Columba livia

Veterinary Parasitology 175 (2011) 9–14

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Chlamydophila psittaci and Toxoplasma gondii infection in pigeons (Columba livia) from São Paulo State, Brazil Vanessa Yuri de Lima a,b,c,∗ , Helio Langoni b , Aristeu Vieira da Silva d , Sandia Bergamaschi Pezerico b , André Peres Barbosa de Castro b , Rodrigo Costa da Silva b , João Pessoa Araújo Jr. c a b c d

School of Veterinary Medicine, Pontifical Catholic University, Toledo, Paraná State, Brazil School of Veterinary Medicine and Animal Science, São Paulo State University, Botucatu, São Paulo State, Brazil Institute of Biosciences, São Paulo State University, Botucatu, São Paulo State, Brazil Department of Biological Sciences, The State University of Feira de Santana, Feira de Santana, Bahia State, Brazil

a r t i c l e

i n f o

Article history: Received 22 October 2009 Received in revised form 4 October 2010 Accepted 6 October 2010 Keywords: Columba livia Chlamydophila psittaci Toxoplasma gondii Zoonosis Infection source Diagnosis

a b s t r a c t Pigeons (Columba livia) cohabit with humans in urban and rural areas, representing a public health problem since microorganisms are transmitted through the inhalation of dust from their dry feces (chlamydiosis) and through ingestion of their undercooked or poorly refrigerated meat (toxoplasmosis). This study aimed to evaluate the presence of Chlamydophila psittaci and Toxoplasma gondii in pigeons from four cities in São Paulo State, Brazil. C. psittaci was evaluated through hemi-nested polymerase chain reaction (hnPCR) using cloacal and tracheal swabs, whereas T. gondii specific antibodies were assessed by means of modified agglutination test (MAT), mouse brain and muscle bioassay, and polymerase chain reaction (PCR). To confirm the infection in mice, T. gondii antibodies were assayed by using indirect fluorescent antibody test (IFAT). Considering C. psittaci, 40/238 (16.8%; 95%CI 12.6–22.1%) samples were positive according to hnPCR, especially for the cities of São Paulo (42.5%) and Bauru (35%). As regards T. gondii, 12/238 (5%; 95%CI 2.9–8.6%) serum samples were positive according to MAT. Of these, five samples had titer equal to 1:8; six samples, 1:16; and one sample, 1:32. Bioassay, IFAT and PCR were negative for mouse toxoplasmosis. The absence of T. gondii antibodies suggests that pigeons may be infected with a low concentration of the agent, not detected by the antigen test. Thus, C. psittaci represents an actual problem concerning bird health. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Pigeons (Columba livia) cohabit with humans in urban and rural areas and are capable of adapting to and surviving in the city, which results in large populations and con-

∗ Corresponding author at: Departamento de Higiene Veterinária e Saúde Pública, Faculdade de Medicina Veterinária e Zootecnia, Universidade Estadual Paulista, Distrito de Rubião Jr., s/n., Botucatu, SP 18618-000, Brazil. Tel.: +55 14 38116270; fax: +55 14 38116075. E-mail address: [email protected] (V.Y. de Lima). 0304-4017/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2010.10.006

sequently serious public health problems. Accumulation of their feces in shelters and procreation sites generates dirt and damage to constructions and monuments (Haag-Wackernagel, 2003). Primary problems include public health due to diseases transmitted through inhalation of their dry feces or contact with their moist feces, feet and feathers in case of histoplasmosis, cryptococcosis and chlamydiosis. Transmission also occurs through ingestion of poorly refrigerated and raw meat in case of toxoplasmosis and salmonellosis (São Paulo, 2003). Chlamydophila psittaci is an obligate intracellular parasite which causes chlamydiosis (Everett et al., 1999), an

