Comparison of a quantitative PCR method with FISH for the ...

Leukemia (2007) 21, 1460–1463 & 2007 Nature Publishing Group All rights reserved 0887-6924/07 $30.00 www.nature.com/leu

ORIGINAL ARTICLE Comparison of a quantitative PCR method with FISH for the assessment of the four aneuploidies commonly evaluated in CLL patients C Bastard1, G Raux2, C Fruchart3, F Parmentier1, D Vaur3, D Penther1, X Troussard4, D Nagib4, S Lepretre1, M Tosi2, T Frebourg2 and H Tilly1 1 3

Groupe d’Etude des Prolife´rations Lymphoı¨des, Centre Henri Becquerel, Rouen, France; 2INSERM U614, IFR23, Rouen, France; De´partement d’He´matologie, Centre Franc¸ois Baclesse, Caen, France and 4Laboratoire d’he´matologie, CHU, Caen, France

Four chromosomal defects associated with outcome are commonly evaluated by fluorescent in situ hybridization (FISH) in chronic lymphocytic leukemia (CLL), namely deletions of the 13q13-q14, 11q22 and 17p13 regions and trisomy 12. In this study, we compared a quantitative PCR method – quantitative multiplex PCR of short fluorescent fragment (QMPSF) – with FISH for the detection of these acquired aneuploidies in a series of 110 patients with Binet stage A CLL. Genes located in the deleted or gained regions were selected as target genes and amplified using a method based on the simultaneous amplification of short fluorescent genomic fragments under quantitative conditions. A chromosomal imbalance involving one or several of the four loci was detected by either method in 72 patients (65%). A chromosome 13 deletion was present in 61 patients (54%), a 11q22 deletion in nine (8%), a trisomy 12 in nine and a 17p deletion in one. FISH and QMPSF results were identical for 103 out of 110 patients and discrepancies could be explained in most cases. This study demonstrates that a quantitative multiplex PCR represents a cost-effective method that could replace FISH in CLL patients. However, although QMPSF is perfectly adapted to the detection of primary defects, care should be taken when searching for clonal evolutions present in a small proportion of tumor cells. Leukemia (2007) 21, 1460–1463; doi:10.1038/sj.leu.2404727; published online 10 May 2007 Keywords: CLL; prognosis; imbalance; FISH; quantitative PCR

Introduction Four chromosomal abnormalities, namely 17p13 deletions, 11q22-23 deletions, trisomy 12 and 13q13-14 deletions have been reported to be strongly associated with the clinical outcome of chronic lymphocytic leukemia (CLL) patients.1–4 Owing to the low proliferative potential of this malignancy and the fact that some of these defects may be cryptic, search for the resulting aneuploidies is commonly performed using fluorescent in situ hybridization (FISH) on interphase nuclei, which, for that purpose, was demonstrated to be more efficient than conventional cytogenetics.3 Even if the efficacy of this latter method was recently improved by the use of the immunostimulatory CpG-oligonucleotideDSP30 plus interleukin 2,5 it alone does not allow detection of all 11q, 13q and 17p deletions. For FISH, several commercial probes have been developed and are largely used by most investigators. These probes target the 13q-deleted region (D13S319, D13S25), the ATM gene, the TP53 gene and chromosome 12 centromere. As probes are expensive and as Correspondance: Dr C Bastard, Laboratoire de Ge´ne´tique OncologiqueCentre Henri Becquerel, Rue d’Amiens, 76000, Rouen, France. E-mail: [email protected] Received 29 August 2006; revised 27 March 2007; accepted 28 March 2007; published online 10 May 2007

FISH is a time-consuming method, we aimed to evaluate the application of a quantitative PCR method (quantitative multiplex PCR of short fluorescent fragments6–8 or QMPSFs) initially developed for the evaluation of constitutional aneuploidies to the somatic aneuploidies acquired by CLL patients.

