www.nature.com/scientificreports
OPEN
received: 07 July 2015 accepted: 22 December 2015 Published: 19 February 2016
CMKLR1 deficiency maintains ovarian steroid production in mice treated chronically with dihydrotestosterone Mi Tang1,2,*, Chen Huang2,*, Yu-Fei Wang2,3, Pei-Gen Ren2, Li Chen2, Tian-Xia Xiao2, Bao-Bei Wang2, Yan-Fei Pan2, Benjamin K. Tsang5,6,7,8, Brian A Zabel4, Bao-Hua Ma1, Hui-Ying Zhao1 & Jian V. Zhang2 Elevated serum chemerin levels correlate with increased severity of polycystic ovary syndrome (PCOS). However, the role of CMKLR1 signaling in ovarian biology under conditions of excess DHT remains unclear. In this study we compared the effects of continuous 90-day high dose DHT exposure (83.3 □g/ day) on wild type and CMKLR1-deficient mice. DHT induced PCOS-like clinical signs in wild type mice as well as significant changes in the expression of hormone receptors, steroid synthesis enzymes, and BMPs and their receptors. In contrast, CMKLR1-deficient mice significantly attenuated DHT-induced clinical signs of PCOS and alterations in ovarian gene expression. To determine whether the BMP4 signaling pathway was involved in the pathogenic effects of CMKLR1 signaling in DHT-induced ovarian steroidogenesis, antral follicles were isolated from wild type and CMKLR1 knockout (KO) mice and treated in vitro with combinations of hCG, DHT, and BMP4 inhibitors. BMP4 inhibition attenuated the induction effects of hCG and DHT on estrogen and progesterone secretion in CMKLR1 KO mice, but not in WT mice, implicating the BMP4 signaling pathway in the CMKLR1-dependent response to DHT. In conclusion, CMKLR1 gene deletion attenuates the effects of chronic DHT treatment on ovarian function in experimental PCOS, likely via BMP4 signaling. In mammals, regular estrous cycles depend on highly regulated production of estrogen and progesterone, and the synthesis and secretion of estrogen and progesterone are dependent on the normal development of follicles and ovulation. Exposure to high concentrations of androgens can cause abnormal follicular development and estrogen and progesterone secretion disorders, leading to abnormal estrous cycles and constituting the symptoms of polycystic ovary syndrome (PCOS). Chemokine-like receptor-1 (CMKLR1), an orphan G-protein-coupled receptor (GPCR), is specifically expressed by monocyte-derived dendritic cells, macrophages, and circulating plasmacytoid dendritic cells (pDCs)1,2. Several groups have reported that CMKLR1 mRNA is also expressed in adipose tissue, liver, and the testes and ovaries of humans, rats, and mice1,3–5. The natural ligand for CMKLR1, chemerin, was recently discovered1,3,6. Chemerin has been isolated from ascitic fluid (ovarian carcinoma), inflamed synovial fluid, hemofiltrate, and normal serum. Chemerin was identified as a chemoattractant ligand for CMKLR13,6 but has also been found to be a novel adipokine associated with obesity and metabolic syndrome and to promote adipogenesis and regulate glucose metabolism3,4,7,8. 1
College of Veterinary Medicine, Northwest Sci-Tech University of A&F, Yangling, Shanxi, 712100, China. 2Research Laboratory for Reproductive Health, Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China. 3University of Science and Technology of China, An-Hui, He-Fei, 230026, China. 4Palo Alto Veterans Institute for Research, Veterans Affairs Palo Alto Health Care System, Palo Alto, CA, USA. 5Department of Obstetrics & Gynaecology, University of Ottawa, Ottawa, Ontario K1H 8L6, Canada. 6Chronic Disease Program, Ottawa Hospital Research Institute Ontario K1H 8L6, Canada. 7Department of Cellular & Molecular Medicine, University of Ottawa; Ottawa, Ontario K1H 8L6, Canada. 8Interdisciplinary School of Health Sciences, University of Ottawa, Ottawa, Ontario K1H 8L6, Canada. *These authors contributed equally to this work. Correspondence and requests for materials should be addressed to B.H.M. (email:
[email protected]) or H.Y.Z. (email: zhaohuiying@ nwsuaf.edu.cn) or J.V.Z. (email:
[email protected]) Scientific Reports | 6:21328 | DOI: 10.1038/srep21328
1
www.nature.com/scientificreports/ Serum chemerin levels are higher in obese women and in women with PCOS4,9, and metformin (a drug for the treatment of PCOS patients with insulin resistance) decreases serum chemerin levels9, implying a correlation between chemerin and PCOS10,11. In a rat model of PCOS, in which exposure to 5α -dihydrotestosterone (DHT)12 recapitulates the reproductive and metabolic phenotypes of human PCOS12, DHT treatment resulted in increased expression of chemerin and CMKLR1 in antral follicles13. Moreover, recombinant chemerin was found to suppress both basal estradiol secretion in granulosa cells from normal rats and FSH-induced progesterone and estradiol secretion in cultured preantral follicles and granulosa cells in vitro, suggesting the possible involvement of chemerin in the regulation of ovarian follicle growth and function. However, the role of chemerin and its receptor, CMKLR1, in follicular development and the pathogenesis of PCOS remains unclear13,14. BMP members are co-expressed in the ovary, and thecal interstitial cells are known to produce at least BMP4, BMP2, BMP7, and GDF1015–17 It has been reported that BMP4 inhibits progesterone synthesis and secretion in ovine ovarian and bovine granulosa cells but that it has no effect on estradiol18. Here, we hypothesize that androgen-induced ovarian follicular growth and function depends, in part, on increased expression and action of chemerin and the BMP4, ActR IIA, and Alk6 signaling pathways. In this study we used CMKLR1 knockout (KO) mice to investigate the role of the receptor in the DHT induction model of PCOS that mimics the reproductive and metabolic characteristics associated with the human disease19,20. We also used freshly isolated ovarian antrals from wild type and CMKLR1 KO mice to explore the intersecting molecular signaling pathways activated by hyperandrogenic stimulation.