10

V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14

infectious disease that globally affects humans, as well as domestic and wild birds, its main reservoirs (Grimes, 1996; Carpenter and Gentz, 1997; Kirchner, 1997). Pigeons are frequently infected by C. psittaci and can eliminate infectious forms named elementary bodies (EBs) either in secretions from their cloaca, upper and lower respiratory tract and eyes (Calnek et al., 1997), or in aerosol originated from such secretions. Transmission occurs through inhalation or ingestion of C. psittaci (Illner, 1962; Lehnert, 1962; Wilt et al., 1972; Wittenbrink et al., 1993; Lublin et al., 1996). Toxoplasmosis is caused by an Apicomplexan parasite, Toxoplasma gondii, and represents another important zoonosis reaching one-third of the human population worldwide (Dubey and Beattie, 1988; Martins and Viana, 1998). Warm-blooded animals are affected by ingesting contaminated feline feces and raw or undercooked meat, as well as transplacentally (Tenter and Johnson, 1997). This parasite can be detected in most organs of birds (Dubey et al., 2008; Oliveira et al., 2009) such as pigeons, as demonstrated by Dubey (2002). The risk to humans is high and directly related to customs and hygiene habits since the infection occurs by accidental ingestion of the parasite. Thus, the present study aimed to determine the importance of pigeons as precursors of these two important zoonoses. 2. Materials and methods 2.1. Experimental design This study was designed as observational, transversal and descriptive, employing high-sensitivity methods to detect C. psittaci and T. gondii among pigeon populations from different habitats. Serology and mouse bioassay were carried out in the labs of the Zoonosis Research Center, Department of Veterinary Hygiene and Public Health (DHVSP), School of Veterinary Medicine and Animal Science (FMVZ), São Paulo State University (UNESP), Botucatu Campus, São Paulo State, Brazil. The molecular detection of microorganisms was carried out in the labs of the Institute of Biosciences, located in the same university. This experiment was approved by the Animal Experimentation Ethics Committee of FMVZ. 2.2. Animals and strains Pigeons (Columba livia) were captured from different sites for the epidemiological study based on T. gondii and C. psittaci detection. Female 30-day-old Swiss albino mice, from Central Animal Facility of UNESP-Botucatu were used to produce home-made antigens for serological tests and bioassay of pigeon samples. T. gondii RH strain, genotype I, was kept by weekly inoculation into Swiss albino mice and was used for the serological test and molecular technique as T. gondii positive control. The antigen Dade Behring (Germain) was used as C. psittaci positive control.

2.3. Sample size and studied area Two hundred and thirty-eight pigeons were captured from four cities in São Paulo State, Brazil: Bauru (22◦ 18 53S; 49◦ 03 38W), 51; São Paulo (23◦ 32 51S; 46◦ 38 10W), 45; Sorocaba (23◦ 30 06S; 47◦ 27 29W), 44; and Botucatu (22◦ 53 09S; 48◦ 26 42W), 98. In Bauru, São Paulo and Sorocaba, the birds were captured from zoo areas, whereas in Botucatu they were captured from public squares and from large and small farms (Table 1). Pigeons were captured by using home-made traps disposed in places where their concentration was high. The birds were manually restrained and euthanized by using the lethal dose of 2% pentobarbital solution after sample collection, which requires live animals. Blood samples were collected and serum samples kept at −20 ◦ C until serological tests. A total of 476 cloacal and tracheal swab samples were assayed for C. psittaci identification. These samples were vortexed and kept in ethyl alcohol for up to 30 days. For T. gondii, chest muscle and brain samples were collected, refrigerated and processed up to 48 h; spleen samples were kept at −80 ◦ C until molecular detection. 2.4. Chlamydophila psittaci test For DNA extraction from cloacal and tracheal swabs, the tubes were centrifuged at 20,000 × g for 30 min at 4 ◦ C; then, ethyl alcohol was removed and the pellet diluted into 40 ␮L buffer (0.1 M NaCl, 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 5% triton X-100) and 15 ␮L proteinase K (20 mg mL−1 ). After digestion at 56 ◦ C for 90 min and proteinase K inactivation for 5 min at 70 ◦ C, samples were centrifuged (2000 × g) for 20 min at 22 ◦ C and the cloacal and tracheal supernatants from the same animals were mixed, totaling 238 samples. DNA was extracted by using GFXTM Genomic Blood DNA Purification Kit (Amersham Bioscience, USA) following the manufacturer’s instructions. Hemi-nested (hn) PCR was done according to Buxton et al. (1996) directed to C. psittaci major outer membrane protein (MOMP) gene, M36703.1 [GenBank]; 5 ␮L cDNA pool for PCR and 1 ␮L of the PCR product for the hnPCR were added to a reaction buffer (50 mM KCl, 75 mM Tris–HCl (pH 9.0), with 0.2 mM MgCl2 , 20 mM (NH4)2 SO4 ), plus 0.1 mM dNTPs, 0.1 mM of each dNTP, 0.1 ␮M of each primer: cla420 107–129 (5 CAGGACATCTTGTCTGGCTTTAA3 ) and cla422 349–366 (5 GCAAGGATCGCAAGGATC3 ) for PCR, amplifying a 260 bp product, and cla421 202–225 (5 TTAGAGGTGAGTATGAAAAAACTC3 ) and cla422 for hnPCR, amplifying a 165 bp product; 1 U Tth DNA Polymerase (Biotools, Spain) and autoclaved ultrapure water to a final volume of 25 ␮L. The cycles in thermal cycler included denaturation at 94 ◦ C for 10 min followed by 35 cycles of denaturation for 60 s at 94 ◦ C; primer annealing for 60 s at 54 ◦ C for PCR and 52 ◦ C for hnPCR; extension at 72 ◦ C for 90 s; and a final step of primer extension at 72 ◦ C for 4 min. The reaction product was kept at 4 ◦ C. The reaction mixture (10 ␮L) was subjected to agarose gel electrophoresis with Tris–bromide EDTA buffer and 0.5 ␮g mL−1 ethidium bromide. The final products were