Patients and methods

Patients Hundred and ten patients with newly diagnosed stage A CLL according to Binet classification9 were evaluated in two hospitals (Centre Henri Becquerel, Rouen, France and Centre Francois Baclesse, Caen, France). This study was conducted in the context of a French multicentre medico-economic study aiming at defining the best cost-effective strategy for the prognosis evaluation of these patients. For patients included in this study, the following parameters were investigated: mutational status of immunoglobulin heavy chain genes,10 expression of CD 38 on leukemic B cells,11–13 soluble CD23,14 ZAP70 expression,15–17 presence of one or several of the four chromosomal defects listed above as evaluated by FISH3,18,19 and serum thymidine kinase activity.20 This study, funded by the French Health Ministry (Direction de l’Hospitalisation et de l’Organisation des Soins), included a quality control for all parameters. In addition, in these 110 patients, QMPSF was compared with FISH for the detection of chromosomal imbalances. There were 66 male and 44 female patients, their median age was 69 years (range 47–96). Owing to the low frequency of chromosomes 11, 12 and 17 defects in this series, additional stage A CLL patients with either 11q deletions (five patients) or trisomy 12 (11 patients) were also analysed, together with 15 patients with stage A, B or C CLL or non-Hodgkin lymphoma and 17p deletion in 18–85% of cells.

Blood-cell separation Mononuclear cells were isolated by density gradient centrifugation (lymphoprep, 15 min at 2000 g). As a result, the median proportion of cells with a double CD5 þ /CD19 þ labelling was 87% (range 49–96).

DNA preparation High-molecular weight DNA was prepared using standard methods, either proteinase K digestion followed by a saltingout procedure and ethanol precipitation or by MagNA pure compact nucleic-acid isolation kit 1 (Roche, Diagnostic, Basel, Switzerland) or QIAamp DNA mini kit (Qiagen, Courtaboeuf, France). As QMPSF is based on a comparison between the amplification profile of the test DNA and a control DNA, only

PCR evaluation of aneuploidies in CLL C Bastard et al

samples prepared using the same extraction protocol can be analysed.

QMPSF (patent FR0209247) QMPSF is a sensitive method for the detection of genomic deletions or duplications based on the simultaneous amplification of short genomic fragments using dye-labelled primers under quantitative conditions.6–8 PCR products are analysed on a sequencing platform used in the fragment analysis mode and both the peak height and area are proportional to the quantity of template present for each target sequence. This method was initially developed for the evaluation of constitutional aneuploidies. In this setting, height or area of peaks corresponding to the loss of one allele will be half that of normal samples, whereas a gain of one allele (trisomy) will result in a 50% increase. As reported previously,21 in the context of an acquired somatic abnormality leading to an imbalance, both the proportion of tumoral cells in the sample and the proportion of tumoral cells bearing the abnormality will impact the template quantity. As a result, if the tumor represents only one half of the sample, the diminution resulting from the loss of one allele by the tumoral cells will be only 25%, as gain in case of trisomy.

Selection of target genes Genes located in the commonly deleted regions of chromosomes 11, 13 and 17 were selected as target genes, namely ATM at 11q22.3, DLEU2 at 13q14.2 and TP53 at 17p13.1. As the TP53 primers failed to detect a 17p deletion in this series of 110 patients, another target gene located in a more telomeric position at 17p13, ATP2A3 was added to the original multiplex. Two genes were chosen on the long arm of chromosome 12, POU6F1 at 12q13.13 and MDM2 at 12q15, located in the more frequently gained regions in case of partial trisomy 12.22 In addition, two genes located in regions which are usually not rearranged in CLL were chosen as reference genes, JAK2 in the 9p24 region and CECR1 located at 22q11. Primer pairs were designed for each of these seven genes in regions that do not contain single nucleotide polymorphisms and chosen to generate PCR fragments ranging from 150 to 250 bp. These primers were modified as described previously.6 Sequences of the primers are indicated in Table 1.

PCR conditions PCRs were run from 100 ng of genomic DNA in a final volume of 25 ml with 0.16 mmol/l of each deoxynucleoside triphosphate, 1.5 mmol/l MgCl2, 1 U of thermoprime plus DNA polymerase (ABgene, Epson, UK), 5% DMSO and 0.5–1.6 mmol/l of each primer, one primer of each pair carrying a 6-FAM label. After an initial denaturation for 3 min at 941C, 20 cycles were performed consisting of denaturation, 941C for 15 s, annealing 501C for 15 s (ramping 31C/s) and extension 701C, 15 s (ramping 31C/s), followed by a final extension step for 5 min at 701C.

