranes were incubated with the conjugated antibodies diluted 1:100 in the same PBS buffer for 3 h at room temperature. Subsequently, Tween20 (1%, v/v) was used for membrane washing. Finally, alkaline phosphatase activity was detected by incubating the membranes with the substrates BCIP®/NBT (5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium; Sigma Fast) until appearance of purple coloration in the positive controls.
3.3. Double Antibody Sandwich (DAS)-ELISA
To confirm the CTV presence, 85 suspicious samples were additionally tested by DAS-ELISA. The assay was performed with the BIOREBA kit for DAS-ELISA, following the protocol instructions for a working volume of 200 µl per well using two 96-well microtiter plates (SARSTEDT). CTV detection was accomplished with the IgG polyclonal 28
antibodies obtained from rabbit antiserum (Bar-Joseph et al., 1980; Iracheta-Cárdenas et al., 2008). The negative and positive controls used in direct immunoprinting-ELISA were included in this assay. The first step of DAS-ELISA procedure consisted of coating the wells with the polyclonal antibody IgG diluted 1:1000 in coating buffer (1.5 M Na 2CO3, 40 mM NaHCO3 pH 9.6) overnight at 4 °C. Before the incubation with the antigens, the plates were washed three times with PBS containing Tween20 (0.05%, v/v). To prepare the plant extracts, plant tissue (0.3-0.5 g) from fresh leaves and petioles of each sample (and controls) were homogenized in 1.5 to 2 ml of a general extraction buffer (20 mM TrisHCl, 140 mMNaCl,8.3 mM PVP K25, 0.4 mM Tween20, 2.68 mM KCl, pH 7.4). After grinding, crude extracts were centrifuged at 10000 x g for 2 min and two aliquots of the supernatant (200 µl) were recovered, applied in two consecutive wells, and incubated overnight at 4 oC. Following the incubation, the plates were washed again and the antirabbit immunoglobulin conjugated with alkaline phosphatase (diluted 1:1000 in PBS with 0.2% BSA) was applied and incubated for 5 h at 30 °C. Finally, after one last wash, a solution of 20 mg of p-nitrophenyl-phosphate (pNPP) in 20 ml of substrate buffer (diethanolamine 10% in water, pH 9.8) was used to generate the detectable product of the reaction catalyzed by alkaline phosphatase. Optical density at 405 nm (OD405) was measured twice (at 30 and at 60 min) in a microplate reader (ASYS Expert Plus Biochrom). Samples were considered as positive for CTV infection when their OD405 value was at least five times higher than that of the negative control (minimum positive value).
3.4. Total RNA extraction and quantification
Total RNA isolation from three CTV-positive samples (4996 from Koufos, 5057 and 5141 from Vatolakkos) was the starting point for following analyses of the p23 gene of CTV.
29
Total RNA extraction was accomplished by using the TRIzol method (Life Technologies). About 100 mg of tissue per sample was homogenized with the aid of liquid nitrogen and mixed with 1 ml TRIzol for cell disruption and cell component solubilization. The complete dissociation of nucleoprotein complexes was achieved by adding 0.2 ml of chloroform and, after centrifugation, the RNA from the aqueous phase was precipitated with isopropanol (0.5 ml) and recovered by centrifugation. Finally after washing the sediment with 75% ethanol, RNA was dissolved in diethylpyrocarbonate (DEPC)-treated water and the total RNA concentration was quantified by measuring the absorbance at 260 nm (A260) using a nanophotometer (P300 IMPLEN).
3.5. Reverse transcription and polymerase chain reaction (RT-PCR)
To amplify the nucleotide sequence of p23 comprising the open reading frame from isolates 4996, 5057 and 5141, specific oligodeoxyribonucleotide primers were designed (Table 1). They were chosen following a BLAST analysis that showed complete conservation of their sequence among a large number of known CTV sequences from geographically distant isolates, including the two reported in Crete, Pum/SP/T1 from Taiwan and T385 from Spain (Owen et al., 2014). Specifically, a fragment of 870 bp was expected to be amplified with these primers.
Table 1.Specific sequence primers used for amplification of the fragments by RT-PCR.
Primer
Nucleotide sequence (5’-3’) Position a
Tm (°C)
p23PumF (forward primer)
CCGTCTTGCGTGTAGGTT
18273-18290 56.1
p23PumR (reverse primer)
CCAACGAGAGGATACGGT
19125-19143 56.1
a
Positions from Taiwan-Pum/SP/T1 CTV isolates including the primers in forward sense.
The cDNA for the p23 gene was synthesized by the reverse transcription and polymerase chain reaction (RT-PCR) two-step method in a Labcycler thermocycler (SensoQuest) following the protocol explained in Sambrook et al. (1989) by using the 30
Promega kit for reverse transcription (RT) and the Takara kit for polymerase chain reaction (PCR). Each RT reaction was carried out in a reaction mixture (10 µl) containing: 1 µg of total RNA preparation, 1 µl of reverse primer (10 mM), 2 µl of the deoxyribonucleotide triphosphate (dNTP) mixture (2.5 mM each), 2 µl of RT 5X reaction buffer (0.25 M Tris-HCl, 0.375 M KCl, 15 mM MgCl2, pH 8.3), 0.25 µl of RNase inhibitor (40 U/µl, Promega), 0.25 µl of PrimeScript reverse transcriptase (RT) (200 U/µl, Takara) and diethyl pyrocarbonate (DEPC)-treated water up to the final volume. The conditions for RT consisted of a 5-min denaturation at 98 °C, 1 h extension at 50 °C and 15 min at 70 oC for RT inactivation. RT products were subsequently amplified by PCR in a reaction mixture (25 µl) consisting of: 2 µl of cDNA, 2.5 µl of each primer (reverse and forward, 10 mM), 2 µl dNTPs (2.5 mM each), 2.5 µl of 10X LA PCR buffer (25 mM MgCl2), 0.25 µl LA Taq polymerase(5 U/µl, Takara) and DEPC-treated water up to the final volume. The thermocycler program for PCR was adjusted to the specific primers (T m = 56.1 °C) and to the total length of the amplicon (870 bp): pre-denaturation at 98 °C for 1 min, followed by 35 cycles of amplification each consisting of 10 s at 98 °C, 10 s at 53 °C and 1 min at 72 °C, with a final extension of 10 min at 72 °C. RT-PCR products (5 µl per sample) were analyzed by gel electrophoresis in 1% agarose in 1X TAE electrophoresis buffer (40 mM Tris-HCl, 20 mM sodium acetate, 1 mM EDTA), followed by staining with Gel Red
TM
(Life Technologies). The Gene Ruler 1 kb
DNA ladder (0.5 µg/µl, Fermentas Life Sciences) was used as a size standard.