V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14

11

Table 1 Description of habitats where pigeons were captured per city. City

Area

Place

Number of captured animals

Zoo/non-zoo

Public squarea

6

Non-zoo

Residential areab

21

Non-zoo

Rural area

University building University farm

35 36

Non-zoo Non-zoo

Urban area Urban area Urban area

Municipal zooc Municipal zooc Municipal zooc

51 45 44

Zoo Zoo Zoo

Urban area Botucatu

Bauru São Paulo Sorocaba

Habitat epidemiological characteristics

Presence of a church, bus stop station and public high school in front of the church. Traffic of many people all day long, some of them eating corn grains, crushed grains, popcorn and bread commercialized in this area. Houses with a strip of land and sand ground behind the houses with chicken breed. These places were dirt and accumulated garbage. In front of one commercial residence (pet food store), a great amount of pigeons were captured. Pigeons were observed eating dog and cat food from this store. Animals were captured near breeding animal Nests of pigeons were observed in the lining of farms. These linings were very dirt. All zoos presented similar epidemiological conditions. Pigeons were captured in iron grating enclosures located far from healthy animals. These places were empty, but in a normal day, they were used for quarantine or isolation to treat zoo animals.

a

Public square located in the commercial center of Botucatu. Residential houses with high amount of pigeons per day. c São Paulo’s zoo is larger than Bauru’s, which is bigger than Sorocaba’s. According to the size, the zoos present large or small numbers of people and pigeons, the latter looking for food, resulting in popcorn and pigeon’s feces on the soil. b

observed in UV light gel analyzer and compared to 50 bp DNA Ladder (Amersham Bioscience, USA). Samples were considered positive when a final 165 bp product was obtained in hnPCR. 2.5. Toxoplasma gondii tests 2.5.1. Serology of pigeons All pigeon serum samples were assayed through modified agglutination test (MAT) with formalin-fixed tachyzoites, homely produced in female 30 day-old Swiss mice inoculated with the T. gondii RH strain and Sarcoma TG-180 cells (ATCC CCRFS-180 II), as described by Desmonts and Remington (1980). Serum samples were initially tested in 1:2 and 1:4 dilutions, and samples that showed titers equal to 1:8 were further diluted in duplicates, until the final titer. Positive and negative controls were also used. Samples presenting titers equal or superior to 1:8 were considered positive. No replicates were done. This was used as a screening test for PCR. 2.5.2. Mouse bioassay Bioassay procedures were based on those described by Dubey (1998), including 211 muscle and brain samples. Twenty-seven animals did not have sufficient tissue for all tests. One millilitre of digested brain and muscle samples from each rat, with pepsin solution, were independently bioassayed in groups of five albino Swiss mice by subcutaneous route; they were observed for up to 30 days. Animals that died during the observation period were researched for the presence of tachyzoites in the peritoneal fluid or tissue cysts in the brain. After 30 days p.i., mice were euthanized in an isofluorane vapor-saturated chamber and blood samples were obtained through orbital sinus punc-