Fragment analysis After completion of the PCR reaction, labelled products were run on an ABI Prism 310 DNA genetic analyser (Applied Biosystem, Courtaboeuf, France) and the amplification profile of each patient was compared with the profile of both a commercial reference DNA (Roche Diagnostic, Basel, Switzerland) and a known negative DNA using the GeneScan 3.1. 2 software. Heights and areas were also calculated and compared with

Table 1

1461

QMPSF primersa

ATM_187F (11q22) ATM_187R

CTATCTCAGCTTCTACCCCAACA CCACGAAAGGTAATACACCAAAT

P53_203F (17p13) P53_203R

CTACAGCCACCTGAAGTCCAA TGCAAGCAAGGGTTCAAAGAC

ATP2A3_218F (17p13) ATP2A3_R

CCCACATCCAAAGCCCCTCA GCTAAGACCTCCCCACCTCCC

POU6F1-212F (12q13) POU6F1-212R

AAATGGACTTTTCTCCCCTACTCG TGCTGGTGTTCTTGAGCGTCT

JAK2_232F (9p24) JAK2_232R

TTCAGCAATTCAGCCAATGC CTCACTTTCTTTATGTTTCCCTCTT

DLEU2_152F (13q14) DLEU2_152R

ATATTTTCCCTACCCTCCCATC TTGCTTTCTAGTCAATCAGGTTTT

CECR1_165F (22q11) CECR1_165R

GCGCATCTGTTGTTGAAAGAAA TGGGTGGGAATATCAGGGTC

MDM2_236F (12q15) MDM2_236R

GCAGCCAAGAAGATGTGAAAGAG ACATACTGGGCAGGGCTTATTC

Abbreviation: QMPSF, quantitative multiplex PCR of short fluorescent fragment. a Two decanucleotide extensions, for the forward and reverse primers, were added on the 50 side of these oligonucleotides. Their sequences are available on request.

Table 2

Comparison of FISH and QMPSF results (n ¼ 110 patients) FISH n (%)

Marker All del(13)(q13-q14) Isolated del(13) del(11)(q22) + 12 del(17)(p13)

68 59 51 8 8 1

(62) (54) (46) (7) (7) (1)

QMPSF n (%) 69 59 51 9 9 0

(63) (54) (46) (8) (8)

Both n (%) 72 61 53 9 9 1

(65) (55) (48) (8) (8) (1)

Abbreviations: FISH, fluorescent in situ hybridization; QMPSF, quantitative multiplex PCR of short fluorescent fragment.

those of the reference markers. For negative samples, the mean variation (M72s.d.) of the ratio of target peak area/reference peak area was 5.074.9 %, with a slight variation from target to target. In this series, all positive samples for a given defect had a ratio value inferior to 0.84 for a loss or superior to 1.20 for a gain, as compared to the ratio calculated for normal DNA.

Sensitivity assessment Tumors comprised of a mixture of normal and abnormal cells that carry somatically acquired genetic defects. To verify that QMPSF was suitable for the evaluation of abnormal DNA diluted in normal DNA, DNAs from patients with a deletion of chromosome 13, 11 or 17 or with a trisomy 12 were diluted in normal DNA (Roche Diagnostic) and analysed using this multiplex assay.

FISH analysis The following probes were used in this study: LSI D13S25 spectrum orange, LSI ATM spectrum orange, LSI TP53 spectrum orange (Vysis, Dover Grove, IL, USA) and chromosome 12 Leukemia


1462 Table 3

QMPSF results of additional cases (peak area, patients vs control) FISH (n) 18%

del 11q del 17p +12

1

QMPSF Not detected

FISH (n) 25–30%

QMPSF mean/range

FISH (n) 430%

QMPSF mean (range)

4

0.81 (0.79–0.84)

5 10 11

0.58 (0.49–0.64) 0.61 (0.56–0.68) 1.36 (1.21–1.5)

Abbreviations: FISH, fluorescent in situ hybridization; QMPSF, quantitative multiplex PCR of short fluorescent fragment.

a-satellite probe (Qbiogen, Illkrich, France). At least 300 nuclei were evaluated for each marker

Results and discussion

Sensitivity In dilution experiments, somatic defects could be reliably detected when the proportion of tumoral cells was as low as 20% for del(13)(q14) and del(11)(q22), 25% for trisomy 12 and del(17). As mentioned above, the median proportion of tumoral cells after density gradient separation was 86%, much higher than this 20–25% threshold. However, in CLL patients, the proportion of abnormal cells carrying either of the tested genetic defects can be lower than the theoretical 100% found in cell lines. For example, the median proportion of cells carrying a 13q deletion as evaluated by FISH in this series was 63%.