3.6. Cloning of RT-PCR products
The p23 RT-PCR products for isolates 4996, 5057 and 5141 were gel-extracted using the QIAEX II gel extraction kit (QIAGEN) based on the solubilization of agarose gel and selective adsorption of DNA onto QIAEX II silica gel particles in the presence of chaotropic salts. After the solubilization of up to 250 mg of agarose gel containing each of the p23-specific DNA bands (870 bp) in 3 ml of QX I buffer, DNA adsorption was performed by incubating the samples with 10 µl of QIAEX II (for 2-3 µg of DNA) for 10
31
min in a water bath at 50 °C. After a short centrifugation, the collected silica gel particles were washed with buffer QX I and buffer PE. DNA recovery was completed by elution with 20 µl of 10 mM Tris-Cl (pH 8.5), with 1/10 of this solution being electrophoresed in a 1% agarose gel to estimate the yield. The purified DNA fragments were cloned in the linearized and thymidylated pGEM-T Easy vector (Promega) using standard protocols (Knoche and Kephart, 1999; Zhou et al., 2000; Chen et al., 2009). Insert and vector, at an approximate 3:1 molar ratio, were ligated together in a final reaction volume of 3.5 µl per sample, which included 1.67 µl of 2X rapid ligation buffer and 0.33 µl of 3 U/µl T4 DNA ligase (Promega). The mixture was incubated at 4 °C overnight. The ligated products (2 µl) were used to transform 50 µl of Escherichia coli Mach1 T1 phage-resistant chemically-competent cells (Life Technologies). Mixtures were placed on ice for 20 min, heat-shocked at 42 °C for 50 s in water bath, and returned immediately on ice for 2 min. After adding 250 μl LB medium (1% w/v bacto-tryptone, 1% w/v NaCl, 0.5% w/v bacto-yeast), the mixtures were incubated at 37 °C with constant shaking for 1 h. The blue-white selection method (Zamenhof and Villarejo, 1972; Langley et al., 1975) was used for recombinant screening in LB solid plates (1.5%
w/v
agar)
supplemented with 0.1% (v/v) ampicillin prepared at 100 µg/ml (LB/+Amp). For each reaction mixture, 35 µl IPTG (Isopropyl β-D-1-thiogalactopyranoside) and 35 µl X-gal (5bromo-4-chloro-3-indolyl-β-D-galactopyranoside) were added and, after re-suspending the cells, they were spread onto LB/+Amp plates for incubation overnight at 37°C. Finally, the incubation plates were placed at 4°C for better differentiation of the white colonies generated by recombinants. Four positive colonies per plate (four replications per sample) were selected for isolation of high-copy plasmid DNA with the Nucleospin Plasmid QuickPure kit and its current protocol (Macherey-Nagel). Each single colony was grown in 3 ml of LB/+Amp medium overnight at 37 °C under shaking, and an aliquot of 2 ml of each culture was centrifuged 3 min at 11000 x g. Pelleted cells were re-suspended in 250 µl of resuspension buffer and lysed with the same volume of SDS/alkaline buffer. The lysate
32
was neutralized and clarified using 300 µl of high-salt buffer, and then loaded in a NucleoSpin Plasmid column. After binding the DNA to the column, the silica particles were washed with 600 µl of ethanolic buffer to remove salts and macromolecular contaminants. Final elution of plasmid DNA was done with 50 µl of elution buffer. A final restriction with Eco RI (Fermentas, LifeSciences) was performed to verify the presence of the expected inserts and compared with a theoretical restriction with the same enzyme made with the program Nebcutter 2.0 (using as input the sequence of the pGEM-T-Easy vector and the sequence of the fragment amplified with the selected primers of the CTV Taiwan-Pum/SP/T1 isolate).
3.7. Sequencing and phylogenetic analysis
The nucleotide sequences of the inserts, containing the full-length CTV-p23 amplified DNA from the three samples, were determined in one single direction using the common sequencing primer T7 and an ABI 3730XL sequencer (Applied Biosystems). A phylogenetic analysis of the obtained sequences for the p23 gene of the Cretan samples 4996, 5057 and 5141, together with p23 sequences of 21 major CTV worldwide fully-sequenced isolates retrieved from the NCBI nucleotide data base (Table 2 ), was performed using several bioinformatic programs. For trimming the p23 gene exact sequence within the inserts, the three query sequences were subjected to a multiple sequence alignment by BLAST (Altschul et al., 1997) together with other known p23 sequences, using the default parameters. The p23 gene sequences of the three Cretan samples and the 21 selected CTV isolates were subsequently aligned by Clustal X 2.0 (Larkin et al., 2007) with default parameters. The same program performed the bootstrap testing (random number generator seed: 111; number of bootstrap trials: 1000) (Efron et al., 1996) and nucleotide distance estimation using the Neighbor-joining method (Saitou and Nei, 1987). Further analysis of the nucleotide (and amino acid) alignment conservation was implemented with GeneDoc (Nicholas et al., 1997). The obtained phylogenetic tree was represented as a
33
dendrogram using NJplot (Perrière and Gouy, 1996), and TreeView X © (Page, 2000) and iTOL (Letunic and Bork, 2006; 2011) were used for visualization and manipulation of the dendrogram.
Table 2. CTV worldwide known isolates used for comparative analyses .
NCBI Accession number CTV isolates KC525952
T3_FLORIDA
GQ454870
HA16-5_HAWAII
JQ911663
CT14A_CHINA
EU076703
B165_INDIA
FJ525433
TH28_NEWZEALAND
FJ525435
M17_NEWZEALAND
FJ525432
G90_NEWZEALAND
JF957196
B301_PUERTORICO
GQ454869
HA18-9_HAWAII
EU937520
T30_FLORIDA
Y18420
T385_SPAIN
U56902
VT_ISRAEL
DQ151548
T318A_SPAIN
AB046398
SY_JAPAN
HM573451
KPG3_INDIA
U16304
T36_FLORIDA
AF001623
SP_CALIFORNIA
EU857538
SP_NEWZEALAND
DQ272579
CTV_MEXICO
AY340974
QAHA_EGYPT
JX266712
TAIWAN-Pum/SP/T1
34
35
RESULTS AND DISCUSSION
37
4. RESULTS AND DISCUSSION 4.1. Routine CTV diagnostic in citrus samples by direct immunoprinting-ELISA
Tissue printing immunodecorated membranes were inspected for the appearance of purple precipitates in the vascular area of the prints indicating CTV presence. Negative controls showed no coloration in contrast to positive controls. However, among the analyzed samples, different degrees of coloring could be observed, and all membranes showed considerable background hindering the differentiation between the kit-provided controls or CTV infected samples. Since no conclusive inferences about CTV infection could be drawn, the 395 analyzed samples were classified into two different groups: suspicious (85 samples), showing any purple coloration, and non-suspicious (310 samples), displaying no obvious coloration. In Figure 10, a representative result of the difference between suspicious and non-suspicious samples is shown. The suspicious samples were subsequently analyzed by DAS-ELISA to confirm CTV presence.
Figure 10. Example of suspicious replicates showing purple coloration (left) and nonsuspicious samples showing no coloration (right).
4.2. Detection of CTV infection in suspicious citrus samples by DAS-ELISA
This analysis was applied to two plates containing a total of 85 samples and their replicates, plus two different positive and negative controls in each plate. Optical density at 405 nm was measured at two different times (30 and 60 min). The OD405values recorded after 60 min of incubation were considered as the final results and are shown in Annex I.