ture followed by centrifugation. The serum samples were assayed through indirect fluorescent antibody test (IFAT) for IgG antibodies, using a home-made antigen produced in female Swiss mice inoculated with T. gondii RH strain and mouse IgG (h&l) antibody chicken FITC conjugated, A90-217F (Bethyl Laboratories, USA). Serum samples were screened in 1:16 dilution. Positive and negative controls were also used (Camargo, 1964). 2.5.3. Polymerase chain reaction (PCR) Twelve spleen samples from positive animals and twelve samples from negative animals were used for PCR. DNA was extracted from fragments sized about 1/3 of the whole spleen, according to the protocol described by Sambrook and Russel (2001). PCR was performed by using the primers described by Homan et al. (2000), which amplify a 529 bp fragment, AF146527 [GenBank], repeated 200–300 times in T. gondii genome. Thus, primers TOX4 (5 CGCTGCAGGGAGGAAGACGAAAGTTG3 ) and TOX5 (5 CGCTGCAGACACAGTGCATCTGGATT3 ) were used. PCR was performed in a 25 ␮L reaction mixture containing 10 ␮M of each primer (Invitrogen, Brazil), 10× PCR buffer (50 mM KCl, 10 mM Tris–HCl, Invitrogen, Brazil), 1.5 mM MgCl2 (Invitrogen, Brazil), 1.25 mM dNTP (Invitrogen, Brazil), 0.15 U Platinum Taq polymerase (Invitrogen, Brazil), and ultrapure water q.s. Amplification was performed in a MJ Research Thermal Cycler (MJ Research Inc., USA). Initial denaturation for 7 min at 94 ◦ C was followed by 35 cycles of 1 min at 94 ◦ C, 1 min at 60 ◦ C and 1 min at 72 ◦ C, and a final extension for 10 min at 72 ◦ C. The sequence was visualized through electrophoresis in 2% agarose gel and stained with ethidium bromide. Crossreaction was not reported using TOX4 and TOX5 primers during T. gondii PCR, according to Homan et al. (2000).

12

V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14

Table 2 Frequency of Chlamydophilla psittaci detected through hnPCR per city. City

Positive/total

City percentage; 95%CI

Total frequency; 95%CI

Bauru Botucatu Sorocaba São Paulo Total

14/51 6/98 3/44 17/45 40/238

27.4; 17.1–41.0 6.1; 2.9–12.7 6.8; 2.5–18.3 37.8; 25.1–52.4 16.8; 12.6–22.1

35.0; 22.1–50.6 15.0; 7.2–29.2 7.5; 2.7–19.9 42.5; 28.5–57.9 100.0; -

95%CI: confidence interval 95%.