Losses and gains Results are summarized in Table 2. A chromosomal imbalance involving one or several of the four loci was detected in 72 patients (65%) either by FISH or QMPSF or both. Using FISH, in agreement with previously reported frequency,3 a deletion of chromosome 13 was found in 59 patients (54%), 11q22 deletion in eight (7%), trisomy 12 in eight (7%) and 17p deletion in one. The low frequency of the three latter defects reflects the fact that only patients with stage A CLL at diagnosis were studied and not stage B or C CLL, known to carry more aggressive cytogenetic patterns. QMPSF detected a 13q deletion in the same number of patients, a 11q deletion and a trisomy 12 in nine patients each (8%) and failed to detect the 17p deletion. As detected by either method, the 13q deletion was isolated in 53 patients and associated with a second defect in eight: these were six of the 11q22 deletions, one trisomy 12 and the 17p deletion. When the 13q deletion was associated with either a 11q deletion or a trisomy 12, both abnormalities were present in the same proportion of cells. This was not the case for the 17p deletion which appeared to be a secondary event, since, as evaluated by FISH, it was present in 24% of cells, whereas the 13q deletion was present in 85% of interphase nuclei.

Comparison of FISH and QMPSF FISH and QMPSF results were identical for 103 of these 110 patients. Two 13q deletions detected by FISH were not detected by QMPSF and conversely two 13q deletions detected by QMPSF were not detected by FISH. These discrepancies are likely to result from the variability of 13q deletion boundaries in CLL patients. A breakpoint located between the FISH and QMPSF probes will be detected by only one of the two techniques. This problem could be resolved by adding another more telomeric target to the current multiplex. Since two of these patients, one detected by FISH and the other by QMPSF had a second defect, they were recognized as 11q deletion for Leukemia

one and trisomy 12 for the other. One partial 12q trisomy could not be detected by FISH, since it does not involve the centromeric region. The ATM QMPSF assay was designed in exon 7 of the gene and unexpectedly demonstrated a 3-bp deletion in one allele for one patient, which was confirmed by sequencing and could of course not be detected by FISH. This case raises the particular problem of small deletion occurring in the coding sequences of target genes, which cannot be detected by the current reference technique. Finally, the secondary 17p deletion, occurring in a patient with a 13q deletion and evaluated to be present in 24% of cells was not detected by QMPSF. This discrepancy could probably be explained by the low proportion of cells carrying the deletion in this case. Of note, this FISH evaluation was difficult as the sample was poor and the hybridization quality not optimal. This discrepancy points to the problem represented by the detection of small emerging secondary defects in this pathology, mainly when they are associated with a bad prognosis. The results of the analysis performed in additional patients with 11q deletions or trisomy 12 or with 17p deletion recruited in stage B and C CLL or non-Hodgkin lymphomas are summarized in Table 3 and show that, for this latter defect, the abnormality is reliably detected when present in 25% of tumoral cells.

Conclusion This study, showing the very good correlation existing between FISH and QMPSF results for the exploration of the common aneuploidies found in CLL, demonstrates that a single multiplex PCR represent a cost-effective method, adapted to large cohorts, which can replace FISH in most patients. However, although QMPSF is perfectly adapted to the detection of primary defects, care should be taken when searching for minor clonal evolutions present in a small proportion of tumor cells.

References 1 Dohner H, Fischer K, Bentz M, Hansen K, Benner A, Cabot G et al. p53 gene deletion predicts for poor survival and non-response to therapy with purine analogs in chronic B-cell leukemias. Blood 1995; 85: 1580–1589. 2 Dohner H, Stilgenbauer S, James MR, Benner A, Weilguni T, Bentz M et al. 11q deletions identify a new subset of B-cell chronic lymphocytic leukemia characterized by extensive nodal involvement and inferior prognosis. Blood 1997; 89: 2516–2522. 3 Dohner H, Stilgenbauer S, Benner A, Leupolt E, Krober A, Bullinger L et al. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 2000; 343: 1910–1916. 4 Juliusson G, Merup M. Cytogenetics in chronic lymphocytic leukemia. Semin Oncol 1998; 25: 19–26. 5 Dicker F, Schnittger S, Haferlach T, Kern W, Schoch C. Immunostimulatory oligonucleotide-induced metaphase cytogenetics detect chromosomal aberrations in 80% of CLL patients: A study of 132 CLL cases with correlation to FISH, IgVH status, and CD38 expression. Blood 2006; 108: 3152–3160.