38
Figure 11. DAS-ELISA results. A) Optical density measured after 60 minutes of incubation of plate 1. Positive controls showed values of 1.451 and 2.312 respectively. The minimum positive value was 0.438 (five times higher than the mean value of the negative controls). None of the samples of this plate showed CTV infection according with this criterion. B) Optical density measured after 60 minutes of incubation of plate 2. Positive controls showed values of 1.342 and 0.771 respectively. The minimum positive value was 0.414. Samples 4996, 5053, 5057, 5141, 5220 and 5226 showed values consistent with CTV presence. For illustrative purposes, some representative samples are displayed. Complete results are shown in Annex I.
39
Samples were considered positive for CTV infection when their OD405 values were at least five times higher than the negative controls in their plate (minimum positive value). According to this criterion, none of the samples in plate 1 were positive for CTV but infection was confirmed in six of the samples analyzed in plate 2 (Figure 11). These CTV infected samples belong to two different loci from the Chania region: sample 4996 from Koufos, and samples 5053, 5057, 5141, 5220 and 5226 from Vatolakkos (Figure 12). In agreement with the previous reports of Dimou et al. (2002), Shegani et al. (2012) and Owen et al. (2014), the virus presence is restricted to the Western area of Crete. A large number of CTV-infected trees have been previously identified in the area of Koufos, representing nowadays the main CTV source of inoculum in Western Crete (Shegani et al., 2012; Owen et al., 2014), whereas Vatolakkos is a new locus where infection has been detected for the first time. This could mean that CTV has been propagated into new areas within this region due to local aphid transmission or to infected budwood distribution. Analyzed samples from other locations did not appear to be infected, but it is not possible to assure that those crops are CTV free because the samples could be non-representative of the entire plots.
Figure 12. Illustrative map showing the location of the citrus samples analyzed by DAS-ELISA in the Chania Prefecture in Western Crete. CTV infected samples found in Koufos and Vatolakkos (red spots). Other analyzed samples from that region showed no virus infection (green spots).
40
4.3. Amplification and cloning of gene p23of selected Cretan CTV isolates
Total RNA was extracted and fractionated by the TRIzol method using young shoots and leaves from CTV-infected samples 4996, 5057 and 5141. Purified RNA was subjected to a two-step RT-PCR in order to amplify the full p23 gene by using specific oligonucleotides (sequences previously shown in Table 1 in ‘Materials and methods’). Following RT-PCR, the size of the amplified DNA products was analyzed by running an aliquot of each final reaction mixture in a 1% agarose electrophoresis gel. In all cases, a prominent DNA product with the anticipated size (870 bp) was observed (Figure 13.A). RT-PCR amplified DNA products were gel-excised and purified by using the QIAEX II kit (Figure 13.B) for further cloning into the pGEM-T-Easy vector to produce recombinant DNA plasmids suitable for sequencing.
A)
B) Figure 13. A) Electrophoresis in 1% agarose gel of RT-PCR products from CTV samples 4996, 5057 and 5141 from left to right. The marker used on the last column is Gene Ruler 1 kb. Prominent bands of approximately 870 bp (the expected size for the full-length product corresponding to gene p23) were observed in the three samples. B) Gel electrophoresis in 1% agarose showing recovery of the full-length product corresponding to gene p23 excised from a previous agarose gel.
41
Figure 14. 1% agarose electrophoresis gel showing the 0.3 kbp and 0.6 kbp bands produced by Eco RI digestion of the full-length RT-PCR fragment of CTV p23 and the 3.0 kbp corresponding with the restricted plasmid. On the right of the marker, bands correspond with the uncut recombinant plasmids obtained by the blue-white selection method and lately sent for sequencing. Track order is indicated on the figure.
Following cloning into pGEM-T-Easy vector and selection of recombinants with the blue-white method, recombinant plasmids were isolated using the Plasmid Nucleospin Kit. The presence of specific restriction sites in the inserts containing the p23 fragment was assessed using the Eco RI restriction endonuclease and subsequent electrophoresis in 1% agarose gel for size estimation (Figure 14).All recombinants containing the putative p23 inserts presented three bands of approximately 0.30 and 0.60 kbp, corresponding to the excised insert, and 3.0 kbp, corresponding to the linearized plasmid. To predict the Eco RI cutting profile, in-silico digestion was performed using the NEBcutter 2.0 software (Figure 15). The profile observed in the experiment (3.0, 0.6 and 0.3 kbp) is in full agreement with the theoretical profile expected for the digestion of the recombinant plasmids by Eco RI (2997, 588 and 302 bp). Therefore, the proper cloning of the amplified fragment containing p23 gen into the pGEM-T-Easy vector has been demonstrated, and the inserts are susceptible to be sequenced.
42
Figure 15. Estimated digestion with Eco RI (recognition sequence: ‘GAATTC’) elaborated by Nebcutter 2.0. The ends of each restricted fragment, its coordinates and its lenght are indicated in the table. The circular display shows the ORF corresponding to the p23 gene and the Eco RI restriction sites for the full construction. The fragments obtained in the theoretical restriction are represented on the left in a theoretical 1% agarose gel in comparison to the Gene Ruler marker.
4.4.
Phylogenetic analysis of Cretan CTV isolates based on their p23 gene sequences
The inserts of three of the purified recombinant plasmids corresponding to each of the three Cretan CTV isolates (4996.1, 5057.1 and 5141.1)(Figure 14) were sequenced in one direction. The sequence of the insert contained in those plasmids, an 870-bp fragment, was trimmed to the exact p23 gene size (630 bp; Annex II) to facilitate direct comparison with the respective sequences of the 21 fully sequenced isolates retrieved from the NCBI database (Table 2 in ‘Materials and Methods’). The nucleotide and amino acid alignments for the p23 variants from the 24 CTV isolates studied are shown in Annex III and IV respectively. Based on the alignment of the nucleotide sequences of p23 of the selected CTV isolates, the phylogenetic tree for p23 was inferred with a 43
Neighbor joining method (Saitou & Nei, 1987) and 1000 bootstrap replicates to estimate the statistical significance of each node (Efron et al., 1996). The phylogenetic tree for p23 gene is represented as a dendrogram in Figure 16 to illustrate the evolutionary relationships among the analyzed isolates including nucleotide distance relation and bootstrap values.
999
594 1000 943 1000 1000 1000 928 1000 1000
1000
562
998
938 990 937
852 700 855
Figure 16. Neighbor-joining phylogenetic tree for CTV p23 gene showing bootstrap values for each clade. Cretan isolates are shown in red and the closest isolate, Taiwan-Pum/SP/T1 is highlighted in blue.