Materials and Methods
Animals. CMKLR1 knockout mice in the C57BL/6J background were provided by Deltagen Ltd. and the Zabel lab21. C57BL/6J wild type female mice were obtained from the Laboratory Animal Center, Institutes of Biomedicine and Health, Chinese Academy of Sciences, China. The animals were housed at constant temperature and humidity under a 12-hour light-dark cycle. Chow and water were available ad libitum. All animal procedures were carried out in accordance with the approved guildellines by the Committee on the Use of Live Animals for Teaching and Research, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences. At postnatal d 19, mice of comparable body weights were randomly divided into two treatment groups (DHT and control; 10 per group) and were implanted s.c. with a 90-d DHT continuous-release pellet (Innovative Research of America, Sarasota, FL). These pellets contained 7.5 mg of DHT (daily dose, 83.3 μ g). Control mice received a placebo pellet. Mice were sacrificed at the end of the treatment period (90 d). Body weight was determined at the start and end of treatment. In addition, at the end of the 90-d treatment period, blood samples and tissues were collected. Blood samples were collected by orbital puncture after the mice were anesthetized with isoflurane. Ovaries and uteri were isolated, weighed, and fixed overnight in Bouin’s fluid. Gonadal fat depots were isolated and fixed overnight in 4% paraformaldehyde. In addition, isolated tissues were snap frozen in liquid nitrogen and stored at − 80 °C until further processing. Estrous Cycle determination. To determine stage in the estrous cycle, daily vaginal smears were taken 12 d before the animals were killed and examined.
Ovarian histology. For histological examination of ovarian morphology, fixed ovaries were embedded in paraffin. After routine histological procedures, 5 μ m sections were mounted on glass slides and stained with hematoxylin and eosin. Follicle counting was performed in serial ovarian sections. In brief, based on the mean diameters of the follicles, growing follicles were divided into four classes: small preantral (20–170 μ m), large preantral (171–220 μ m), small antral (221–310 μ m), and large antral (311 μ m). Non-atretic and atretic growing follicles were counted in every fifth section. Primordial follicles were counted in every second section. In addition, sections were examined for the presence of recent corpora lutea. TUNEL assay. Five μ m ovarian sections were mounted on glass slides, and the DNA Fragmentation Detection Kit (QIA 39, Calbiochem, Germany) was used to quantify DNA ends generated in response to apoptotic signals. Real-time PCR. Total RNA from tissues and cells was extracted using RNA iso Plus reagent and subjected
to real-time RT-PCR analysis. RNA samples (1 μ g) were reverse transcribed into cDNA according to the manufacturer’s instructions (Bio-Rad Laboratories, Hercules, CA). The PCR reaction mixtures contained 10 μ l SYBR Premix Ex TaqTM II (Takara, Japan), 500 nM of each primer, 1 μ l template cDNA, and DNase-free water to a final volume of 20 μ l. Cycle conditions were 95 °C for 10 sec, followed by 45 cycles of 95 °C for 5 sec, 60 °C for 30 sec, and 72 °C for 30 sec. The reaction was completed with a dissociation step for melting point analysis from 50 °C to 95 °C (in increments of 0.5 °C for 10 sec each). The primer sequences and their reference sequences are presented in Table 1. Gene expression levels were normalized to levels of β -actin using the Δ CT method, where CT was the cycle threshold. Melting curve analysis for each primer set revealed only one peak for each product. The size of the PCR products was confirmed by comparing the size of product with a commercial ladder after agarose gel electrophoresis
®
ELISA and RIA. DHT levels were measured with a DHT ELISA kit (Diagnostics Biochem Canada, Inc.,
London, Ontario, Canada). Progesterone, estradiol, LH, and FSH levels in sera were measured using commercial Iodine [125I] Radioimmunoassay Kits (Lareneen, GZ, China). The intra- and inter-assay errors among all assays were less than 10% and 15%, respectively.