1463 6 Casilli F, Di Rocco ZC, Gad S, Tournier I, Stoppa-Lyonnet D, Frebourg T et al. Rapid detection of novel BRCA1 rearrangements in high-risk breast-ovarian cancer families using multiplex PCR of short fluorescent fragments. Hum Mutat 2002; 20: 218–226. 7 Rovelet-Lecrux A, Hannequin D, Raux G, Meur NL, Laquerriere A, Vital A et al. APP locus duplication causes autosomal dominant early-onset Alzheimer disease with cerebral amyloid angiopathy. Nat Genet 2006; 38: 24–26. 8 Tournier I, Paillerets BB, Sobol H, Stoppa-Lyonnet D, Lidereau R, Barrois M et al. Significant contribution of germline BRCA2 rearrangements in male breast cancer families. Cancer Res 2004; 64: 8143–8147. 9 Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J et al. A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer 1981; 48: 198–206. 10 Hamblin TJ, Davis Z, Gardiner A, Oscier DG, Stevenson FK. Unmutated Ig V(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 1999; 94: 1848–1854. 11 Hamblin TJ, Orchard JA, Gardiner A, Oscier DG, Davis Z, Stevenson FK. Immunoglobulin V genes and CD38 expression in CLL. Blood 2000; 95: 2455–2457. 12 Hamblin TJ, Orchard JA, Ibbotson RE, Davis Z, Thomas PW, Stevenson FK et al. CD38 expression and immunoglobulin variable region mutations are independent prognostic variables in chronic lymphocytic leukemia, but CD38 expression may vary during the course of the disease. Blood 2002; 99: 1023–1029. 13 Chevallier P, Penther D, Avet-Loiseau H, Robillard N, Ifrah N, Mahe B et al. CD38 expression and secondary 17p deletion are important prognostic factors in chronic lymphocytic leukaemia. Br J Haematol 2002; 116: 142–150. 14 Reinisch W, Willheim M, Hilgarth M, Gasche C, Mader R, Szepfalusi S et al. Soluble CD23 reliably reflects disease activity in

15

16 17

18

19

20 21

22

B-cell chronic lymphocytic leukemia. J Clin Oncol 1994; 12: 2146–2152. Crespo M, Bosch F, Villamor N, Bellosillo B, Colomer D, Rozman M et al. ZAP-70 expression as a surrogate for immunoglobulinvariable-region mutations in chronic lymphocytic leukemia. N Engl J Med 2003; 348: 1764–1775. Orchard JA, Ibbotson RE, Davis Z, Wiestner A, Rosenwald A, Thomas PW et al. ZAP-70 expression and prognosis in chronic lymphocytic leukaemia. Lancet 2004; 363: 105–111. Wiestner A, Rosenwald A, Barry TS, Wright G, Davis RE, Henrickson SE et al. ZAP-70 expression identifies a chronic lymphocytic leukemia subtype with unmutated immunoglobulin genes, inferior clinical outcome, and distinct gene expression profile. Blood 2003; 101: 4944–4951. Krober A, Seiler T, Benner A, Bullinger L, Bruckle E, Lichter P et al. V(H) mutation status, CD38 expression level, genomic aberrations, and survival in chronic lymphocytic leukemia. Blood 2002; 100: 1410–1416. Oscier DG, Gardiner AC, Mould SJ, Glide S, Davis ZA, Ibbotson RE et al. Multivariate analysis of prognostic factors in CLL: clinical stage, IGVH gene mutational status, and loss or mutation of the p53 gene are independent prognostic factors. Blood 2002; 100: 1177–1184. Magnac C, Porcher R, Davi F, Nataf J, Payelle-Brogard B, Tang RP et al. Predictive value of serum thymidine kinase level for Ig-V mutational status in B-CLL. Leukemia 2003; 17: 133–137. Killian A, Di Fiore F, Le Pessot F, Blanchard F, Lamy A, Raux G et al. A simple method for the routine detection of somatic quantitative genetic alterations in colorectal cancer. Gastroenterology 2007; 132: 645–653. Merup M, Juliusson G, Wu X, Jansson M, Stellan B, Rasool O et al. Amplification of multiple regions of chromosome 12, including 12q13–15, in chronic lymphocytic leukaemia. Eur J Haematol 1997; 58: 174–180.

Leukemia