Phylogenetic analysis shows that CTV isolates 4996, 5057 and 5141 from Crete are clustering together with the severe stem-pitting isolate Taiwan-Pum/SP/ T1 (Su, 1981; GenBank JX266712), in agreement with the findings of Owen et al. (2014) about the recent introduction of this exotic isolate within the Western region of Crete. Also the two Hawaiian isolates (Meltzer et al., 2010; GenBankGQ454869 and GQ454870) are included within this clade. The mild isolate T385 from Spain, historically found in infected citrus trees in Western Crete and mainland Greece (Dimou et al., 2002; Shegani et al., 2012;
44
Owen et al., 2014), forms a separated group together with the mild isolate T30 from Florida (Figure 16). The three Cretan isolates share a high nucleotide identity for p23 sequence (99100%) (Table 3). These isolates exhibit 99% nucleotide identity to isolate TaiwanPum/SP/T1, with the divergence observed due to four single nucleotide substitutions along the p23 sequence. They also present important nucleotide identity (96-97%) with isolates HA18-9 and HA16-5 from Hawaii. Comparisons with the rest of the sequenced CTV isolates show levels of p23 identity ranging between 88-90%.
Table 3. Sequence identity between the gene p23 of the three analyzed Cretan CTV isolates and several worldwide CTV isolates. Data obtained by the nucleotide alignment generated by Clustal X and GeneDoc programs. 4996_CRETE
5057_CRETE
5141_CRETE
4996_CRETE
100%
99%
99%
5057_CRETE
99%
100%
99%
5141_CRETE
99%
99%
100%
TAIWAN-Pum/SP/T1
99%
99%
99%
T3_FLORIDA
89%
90%
89%
KPG3_INDIA
90%
90%
90%
T318A_SPAIN
90%
90%
90%
SY_JAPAN
89%
90%
90%
SP_CALIFORNIA
90%
90%
90%
B165_INDIA
90%
90%
90%
CT14A_CHINA
90%
90%
90%
VT_ISRAEL
89%
90%
89%
SP_NEWZEALAND
90%
90%
90%
T36_FLORIDA
90%
90%
90%
QAHA_EGYPT
90%
90%
90%
CTV_MEXICO
89%
90%
89%
TH28_NEWZEALAND
88%
88%
88%
M17_NEWZEALAND
88%
89%
88%
G90_NEWZEALAND
88%
88%
88%
B301_PUERTORICO
88%
88%
88%
T3_FLORIDA
90%
90%
90%
T385_SPAIN
90%
90%
90%
HA16-5_HAWAII
96%
97%
97%
HA18-9_HAWAII
96%
97%
97%
45
As shown in the amino acid alignment (Figure 17; Annex IV), some isolates (including those from Crete) show a glycine substitution in the conserved motif CVDCGRKHDKALKTERKC between amino acids 68 and 86, corresponding to the proposed zinc-finger domain (López et al., 1998), instead of the alanine at position 79. The three cysteines and the histidine that confer the ability of coordinating the Zn 2+ ion are conserved in all isolates. The basic amino acids of the motif associated with the nucleolar localization signal of p23 (Ruiz-Ruiz et al., 2013) and of the RNA-binding fragment (López et al., 2000) between positions 50-86 are conserved in all p23 sequences. As reported by Sambade et al. (2003), differences in positions 78-80 of the p23 protein allow distinction between CTV isolates. Mild isolates such as T30 from Florida have Ala78, Leu79 and Lys80, whereas isolates of the severe group as VT from Israel (and also SY from Japan, SP from California, B165 from India and others) have Ala78, Ser79 and Arg80. The group formed by the three Cretan isolates, Taiwan isolate Pum/SP/T1 and both Hawaiian isolates, have a Gly78, Leu79 and Lys80, like the nearest group formed by isolates T36 from Florida, Qaha from Egypt and Mexican isolate. These differences characteristic for each genotype group could be further studied in order to be used as a marker for rapid differentiation of CTV isolates.
Figure 17. Fragment of the amino acid alignment showing the conserved motif of the zinc-finger domain between positions 68 and 86, and the polymorphisms in positions 78, 79 and 80.
46
The amino acid motifs identified previously as indispensable for the performance of p23 roles are conserved in all CTV samples, whereas specific polymorphisms specific for the different genotype groups are found and could be used as markers for CTV isolate characterization. According to the entire results of this study, the isolates 4996, 5057 and 5141 from Koufos and Vatolakkos areas are evolutionary close to the severe stem pitting isolate Taiwan-Pum/SP/T1. As reported by Owen et al. (2014) this CTV genotype has been recently introduced in the island of Crete and it is coexisting with the Spanish mild isolate T385. To date, the Taiwanese genotype had only been identified in the area of Koufos. Since it has been found in a novel location in Vatolakkos, further studies should be implemented in order to contain the spread of the virus. CTV surveys should continue being implemented routinely and should be combined with systematic monitoring for the aphid vectors to promote sustainable strategies for the safety of the local citrus industry.
47
48
CONCLUSIONS
50
5. CONCLUSIONS
- Among the 395 citrus samples analyzed from the Chania, Rethymno and Heraklion prefectures, CTV has been detected only in six samples from the Chania prefecture in Western Crete.
- The infected samples belong to Koufos, where the CTV presence has been reported previously, and Vatolakkos, a new focus of viral infection, thus suggesting the spread of the virus.
- The sequence comparison of the p23 gene of the three Cretan isolates, 4996 from Koufos, and 5057 and 5141 from Vatolakkos, together with other worldwide representative CTV isolates, confirms the close relationship of the CTV isolates from Crete with the severe stem pitting isolate Pum/SP/T1 from Taiwan.
51
52
REFERENCES
54
6. REFERENCES Albiach-Marti MR, Mawassi M, Gowda S, Satanarayana T, Hilf ME, Shanker S, Almira EC, Vives MC, López J, Guerri J, Flores R, Moreno P, Garnsey SM and Dawson WO (2000) Sequences of Citrus tristeza virus separated in time and space are essentially identical. J Virol, 74: 6856-6865.
Albiach-Martí MR, Robertson C, Gowda S, Tatineni S, Belliure B, Garnsey SM, Folimonova SY, Moreno P and Dawson WO (2010) The pathogenicity determinant of Citrus tristeza virus causing the seedling yellows syndrome maps at the 3'-terminal region of the viral genome. Mol Plant Pathol, 11: 55-67.
Albiach-Marti MR (2013) The complex genetics of Citrus tristeza virus. In: V Romanoski (ed). Current Issues in Molecular Virology. Viral Genetics and Biotechnological Applications. InTech, pp 1-26.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W and Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res, 25: 3389-3402.
Ayllón MA, López C, Navas-Castillo J, Garnsey SM, Guerri J, Flores R and Moreno P (2001) Polymorphisms of the 5’ terminal region of Citrus tristeza virus (CTV) RNA: Incidence of three sequence types in isolates of different origin and pathogenicity. Arch Virol, 146: 27-40.
Ayllón MA, Rubio L, Sentendreu V, Moya A, Guerri J and Moreno P (2006) Variations in two gene sequences of Citrus tristeza virus after host passage. Virus Genes, 32: 119128.
55
Bar-Joseph M, Garnsey SM, Gonsalves D and Pucifull DE (1980) Detection of Citrus tristeza virus. Enzyme-linked immunosorbent assay (ELISA) and SDS-immunodiffusion methods. Proc 8thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 1-8.