Follicle culture. Superovulation was induced in 19-day-old immature female C57BL/6 J mice by intraperitoneal (i.p.) injection with 5 IU per mouse of pregnant mare serum gonadotropin (Sigma, PMSG). Large antral
Scientific Reports | 6:21328 | DOI: 10.1038/srep21328
2
www.nature.com/scientificreports/ Name
Sequence (5′-3′)
mouse Fabp4-Fw
AAGGTGAAGAGCATCATAACCCT
mouse Fabp4-Rev
TCACGCCTTTCATAACACATTCC
mouse Adiponectin-Fw
TGTTCCTCTTAATCCTGCCCA
mouse Adiponectin-Rev
CCAACCTGCACAAGTTCCCTT
Mouse Cidea-Fw
TGCTCTTCTGTATCGCCCAGT
Mouse Cidea-Rev
GCCGTGTTAAGGAATCTGCTG
Mouse PGC-1α -Fw
AGCCGTGACCACTGACAACGAG
Mouse PGC-1α -Rev
GCTGCATGGTTCTGAGTGCTAAG
Mouse PRDM16-Fw
CAGCACGGTGAAGCCATTC
Mouse PRDM16-Rev Mouse UCP1-Fw Mouse UCP1-Rev mouse Alk3 -Fw
GCGTGCATCCGCTTGTG ACTGCCACACCTCCAGTCATT CTTTGCCTCACTCAGGATTGG CCTGTTGTTATAGGTCCGTTCTT
mouse Alk3-Rev
AGCTGGAGAAGATGATCATAGCA
mouse Alk6 -Fw
GGAAGACTCAGTCAACAATATCTGC
mouse Alk6-Rev
CTAGTCCTAGACATCCAGAGGTGAC
mouse ActRIIA -Fw
GTTGAACCTTGCTATGGTGATAA
mouse ActRIIA-Rev
AATCAGTCCTGTCATAGCAGTTG
mouse BMPRII-Fw
AGCTGACAGAAGAAGACTTGGAG
mouse BMPRII-Rev
CAAGCTAGAACTGGTACTGCTCA
mouse bmp2 -Fw
ACTTTTCTCGTTTGTGGAGC
mouse bmp2-Rev
GAACCCAGGTGTCTCCAAGA
mouse bmp4 -Fw
GAGGAGGAGGAAGAGCAGAG
mouse bmp4-Rev
TGGGATGTTCTCCAGATGTT
mouse bmp6 -Fw
AACCTTTCTTATCAGCATTTACCA
mouse bmp6 -Rev
GTGTCCAACAAAAATAGGTCAGAG
mouse bmp7 -Fw
GGGCTTACAGCTCTCTGTGG
mouse bmp7 -Rev
TGAAGGGTTGCTTGTTCTGG
Mouse- StAR-fw
CCGGGTGGATGGGTCAA
Mouse- StAR-Rev
CACCTCTCCCTGCTGGATGTA
Mouse-P450scc-Fw
CCATCAGATGCAGAGTTTCCAA
Mouse-P450scc-Rev
TGAGAAGAGTATCGACGCATCCT
Mouse-3β -HSD-Fw
GGAGGCCTGTGTTCAAGCAA
Mouse-3β -HSD-Rev
GGCCCTGCAACATCAACTG
mouse estrogen receptor alpha-Fw
CCTCCCGCCTTCTACAGGT
mouse estrogen receptor alpha-Rev
CACACGGCACAGTAGCGAG
mouse estrogen receptor beta-Fw
CTGTGATGAACTACAGTGTTCCC
mouse estrogen receptor beta-Rev
CACATTTGGGCTTGCAGTCTG
mouse androgen receptor-Fw
CTGGGAAGGGTCTACCCAC
mouse androgen receptor-Rev
GGTGCTATGTTAGCGGCCTC
mouse progesterone receptor-Fw
CTCCGGGlACCGAACAGAGT
mouse progesterone receptor-Re
ACAACAACCCTTTGGTAGCAG
mouse beta-Actin-Fw
GTATCCATGAAATAAGTGGTTACAGG
mouse beta-Actin-Re
GCAGTACATAATTTACACAGAAGCAAT
Table 1. primers list.
follicles of > 300 μ m diameter were isolated 48 h post-PMSG treatment. Ovarian follicles were isolated in ice-cold normal saline with a dissecting microscope and two 26 gauge 1/2 inch syringe needles and pre-incubated at 37 °C in 24-well plates (3 follicles per well) containing DMEM/F12-0.1% BSA. The follicles were then treated with 0.01 IU/ml hCG or 1 μ g/mL DAN (D2066, Sigma) in the presence of 1 μ M DHT for 24 h. Conditioned media were collected for progesterone and estradiol measurement. Follicles were lysed for real-time PCR analysis.
Statistics. Data were statistically analyzed by Duncan’s multiple range test for individual comparison repeated measures ANOVA, or two-way ANOVA (adipocyte size distribution), using SPSS 15.0 (SPSS, Inc., Chicago, IL). Data are expressed as means ± SEM, and differences were considered significant at p