2.6. Statistical analysis C. psittaci positive results were compared among the studied cities by using Chi-Square test with 95% confidence interval and ˛ = 0.05 (Triola, 1999). 3. Results As shown in Table 2, 40/238 (16.8%; 95%CI 12.6–22.1%) samples were positive for C. psittaci according to hnPCR: 14/51 (27.4%; 95%CI 17.1–41.0%) in Bauru, 17/45 (37.8%; 95%CI 25.1–52.4%) in São Paulo, 3/44 (6.8%; 95%CI 2.5–18.3%) in Sorocaba, and 6/98 (6.1%; 95%CI 2.9–12.7%) in Botucatu. Considering T. gondii, 12/238 (5%; 95%CI 2.9–8.6%) samples were positive according to MAT: five had titer equal to 1:8; six, 1:16; and one, 1:32. All 211 pigeons were negative according to mouse bioassay and IFAT, while all 24 samples were negative according to PCR. 4. Discussion The distinct frequencies of pigeons positive for C. psittaci in São Paulo State, Brazil, corroborate previous findings around the world (Grelloni et al., 1997; Andersen et al., 1997; Cislakova et al., 1998; Travnicek and Misko, 2000; Mushi et al., 2001; Travnicek et al., 2002). In previous studies carried out in our laboratory, separate tracheal and cloacal swab extractions had no difference (data not shown) since all animals with positive tracheal swab samples also had positive cloacal swabs, according to hnPCR. Based on such results, separate extraction was not adopted to avoid compromising the results. hnPCR was chosen, rather than serology, due to its high sensitivity and specificity for DNA sequence detection. hnPCR is a rapid and easy-to-perform diagnostic test because it does not require the live agent (OIE, 2000) and is capable of detecting ten EBs (Dahlhausen and Radabaugh, 1997), demonstrating its high sensitivity. Olsen et al. (1998) used PCR to test fecal samples and found 9/312 (2.89%) positive birds in Sweden. McElnea and Cross (1999) also used PCR as one of the methods for C. psittaci detection in domestic and wild birds and observed 16% positive samples among captured birds with no clinical signs of illness, similarly to the present study (16.8%). These findings assure the importance of birds, especially pigeons, as C. psittaci-carriers in Brazil. Most diagnostic tests present problems concerning antibody and antigen detection, leading to false-positive and false-negative results (Dahlhausen and Radabaugh, 1997). Mushi et al. (2001) reported 7/16 (43.8%) C. psittacipositive pigeon samples by using complement fixation.

Even with high positive percentage, small samples must be considered in the test assessment and adoption of epidemiological measures. However, the detection of antibodies can reflect their ability to contaminate the environment. The frequencies of positive results for C. psittaci obtained in São Paulo, 17/45 (37.7%), and in Bauru, 14/51 (27.4%), were statistically different from those detected in Botucatu, 6/98 (6.1%), and Sorocaba, 3/44 (6.8%). São Paulo (42.5%) and Bauru (35%) accounted for 77.5% of the positive results (Table 2), since these are big cities presenting a large number of free pigeons. The different frequencies among the studied cities could be attributed to other birds or wild hosts especially from the rural area of Botucatu, different habitats in different studied areas, or cohabitation in zoo areas. In addition, the high frequencies found for these cities are mostly related to the cohabitation of pigeons with other hosts that can be sources of infection. The zoo in São Paulo is larger than that of Bauru and other cities, presenting higher circulation of people per day, food on the soil, and consequently attracting pigeons. On the other hand, pigeons from Sorocaba (also from a zoo area) did not have high positive percentage probably due to the animal care program, the cleaning, and the restrictive access of pigeons in the zoo. The scenario observed in the zoos of Bauru and São Paulo is of public health concern. A high visitation rate in these places increases the risk of exposure of visitors to infected animals or pigeons, which play an important role as infection transmitters to zoo animals. Since pigeons have free access to these places, they can contaminate exotic animals of inestimable value, causing their death. Therefore, a high amount of pigeon feces accumulates and exposes other hosts to C. psittaci infection, mainly in zoos. Thus, urban pigeons are more susceptive than rural ones, as observed in areas from Botucatu, which was the only city where birds were not captured from zoos. In this city, the frequency of positive samples was low, except in commercial places like in front of pet food store and public churches. However, these results are also of concern since the microorganism was found and contamination and dissemination are possible due to the proximity to other birds. The presence of C. psittaci in the samples of this study confirms the pigeon potential to carry and transmit the agent. As a result, the agent is kept in the environment and can be transmitted to other susceptible animals and humans. As regards T. gondii, 5% serum samples were positive, all from Botucatu. This prevalence was similar to that obtained by Waap et al. (2008) (4.8%) in Lisbon, Portugal and higher than that observed by Godoi et al. (2008) in Sorocaba, Brazil. All samples were negative for antigen diagnosis, as