Bar-Joseph M, Marcus R and Lee RF(1989)The continuous challenge of Citrus tristeza virus control. Annu Rev Phytopathol, 27: 291-316.
Bar-Joseph M and Dawson WO (2008) Citrus tristeza virus. In: BWJ Mahy and MHV van Regenmortel (eds). Encyclopedia of Virology. Third edition, Evolutionary biology of viruses. Amsterdam: Elsevier Ltd, pp 161-184.
Barrett HC and Rhodes AM (1976) A numerical taxonomic study of affinity relationships in cultivated Citrus and its close relatives. Syst Bot, 1: 105-136.
Cambra M, Gorris MT, Román MP, Terrada E, Garnsey SM, Camarasa E, Olmos A and Colomer M (2000) Routine detection of Citrus tristeza virus by direct Immunoprinting-ELISA method using specific monoclonal and recombinant antibodies. Proc 14thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 34-41.
Chen S, Songkumarn P, Liu J and Wang GL (2009) A versatile zero background T-vector system for gene cloning and functional genomics. Plant Physiol, 150: 1111-1121.
Culver JN and Padmanabhan MS (2007) Virus-induced disease: altering host physiology one interaction at a time. Ann Rev Phytopathol, 45: 221-243.
Dawson WO, Garnsey SM, Tatineni S, Folimonova SY, Harper SJ and Gowda S (2013) Citrus tristeza virus-host interactions. Front Microbiol, 4: 88.
Dimou D, Drossopoulou J, Moschos E, Varveri C and Bem F (2002) First report of Citrus tristeza virus in Greece. Plant Dis, 86: 329. 56
Dolja VV, Kreuze JF and Valkonen JPT (2006) Comparative and functional genomics of closteroviruses. Virus Res, 117: 38-51.
Domingo E and Holland JJ (1994) Mutation rates and rapid evolution of RNA viruses. In: SS Morse (ed). The evolutionary biology of viruses. New York: Raven Press Ltd, pp 161–184.
Drake JW and Holland JJ (1999) Mutation rates among RNA viruses. Proc Natl Acad Sci USA,96: 13910-13913.
Efron B, Halloran E and Holmes S (1996) Bootstrap confidence levels for phylogenetic trees. Proc Natl Acad Sci USA, 93: 13429-13434.
EuroMedCitrusNet (2007) Safe and High Quality Supply Chains and Networks for the Citrus Industry between Mediterranean Partner Countries and Europe. Contract No. 43146 (Food Quality and Safety) November 2007.
Fagoaga C, Pensabene-Bellavia G, Moreno P, Navarro L, Flores R and Peña L (2011) Ectopic expression of the p23 silencing suppressor of Citrus tristeza virus differentially modifies viral accumulation and tropism in two transgenic woody hosts. Mol Plant Pathol, 12: 898-910.
Fereres A and Moreno A (2009) Behavioral aspects influencing plant virus transmission by homopteran insects. Virus Res, 141: 158-168.
Flores R, Ruiz-Ruiz S, Soler N, Sánchez-Navarro J, Fagoaga C, López C, Navarro L, Moreno P and Peña L (2013) Citrus tristeza virus p23: a unique protein mediating key virushost interactions. Front Microbiol, 4.
57
Food and Agriculture Organization (2004 and 2005). Codex standards for fruit and vegetables. Food and Agriculture Organization, Rome.
Fraser L (1952) Seedling yellows, an unreported virus disease of citrus. Agric Gaz NS Wales, 63: 125-131.
Galati A (2005) Libéralisation des échanges et compétitivité des pays méditerranéens dans la filière agrumes. Project de thèse Master, Institut Agronomique Méditerranéen de Montpellier, France.
Garnsey SM, Barrett HC and Hutchinson DJ (1987) Identification of Citrus tristeza virus resistance in citrus relatives and its potential applications. Phytophylactica, 19: 187191.
Garnsey SM, Civerolo EL, Gumpf DJ, Yokomi RK and Lee RF (1991) Development of a worldwide collection of citrus tristeza virus isolates. Proc 11thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 113-120.
Garnsey SM, Permar TA, Cambra M and Henderson CT (1993) Direct tissue blot immunoassay (DTBIA) for detection of Citrus tristeza virus (CTV). Proc 12thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 39-50.
Garnsey SM, Su HJ and Tsai MC (1996) Differential susceptibility of pummelo and Swingle citrumelo to isolates of Citrus tristeza virus. Proc 13thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 138-146.
Garnsey SM, Civerolo EL, Gumpf DJ, Paul C, Hilf ME, Lee RF, Brlansky RH, Yokomi RK and Hartung JS (2005) Biological characterization of an international collection of Citrus tristeza virus (CTV) isolates. Proc 16thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 75-93. 58
Ghorbel R, López C, Fagoaga C, Moreno P, Navarro L, Flores R and Peña L (2001) Transgenic citrus plants expressing the Citrus tristeza virus p23 protein exhibit viral‐like symptoms. Mol Plant Pathol, 2: 27-36.
Gibbs A (1999) Evolution and origins of tobamoviruses. Philos Trans R Soc London B, 354: 517-685.
Gowda S, Satyanarayana T, Davis CL, Navas-Castillo J, Albiach-Martí MR, Mawassi M, Valkov N, Bar-Joseph M, Moreno P and Dawson WO (2000) The p20 gene product of Citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology, 274: 246-254.
Gowda S, Satyanarayana T, Ayllón MA, Moreno P, Flores R and Dawson WO (2003) The conserved structures of the 5´non-translated region of Citrus tristeza virus are involved in replication and virion assembly. Virology, 317: 50-64.
Harper SJ, Dawson TE and Pearson MN (2009) Complete genome sequences of two distinct and diverse Citrus tristeza virus isolates from New Zealand. Arch Virol, 154: 1505-1510.
Harper SJ (2013) Citrus tristeza virus: evolution of complex and varied genotypic groups. Front Microbiol, 4.
Hartmann HT, Kester DE and Davies FT (1990) Plant propagation: principles and practices. Fifth edition. Englewood Cliffs: Prentice Hall Inc, pp 354-385.
Hilf ME, Karasev AV, Pappu HR, Gumpf DJ, Niblett CL and Garnsey SM (1995) Characterization of Citrus tristeza virus subgenomic RNAs in infected tissue. Virology, 208: 576-582.
59
Hilf ME and Garnsey SM (2000) Characterization and classification of citrus tristeza virus isolates by amplification of multiple molecular markers. Proc 14thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 18-27.
Iracheta-Cárdenas M, Sandoval-Alejos BD, Román-Calderón ME, Manjunath KL, Lee RF and Rocha-Peña MA (2008) Production of polyclonal antibodies to the recombinant coat protein of Citrus tristeza virus and their effectiveness for virus detection. Phytopath, 156: 243-250.
Karasev AV, Boyko VP, Gowda S, Nikolaeva OV, Hilf ME, Koonin EV, Niblett CL, Cline K, Gumpf DJ, Lee RF, Garnsey SM, Lewandowski DJ and Dawson WO (1995) Complete sequence of the Citrus tristeza virus RNA genome. Virology, 208: 511-520.
Karasev AV, Hilf ME, Garnsey SM and Dawson WO (1997) Transcriptional strategy of closteroviruses: mapping the 5´termini of the citrus tristeza virus subgenomic RNAs. J Virol, 71: 6233-6236.
Kitajima EW, Silva DM, Oliveira AR, Muller GW and Costa AS (1964) Threadlike particles associated with tristeza disease of citrus. Nature, 201: 1- 112.
Knoche K, Kephart D (1999) Cloning blunt-end Pfu DNA polymerase-generated PCR fragments into pGEM®-T Vector Systems. Promega Notes, 7: 10-14.
Ladaniya M and Ladaniya M (2010) Citrus fruit: biology, technology and evaluation. New York: Academic press, pp 103-121.
Lai MMC (1995) Recombination and its evolutionary effect on viruses with RNA genomes. In: AJ Gibbs, CH Calisher and F García-Arenal (eds). Molecular basis of virus evolution. Cambridge: Cambridge University Press, pp 119-132.
60
Langley KE, Villarejo MR, Fowler AV, Zamenhof PJ and Zabin I (1975) Molecular basis of beta-galactosidase α-complementation. Proc Natl Acad Sci USA, 72: 1254-1257.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ and Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics, 23: 2947-2948.
Letunic I and Bork P (2006) Interactive Tree Of Life (iTOL): an online tool for phylogenetic tree display and annotation. Bioinformatics, 23: 127-128.
Letunic I and Bork P (2011) Interactive Tree Of Life v2: online annotation and display of phylogenetic trees made easy. Nucleic Acids Res, 39: 475-478.
López C, Ayllón MA, Navas-Castillo J, Guerra J, Moreno P and Flores R (1998) Molecular variability of the 5’- and 3’-terminal regions of citrus tristeza virus RNA. Phytopath, 88: 685-691.
López C, Navas-Castillo J, Gowda S, Moreno P and Flores R (2000) The 23kDa protein coded by the 3’- terminal gene of Citrus tristeza virus is an RNA-binding protein. Virology, 269: 462-470.
Lu R, Folimonov A, Shintaku M, Li WX, Falk BW, Dawson WO and Ding SW (2004) Three distinct suppressors of RNA silencing encoded by a 20-Kb viral RNA genome. Proc Natl Acad Sci USA, 101: 15742-15747.
Martín S, Sambade A, Rubio L, Vives MC, Moya P, Guerri J, Elena SF and Moreno P (2009) Contribution of recombination and selection to molecular evolution of Citrus tristeza virus. J Gen Virol, 90: 1527-38.
61
Mawassi M, Karasev AV, Mietkiewska E, Gafny R, Lee RF, Dawson WO and Bar-Joseph M (1995) Defective RNA molecules associated with Citrus tristeza virus. Virology, 208: 383-387.
Mawassi M, Mietkiewska E, Gofman R, Yang G and Bar-Joseph M (1996) Unusual sequence relationships between two isolates of Citrus tristeza virus. J Gen Virol, 77: 2359-2364.
Melzer MJ, Borth WB, Sether DM, Ferreira S, Gonsalves D and Hu JS (2010) Genetic diversity and evidence for recent modular recombination in Hawaiian Citrus tristeza virus. Virus Genes, 40: 111-118.
Moreno P, Ambrós S, Albiach-Martí MR, Guerri J and Peña L (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol, 9: 251268.
Navas-Castillo J, Albiach-Marti MR, Gowda S, Hilf ME, Garnsey SM and Dawson WO (1997) Kinetics of accumulation of citrus tristeza virus RNAs. Virology, 228: 92-97.
Nicholas KB, Nicholas HB Jr and Deerfield DW (1997) GeneDoc: analysis and visualization of genetic variation. EMBnews, 4: 14.
Nicolosi E, Deng ZN, Gentile A, La Malfa S, Continella G and Tribulato E (2000) Citrus phylogeny and genetic origin of important species as investigated by molecular markers. Theor Appl Genet, 100: 1155-1166.
Owen C, Mathioudakis M, Gazivoda A, Gal P, Nol N, Kalliampakou K, Figas A, Bellan A, Iparaguirre A, Rubio L and Livieratos IC (2014) Evolution and molecular epidemiology of Citrus tristeza virus on Crete: recent introduction of a severe strain. J Phytopathol, (in press) doi: 10.1111/jph.12266. 62
Page RDM (2000) Tree View: An application to display phylogenetic trees on personal computers. Comput Appl Biosci, 12: 357-358.
Pappu H, Pappu S, Niblett C and Civerolo E (1993) Comparative sequence analysis of the coat protein of biologically distinct citrus tristeza closterovirus isolates. Virus Genes, 7: 255-264.
Pappu HR, Karasev AV, Anderson EJ, Pappu SS, Hilf ME, Febres VJ, Eckloff RMG, McCaffery M, Boyko V, Gowda S, Dolja VV, Koonin EV, Gumpf DJ, Cline K, Garnsey SM, Dawson WO, Lee RF and Niblett CL (1994) Nucleotide sequence and organization of eight 3′ open reading frames of citrus tristeza closterovirus genome. Virology, 199: 35-46.
Permar TA, Garnsey SM, Gumpf DJ and Lee RF (1990) A monoclonal antibody that discriminates strains of Citrus tristeza virus. Phytopathology, 80: 224-228.
Perrière G and Gouy M (1996) An on-line retrieval system for biological sequence banks. Biochimie, 78: 364-369.
Roistacher CN and Moreno P(1991)The worldwide threat from destructive isolates of Citrus tristeza virus—a review. Proc 11thConf Inter Organ Citrus Virol, IOCV, Riverside, pp 7-19.
Roy A and Brlansky RH (2010) Genome analysis of an orange stem pitting Citrus tristeza virus isolate reveals a novel recombinant genotype. Virus Res, 151: 118-130.
Ruiz-Ruiz S, Moreno P, Guerri J and Ambrós S (2006) The complete nucleotide sequence of a severe stem pitting isolate of Citrus tristeza virus from Spain: comparison with isolates from different origins. Arch Virol, 151: 387-98.
63
Ruiz-Ruiz S, Soler N, Sanchez-Navarro J, Fagoaga C, López C, Navarro L, Moreno P, Peña L and Flores R (2013) Citrus tristeza virus p23: determinants for nucleolar localization and their influence on suppression of RNA silencing and pathogenesis. Mol Plant Microbe Interact, 26: 306-318.
Saitou N and Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol, 4: 406-425.
Sambade A, López C, Rubio L, Flores R, Guerri J and Moreno P (2003) Polymorphism of a specific region in gene p23 of Citrus tristeza virus allows discrimination between mild and severe isolates. Arch Virol, 148: 2325-2340.
Sambrook J, Fritsch EF and Maniatis T (1989) Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory Press, pp 8-64.
Satyanarayana T, Gowda S, Mawassi M, Albiach-Martí MR, Ayllón MA, Robertson C, Garnsey SM and Dawson WO (2000) Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology, 278: 253-265.