V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14

reported by Godoi et al. (2008) using bioassay; however, the obtained percentages were lower than those obtained by Waap et al. (2008) (12/23; 52.17%) using PCR. Despite the lack of epidemiological knowledge concerning this agent in the studied bird species and the small number of studies in Brazil, the role of pigeons as potential carriers of this microorganism to humans is known in other countries. Its diagnosis is based on clinical signs and serological tests, besides the presence of the agent in tissues or body fluids (Dubey and Frenkel, 1998). Since pigeons usually present more subclinical infections, the association between clinical signs and positive serology or the agent detection is compromised (Dubey and Beattie, 1988), requiring tests of high sensitivity such as PCR and biological tests for diagnosis. Mouse inoculation is very specific and sensitive for parasite isolation (Wong and Remington, 1994); however, the prolonged time to confirm results is certainly an important disadvantage. IFAT should not be considered the ultimate diagnosis since T. gondii has already been isolated from seronegative mice (Dubey and Frenkel, 1998). Mouse inoculation is still considered the gold-standard method due to its high sensitivity and specificity (Homan et al., 2000). However, in Botswana, Mushi et al. (2001) obtained 16/16 (100%) positive results for T. gondii diagnosis using MAT. This result should be carefully analyzed since T. gondii cannot be diagnosed only through serological tests, as previously described. Marca et al. (1996) compared IFAT and MAT and concluded that they are indicated for toxoplasmosis diagnosis since both tests had similar results, presenting high importance for diagnosis and epidemiological tests (Desmonts and Remington, 1980; Dubey et al., 1997). The use of molecular diagnostic techniques is particularly appropriate for patients presenting subclinical infections since these techniques do not depend on the host immunological status. However, since the immune response plays a very important role in the development of toxoplasmosis, several studies have emphasized the hypothesis that the outcome and the clinical presentation are also related to the virulence of specific T. gondii genotypes (Sibley and Boothroyd, 1992; Boothroyd and Grigg, 2002; Dubey et al., 2008). All 24 samples tested through PCR were negative. These results show the reduced risk of infection in the studied area due to the food provided to pigeons, differently from the risk reported by Waap et al. (2008). In zoo areas, free pigeons eat the food of captive animals. In addition, most people from Botucatu feed pigeons corn grains, crushed corn and bread; consequently, the probability of infection is lower. The risk of transmission of these zoonoses apparently increases due to the proximity between birds and the human population, since the former are important disseminating agents. An educational policy should be elaborated in order to aware people about the importance of not feeding and not sheltering these birds, promoting their evasion and probably making them return to their natural habitat. Thus, the low prevalence of T. gondii antibodies in all studied cities suggests that pigeons are not a good source of toxoplasmosis to humans. On the other hand, C. psittaci represents a real problem for bird health.