Satyanarayana T, Gowda S, Ayllón MA, Albiach-Martí MR, Rabindram R and Dawson WO (2002) The p23 protein of Citrus tristeza virus controls asymmetrical RNA accumulation. J Virol, 76: 473-483.
Satyanarayana T, Gowda S, Ayllón MA and Dawson WO (2004) Closterovirus bipolar virion: evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA 5´region. Proc Natl Acad Sci USA, 101: 799-804.
64
Schimmenti E, Borsellino V and Galati A (2013) Growth of citrus production among the Euro-Mediterranean countries, political implications and empirical findings. Span J Agric Res, 11: 561-577.
Schneider H (1959) The anatomy of tristeza-virus-infected citrus. In: JM Wallace (ed).Citrus virus diseases. Berkeley, CA: University of California Division of Agricultural Science Bulletin, pp 73- 84.
Scora RW (1975) On the history and origin of citrus. B Torrey Bot Club, 102: 369-375.
Scott KA, Hlela Q, Zablocki O, Read D, van Vuuren S and Pietersen G (2013) Genotype composition of populations of grapefruit-cross-protecting citrus tristeza virus strain GFMS12 in different host plants and aphid-transmitted sub-isolates. Arch Virol, 158: 27-37.
Sekiya ME, Lawrence SD, McCaffery M and Cline K (1991) Molecular cloning and nucleotide sequencing of the coat protein gene of Citrus tristeza virus. J Gen Virol, 69: 1013-1020.
Shegani M, Tsikou D, Velimirovic A, Afifi H, Karayianni A, Gazivoda A, Manevska K, Manakos I and Livieratos IC (2012) Citrus tristeza virus on the island of Crete: a survey and detection protocol applications. J Plant Pathol, 94: 71- 78.
Soler N, Plomer M, Fagoaga C, Moreno P, Navarro L, Flores R, et al.(2012) Transformation of Mexican lime with an intro-hairpin construct expressing untranslatable version of the genes coding for the three silencing suppressors of Citrus tristeza virus confers complete resistance to the virus. Plant Biotechnol J, 10: 597-608.
65
Su HJ (1981) A tristeza virus strain causing dwarf of pummelo and grapefruit. In: K Matsumoto et al., (eds). International Citrus Congress. Fourth edition. Tokyo: International Society of Citriculture, pp 423-430.
Tatineni S, Robertson C, Garnsey SM, Bar-Joseph M, Gowda S and Dawson WO (2008) Three genes of Citrus tristeza virus are dispensable for infection and movement throughout some varieties of citrus trees. Virology, 376: 297-307.
Timmer LW, Garnsey SM and Graham JH (2000) Compendium of Citrus Diseases. St Paul, Minnesota: APS Press, pp 55-56.
Vela C, Cambra M, Cortés E, Moreno P, Miguet JG, Pérez de San Román C and Sanz A (1986) Production and characterization of monoclonal antibodies specific for Citrus tristeza virus and their use for diagnosis. J Gen Virol, 67: 91-96.
Vives MC, Rubio L, López C, Navas-Castillo J, Albiach-Martí MR, Dawson WO, Guerri J, Flores R and Moreno P (1999) The complete genome sequence of the major component of a mild Citrus tristeza virus isolate. J Gen Virol, 80: 811-816.
Vives MC, Rubio L, Sambade A, Mirkov TE, Moreno P and Guerri J (2005) Evidence of multiple recombination events between two RNA sequence variants within a Citrus tristeza virus isolate. Virology, 331: 232-237.
Zamenhof P and Villarejo M (1972) Construction and properties of E. coli strains exhibiting α-complementation of beta-galactosidase fragments in-vivo. J Bacteriol, 110: 171-178.
Zhou MY and Gómez-Sánchez CE (2000) Universal TA Cloning. Curr Issues Mol Biol, 2:1-7.
66
67
ANNEXES
69
7. ANNEXES ANNEX I. DAS-ELISA results A) DAS-ELISA plate 1 OD405 mean values and minimum positive value
DAS-ELISA results PLATE 1
DAS-ELISA results PLATE 1 (continued)
Sample code
Mean value
Sample code
Mean value
9,8
0,091
7,9
0,108
9,7
0,092
7,1
0,092
9,6
0,093
9,3
0,083
Control (+) B
2,312
9,2
0,087
Control (-) B
0,087
A9
0,094
78
0,097
5297
0,081
80
0,093
5292
0,097
82
0,103
5283
0,091
L1
0,080
5276
0,097
7,50
0,086
5275
0,086
7,49
0,086
5274
0,093
7,48
0,086
5272
0,084
7,47
0,085
5270
0,086
7,45
0,087
5266
0,088
7,37
0,085
5265
0,095
7,36
0,127
8,3
0,094
7,30
0,087
8,4
0,105
7,29
0,094
8,6
0,081
7,19
0,102
8,7
0,097
8,8
0,127
Control (+) A
1,451
8,31
0,087
8,32
0,120
8,33
0,095
Control (-) A
0,089
7,18
0,128
8,34
0,088
7,11
0,100
8,57
0,094
Minimum positive value (DAS-ELISA plate 1) = 0,44 Control (-) A = 0,089 Control (-) B = 0,087 Control (-) Mean = 0,088
Minimum positive value = (Control (-) Mean) x 5 = 0.44
70
B) DAS-ELISA plate 2 OD405 mean values and minimum positive value
DAS-ELISA results PLATE 2
DAS-ELISA results PLATE 2 (continued)
Sample code
Mean value
Sample code
Mean value
5266
0,089
5329
0,085
5260
0,098
5328
0,084
5258
0,092
5327
0,079
5256
0,098
5255
0,093
5326
0,085
5254
0,091
5325
0,085
5253
0,105
5324
0,084
5252
0,096
5323
0,087
5251
0,102
5322
0,086
5347
0,091
5321
0,085
5346
0,086
5320
0,090
5345
0,090
5319
0,091
5342
0,093
5314
0,084
5341
0,093
5309
0,089
Control (+) A
1,342
5308
0,086
5307
0,090
Control (-) A
0,080
5057
1,390
5340
0,095
4996
1,326
5226
1,286
5220
1,226
5053
1,257
5141
1,478
5339
0,093
5333
0,086
5332
0,084
Control (+) B
0,771
Control (-) B
0,086
Minimum positive value (DAS-ELISA plate 2) = 0,42 Control (-) A = 0,080 Control (-) B = 0,086 Control (-) Mean = 0,083
Minimum positive value = (Control (-) Mean) x 5 = 0.42
71
ANNEX II. Sequencing results Nucleotide sequences of the three amplified fragments of the analyzed CTV isolates from Crete. Primers are highlighted in red and p23 sequence is highlighted in yellow. > 4996_CRE WMAACCWCCCYYCCCCCWWWGGTKGGCCGATTCATTATGCAGCKGCMCGAACAGGTTTCCCGACTGAAAGCGGCAGKGAGWGCACGCA TTAATGKGAGTTAGCTCMCYCATAGGCACCCCCAGGCTTTACMCTTTATGCTTCCGGCTCGTATGTTGKGKGAATGTGAGCGGATACA ATTTCACACAGGAAACAGCTATGACCATGATTACGCAAGCTATTTAGKGACACTATAGATACTCAAGCTATGCATCCAACGCGTTGGG AGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCCGTCTTGCGTGTAGGTTAATACGTTTCTCAGAACGTG TGGTTGTATTAACTAACTTTAATTGGAACAAGTTTATTGTAAAGTCTGCGAGTTACAATGGATAGTACTAGCGGACAAACTTTCGTTT CTGTGAACCTTTCTGACGAAAGCAACACAGCAAGTACTGCAGTTAGAACCGTAAGTTCGGAAGCTGATCGCTTGGAACTTTTACGAAA AATGAACCCCTTTATCATCGACGCTTTGGTACGGAAAACCAATTATCAGGGTGCTCGCTTTCGCGCAAAAATAATAGGAGTATGCGTA GATTGTGGTAGAAAACACGATAAGGGGTTGAAGACCGAACGTAAATGTAAGGTCAATAATACACAGTCTCAGAACGAGGTGGCGCATA TGTTAATGCACGATCCCGTTAAGTATTTAAATAAAGGAAAGGCTAGAGCCTTTTCTAACGCAGAGATGTTTGCAATCAATTTGGTTAT GTACACCAAGGAAAAGCAGTTGGCGGTTAATTTGGCCGCTGAAAGGGAGAAGACGAGACTGGCTCGTAGACACCCGATGCGTTCTCCG GAAGAAACTCCGGAATTCTATAAATTCGGTATAACTGCTAAAGCAACGTTACCGAACATCAACGCTGTGGACGTTGGTGATAACGAGG ACACTTCGTCGGAGTACCCAGTGAGTCTGAGTGTTTCTGACGGAGTTCTCCGTGAACACCACTTCATCTGATTGAAGTGGACGGAATA AGTTCCTTGCGGAACTTTATGTCGGGTTGGTAAAAACCCTTATGATGGTGATGTATCACTAGACAATAACCGGATGGGTAAAGTCTTT AAAATGATCGAGGGGAAAAATTAACCGTATCCTCTCGTTGGAATCGAATTCCCGCGGCCGCCATGGCGGCCGGAGCATGCGACTCCCY TTT
> 5057_CRE AATCMGGGGAGTCGCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTCGATTCCGTCTTGCGTGTAGGTTAATACGTTTCTCAGAACG TGTGGTTGTGTTAACTAACTTTAATTGGAACAAGTTTATTGTAAAGTCTGCGAGTTACAATGGATAGTACTAGCGGACAAACTTTCGT TTCTGTGAACCTTTCTGACGAAAGCAACACAGCAAGTACTGCAGTTAGAACCGTAAGTTCGGAAGCTGATCGCTTGGAATTTTTACGA AAAATGAACCCCTTTATCATCGACGCTTTGGTACGGAAAACCAATTATCAGGGTGCTCGCTTTCGCGCAAAAATAATAGGAGTATGCG TAGATTGTGGTAGAAAACACGATAAGGGGTTGAAGACCGAACGTAAATGTAAGGTCAATAATACACAGTCTCAGAACGAGGTGGCGCA TATGTTAATGCACGATCCCGTTAAGTATTTAAATAAAGGAAAGGCTAGAGCCTTTTCTAACGCAGAGATGTTTGCAATCGATTTGGTT ATGTACACCAAGGAAAAGCAGTTGGCGGTTAATTTGGCCGCTGAAAGGGAGAAGACGAGACTGGCTCGTAGACACCCGATGCGTTCTC CGGAAGAAACTCCGGAATTCTATAAATTCGGTATAACTGCTAAAGCAACGTTACCGAACATCAACGCTGTGGACGTTGGTGATAACGA GGACACTTCGTCGGAGTACCCAGTGAGTCTGAGTGTTTCTGACGGAGTTCTCCGTGAACACCACTTCATCTGATTGAAGTGGACGGAA TAAGTTCCTTGCGGAACTTTATGTCGGGTTGGTAAAAACCCTTATGATGGTGATGTATCACTAGACAATAACCGGATGGGTAAAGTCT TTAAAATGATCGAGGGGAAAATTTAACCGTATCCTCTCGTTGGAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGA GAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTG TGTGAAATTGTTATCCGCTCACATTCCACACAAMATACGAGCCGGAAGCATAAGTGTAAGCTGGGTGCCTAATGAGTGAGCTACTCMC ATTATTGCGTGCSCTCMCTGCCGCTTTCAGTCGGGAAACCTGKTCGKGCCAGCTKCWTTA
> 5141_CRE AAGCGGGWCMGKRGRWGCAACWCAATSATGKGRKTAGCTCAMTCATTAGGCMCCCAGGCTTTACACTTTSSGCSTCMGGCTMGTATGT TGKGKGAATGTGAGCGASAACAATTTCACACAGAAACAGCTAAKACCATGATACGCCAAGCYATTAGGTGACACTASARASACTCAGC TATGCATCCAACGCGTTGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCCGTCTTGCGTGTAGGTT AATACGTTTCTCAGAACGTGTGGTTGTATTAACTAACTTTAATTGGAACAAGTTTATTGTAAAGTCTGCGAGTTACAATGGATAGTAC TAGCGGACAAACTTTCGTTTCTGTGAACCTTTCTGACGAAAGCAACACAGCAAGTACTGCAGTTAGAACCGTAAGTTCGGAAGCTGAT CGCTTGGAATTTTTACGAAAAATGAACCCCTTTATCATCGACGCTTTGGTACGGAAAACCAATTATCAGGGTGCTCGCTTTCGCACAA AAATAATAGGAGTATGCGTAGATTGTGGTAGAAAACACGATAAGGGGTTGAAGACCGAACGTAAATGTAAGGTCAATAATACACAGTC TCAGAACGAGGTGGCGCATATGTTAATGCACGATCCCGTTAAGTATTTAAATAAAGGAAAGGCTAGAGCCTTTTCTAACGCAGAGATG TTTGCAATCGATTTGGTTATGTACACCAAGGAAAAGCAGTTGGCGGTTAATTTGGCCGCTGAAAGGGAGAAGACGAGACTGGCTCGTA GACACCCGATGCGTTCTCCGGAAGAAACTCCGGAATTCTATAAATTCGGTATAACTGCTAAAGCAACGTTACCGAACATCAACGCTGT GGACGTTGGTGATAACGAGGACACTTCGTCGGAGTACCCAGTGAGTCTGAGTGTTTCTGACGGAGTTCTCCGTGAACACCACTTCATC TGATTGAAGTGGACGGAATAAGTTCCTTGCGGAACTTTATGTCGGGTTGGTAAAAACCCTTATGATGGTGATGTATCACTAGACAATA ACCGGATGGGTAAAGTCTTTAAAATGATCGAGGGGAAAATTTAACCGTATCCTCTCGTTGGAATCGAATTCCCGCGGCCGCCATGGCG GCCGGAGCATGWRWTCCCKRGKTGGT
ANNEX III. Nucleotide alignment conservation
72
73
74
ANNEX IV. Amino acid alignment conservation
75