13

References Andersen, A.A., Grimes, J.E., Wyrick, P.B., 1997. Chlamydiosis (Psittacosis, ornithosis). In: Calnek, B.W., Barnes, H.J. (Eds.), Diseases of Poultry, 10th ed. Iowa State University Press, Iowa, pp. 333–349. Boothroyd, C.J., Grigg, M.E., 2002. Population biology of Toxoplasma gondii and its relevance to human infection: do different strains cause different disease? Current Opinions in Microbiology 5, 438–442. Buxton, D., Rae, A.G., Maley, S.W., Thomson, K.M., Livingtone, M., Jones, G.E., Herring, A.J., 1996. Pathogenesis of Chlamydia psittaci infection in sheep: detection of the organism in a serial study of the lymph node. Journal of Comparative Pathology 114, 221–230. Calnek, B.W., Barnes, H.J., Beard, C.W., McDougald, L.R., Saif, Y.M., 1997. Diseases of Poultry, 11th.ed. Iowa State University Press, Iowa, p. 1248. Camargo, M.E., 1964. Improved technique of indirect immunofluorescence for serological diagnosis of toxoplasmosis. Revista do Instituto de Medicina Tropical de São Paulo 6, 117–118. Carpenter, J.W., Gentz, E.J., 1997. Zoonotic diseases of avian origin. In: Altman, R.B., Clubb, S.L., Dorrestein, G.M., Quesenberry, K. (Eds.), Avian Medicine and Surgery. Saunders, Philadelphia, pp. 350–363. Cislakova, L., Prokopcakova, H., Dietzova, Z., 1998. Ornithosis of municipal pigeons Columba livia f. domestica gone wild in Kosice – Slovak Republic. Veterinarni Medicina UZPI 43, 361–363. Dahlhausen, B., Radabaugh, C.S., 1997. Detection of Chlamydia psittaci infection in pet birds using a molecular based diagnostic assay. In: Association of Avian Veterinarians Proceedings, pp. 191–198. Desmonts, G., Remington, J.S., 1980. Direct agglutination test for diagnosis of Toxoplasma infection: method for increasing sensitivity and specificity. Journal of Clinical Microbiology 11, 562–568. Dubey, J.P., Beattie, C.P., 1988. Toxoplasmosis of Animals and Man. CRC Press, Boca Raton, p. 220. Dubey, J.P., Andrews, C.D., Thulliez, P., Lind, P., Kwok, O.C.H., 1997. Longterm humoral antibody responses by various aerologic tests in pigs orally inoculated with oocysts of four strains of Toxoplasma gondii. Veterinary Parasitology 68, 41–50. Dubey, J.P., 1998. Refinement of pepsin digestion method for isolation of Toxoplasma gondii from infected tissues. Veterinary Parasitology 74, 75–77. Dubey, J.P., Frenkel, J.K., 1998. Toxoplasmosis of rats: a review, with considerations of their value as an animal model and their possible role in epidemiology. Veterinary Parasitology 77, 1–32. Dubey, J.P., 2002. A review of toxoplasmosis in wild birds. Veterinary Parasitology 106, 121–153. Dubey, J.P., Velmurugan, G.V., Chockalingam, A., Pena, H.F.J., de Oliveira, L.N., Leifer, C.A., Gennari, S.M., Bahia Oliveira, L.M.G., Su, C., 2008. Genetic diversity of Toxoplasma gondii isolates from chickens from Brazil. Veterinary Parasitology 157, 299–305. Everett, K.D.E., Bush, R.M., Andersen, A.A., 1999. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the indentification of organisms. International Journal of Systematic Bacteriology 49, 415–440. Godoi, F.S.L., Rassy, F.B., Viero, L.M., Nishi, S.M., Gennari, S.M., 2008. Toxoplasma gondii in free-range pigeons captured in Sorocaba, SP. Preliminary results. In: Toxoplasma Centennial Congress, 1. UENF, Búzios, Brazil, p. 105. Grelloni, V., Cagiola, M., Battistacci, L., Cenci, T., Scuota, S., Principato, M., 1997. Epidemiology of zoonotic diseases in the urban environment due to pigeons (Columba livia). Veterinaria Italiana 33, 41–45. Grimes, J.E., 1996. Detection of chlamydial infections. In: Rosskopf Jr., W.J., Woerpel, R.W. (Eds.), Diseases of Cage and Aviary Birds. Willians and Wilkins, Malvern, pp. 827–835. Haag-Wackernagel, D., 2003. Os pombos silvestres: história, problemas e soluc¸ões. Der Ornithologische Beobachter 100, 33–57. Homan, W.L., Vercammen, M., De Braekeleer, J., Verschueren, H., 2000. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. International Journal for Parasitology 30, 69–75. Illner, F., 1962. Ein beitrag zur enten-ornithose und ihrer epizootioogie. Monatsh Veterinaermed 17, 141–146. Kirchner, J.T., 1997. Psittacosis is contact with birds causing your patient’s pneumonia? Psittacosis 102, 181–194. Lehnert, C., 1962. Zur frage der uebertragung dez ornithosevirus ueber das brutei bei enten. Berliner und Munchener Tierarztliche Wochenschrift 75, 151–152. Lublin, A., Shudari, G., Mechani, S., Weisman, Y., 1996. Egg transmission of Chlamydia psittaci in turkeys. Veterinary Record 139, 300.

14

V.Y. de Lima et al. / Veterinary Parasitology 175 (2011) 9–14

Marca, M.C., Ramos, J.J., Porte, A., Sáez, T., Sanz, M.C., 1996. Comparison of indirect immunofluorescent antibody test and modified direct agglutination test methods for detection of Toxoplasma gondii antibodies in adult sheep in Spain. Veterinary Parasitology 67, 99–103. Martins, C.S., Viana, J.A., 1998. Toxoplasmose—o que todo profissional de saúde deve saber. Revisão. Clínica Veterinária 3 (15), 33–37. McElnea, C.L., Cross, G.M., 1999. Methods of infection of Chlamydia psittaci in domesticated and wild birds. Australian Veterinary Journal 77, 516–521. Mushi, E.Z., Binta, M.G., Chabo, R.G., Ndebele, R., Panzirah, R., 2001. Seroprevalence of Toxoplasma gondii and Chlamydia psittaci in domestic pigeons (Columba livia domestica) at Sebele, Gaborone, Botswana. Onderstepoort Journal of Veterinary Research 68, 159–161. OIE, 2000. World Organisation for Animal Health. Manual of Standards. Diagnostic Tests and Vaccines. OIE Avian Chlamydiosis (part 2, section 2.7, chapter 2.7.4). Oliveira, L.N., Costa Junior, L.M., De Melo, C.F., Ramos Silva, J.C., Bevilaqua, C.M., Azevedo, S.S., Muradian, V., Araújo, D.A., Dubey, J.P., Gennari, S.M., 2009. Toxoplasma gondii isolates from free-range chickens from the northeast region of Brazil. Journal of Parasitology 95, 235–237. Olsen, B., Persson, K., Broholm, K.A., 1998. PCR detection of Chlamydia psittaci in faecal samples from passerine birds in Sweden. Epidemiology and Infection 121, 481–484. Sambrook, J., Russel, D.W., 2001. Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York. São Paulo, 2003. Centro de Controle de Zoonoses. Prefeitura Municipal de São Paulo. Animais sinatrópicos. Available online: http://www.portal.prefeitura.sp.br Accessed in 20.06.08.

Sibley, L.D., Boothroyd, C.J., 1992. Virulent strains of T. gondii comprise a single clonal lineage. Nature 359, 82–85. Tenter, A.M., Johnson, A.M., 1997. Phylogeny of the tissue cyst-forming coccidia. Advances in Parasitology 39, 70–139. Travnicek, M., Cislakova, L., Deptula, W., Stosik, M., Bhide, M.R., 2002. Wild pigeons and pheasants a source of Chlamydophila psittaci for humans and animals. Annals of Agricultural and Environmental Medicine 9, 253–255. Travnicek, M., Misko, J., 2000. Presence of antibody to Chlamydia psittaci in farm-managed, Phasianus colchicus and pigeons, Columba livia f. domestica. Veterinarni-Medicina-UZPI 45, 149–151. Triola, F., 1999. Introduc¸ão a estatística, 7th ed. LTC livros técnicos e científicos, Rio de Janeiro, p. 410. Waap, H., Vilares, A., Rebelo, E., Gomes, S., Ângelo, H., 2008. Epidemiological and genetic characterization of Toxoplasma gondii in urban pigeons from the area of Lisbon (Portugal). Veterinary Parasitology 157, 306–309. Wilt, P.C., Kordova, N., Wilt, J.C., 1972. Preliminary characterization of a chlamydial agent isolated from embryonated snow goose eggs in northern Canada. Canadian Journal of Microbiology 18, 1327– 1332. Wittenbrink, M.M., Mrozek, M., Bisping, W., 1993. Isolation of Chlamydia psittaci from a chicken egg: evidence of egg transmission. Journal of Veterinary Medicine B 40, 451–452. Wong, S.Y., Remington, J.S., 1994. Toxoplasmosis in pregnancy. Clinical Infectious Diseases 18, 853–862.