concurrent or subsequent development of non ...

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only.

1991 77: 1527-1533

Epstein-Barr virus in benign lymph node biopsies from individuals infected with the human immunodeficiency virus is associated with concurrent or subsequent development of non-Hodgkin's lymphoma D Shibata, LM Weiss, BN Nathwani, RK Brynes and AM Levine

Information about reproducing this article in parts or in its entirety may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only.

Epstein-Barr Virus in Benign Lymph Node Biopsies From Individuals Infected With the Human Immunodeficiency Virus Is Associated With Concurrent or Subsequent Development of Non-Hodgkin’s Lymphoma By Darryl Shibata, Lawrence M. Weiss, Bharat N. Nathwani, Russell K. Brynes, and Alexandra M. Levine Individuals infected with the human immunodeficiency virus (HIV) have an increased incidence of high-grade B-cell lymphoma. In many instances, these lymphomas contain EpsteinBarr viral (EBV) genomes. To investigate the role of EBV in development of HIV-related lymphoma, benign fixed lymph node biopsies from normal individuals and HIV-infected individuals with persistent generalized lymphadenopathy (PGL) were analyzed for EBV sequences by polymerase chain reaction and in situ DNA hybridization techniques. EBV DNA was not detected in any of 16 benign lymph node biopsies from normal individuals, but could be detected from 13 of 35 PGL biopsies. The EBV-infected cells were present in both follicular and interfollicular areas and in both small and large lymphoid cells. The presence of detectable amounts of EBV

M

OST ADULTS have been infected by Epstein-Barr virus (EBV). The initial infection may be asymptomatic or may produce the clinical syndrome of infectious mononucleosis. During the acute infection, large numbers of EBV-infected lymphocytes are present in the peripheral blood (PB)’ and lymph nodes.* Subsequently, the number of infected lymphocytes decreases as the host mounts an immune response.’ EBV then remains latent in B lymphocytes or nasopharyngeal epithelium, with periodic shedding of virus into saliva.‘ The mechanisms of EBV latency are complex and host dependent. In immunocompromised patients, EBV-related lymphoproliferative disorders have been well described.’~~ Furthermore, patients immunocompromised owing to infection by human immunodeficiency virus (HIV) have an increase in circulating EBV-infected lymphocytes’ and have also been shown to be at increased risk of developing high-grade B-cell lymph~ma.~.’ Approximately one half of these lymphomas have been shown to contain EBV DNA sequenCes.8.’’ The AIDS-related lymphomas behave aggressively and respond poorly to ~hemotherapy.~.’ HIV-infected patients are also at increased risk for developing reactive lymphadenopathy, designated as persistent generalized lymphadenopathy (PGL), which is considered an AIDS-related condition (ARC). The histology of these enlarged PGL lymph nodes consists of a benign but florid follicular and interfollicular B-cell hyperplasia or follicular involution.”.” The presence of monoclonal or oligoclonal immunoglobulin gene rearrangements in approximately 20% of these reactive lymph nodes suggests that this lymphoid hyperplasia may be a risk factor or prodrome for subsequent development of lymphoma,8 but because most HIV-infected individuals with PGL do not progress to lymph~ma,’’.’~ other cofactors may be necessary. Because EBV may be associated with HIV-related lymphoma, the current study was performed to investigate the presence of EBV in PGL lymph node biopsies and to determine the possible relationship between EBV-related lymphoproliferations and the risk of malignant lymphoma. Blood, Vol77, No 7 (April 1). 1991: pp 1527-1533

DNA in the 13 PGL biopsies was associated with an increased incidence of concurrent lymphoma at another site (n = 3) or development of lymphoma in time (n = 2). In contrast, only 1 of 22 individuals with EBV-negative PGL biopsies developed lymphoma in time (P < .05). EBV was detected in all five lymphomas in which tissue was available for subsequent analysis, including the lymphoma that developed in the individual without EBV in his previous PGL biopsy. These findings support the hypothesis that EBV plays a role in development of some HIV-related lymphomas. Detectable EBV lymphoproliferations occur in a few PGL biopsies and are associated with a significant risk of EBV DNA-positive non-Hodgkin’s lymphoma. o 1991by The American Society of Hematology. MATERIALS AND METHODS

The slides and paraffin-embedded benign lymph node biopsies from 35 HIV-infected and 16 non-HIV-infected patients from the Los Angeles County-University of Southern California (LACUSC) Medical Center were analyzed. None of the 35 HIV-infected patients had histories of opportunistic infection or Kaposi’s sarcoma, but three HIV-infected patients subsequently developed lymphoma and three HIV-infected patients had lymphoma (“concurrent lymphoma”) at another site at the time the initial benign lymph node biopsy was performed. Morphologic lymphoma classification, performed by three of the authors (D.S., R.K.B., B.N.N.), was based on the Working Form~lation.’~ The benign lymph node biopsies were classified either as normal or as reactive with follicular hyperplasia, follicular involution, or dermatopathic

lymph ad en it is."^" DNA was extracted from single 10-pm slices of the fixed tissues into a 50-pL extraction ~olution.’~.~’ Approximately 0.5 to 2.0 pL extraction solution was used for each reaction. The polymerase chain reaction (PCR)17-’Y was performed with primers (SL15‘ GGACCTCAAAGAAGAGGGGG and SL3 GCTCCTGGTC’ITCCGCCTCC) and a probe (SL2 GGACGAGGACGGGGAAGAGG) specific for the EBNA 1 gene of EBV. The primers amplify and detect an 80-base pair (bp) region of the EBNA 1 gene (starting at position 8037’”) which appears to be conserved between EBV strains with no reported sequence differences between the B95-8, JY, and FF41 strains.’@’’ As expected, From the Departments of Pathology and Hematology, Los Angeles County-University of Southem California Medical Center, Los Angeles; and the Department of Pathology, City of Hope National Medical Center, Duarte, CA. Submitted July 27 1990; accepted November 30, 1990. Supported in part by a Grant No. CA50850 from the National Cancer Institute, Bethesda, MD. D.S. is a recipient of the College of American Pathology Fellowship Award. Address reprint requests to Danyl Shibata, MD, at the LAC-USC Medical Center, 1200 N State St 736, Los Angeles, CA 90033. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.section 1734 solely to indicate this fact. 0 1991 by The American Society of Hematology. 0006-4971l91/7707-0025$3.0010 1527

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only. 1528

SHIBATA ET AL

SL1-3 detected the EBNA 1gene from the Raji, Jijoye, EB1, EB2, EB3, and Daudi cell lines (American Type Culture Collection, Rockville, MD) and also detected EBV from more than YO% of all fixed biopsies of nasopharyngeal carcinoma (data not shown). The reaction volumes were 50 p,L, and the primers were used at 40 pmol/L. Temperatures during the 42 amplification cycles were 95°C for 45 seconds, 50°C for 45 seconds, and 72°C for 60 seconds. As a positive amplification control, primers for a genomic sequence (low-density lipoprotein receptor”) were also simultaneously present during the amplification. All EBV’ and EBV- samples with the exception of the B-5 fixed biopsies demonstrated amplification of this normal genomic sequence. Fixation with B-5 greatly reduces PCR amplification (D. Shibata, unpublished observations), and only EBV was detected from the B-5-fixed tissues. The remainder of the PGL biopsies and all biopsies from the non-HIVinfected patients were fixed in formalin, and dilution studies demonstrated that most of the DNA was suitable for amplification (described below). Positive controls consisting of Raji DNA and negative controls consisting of human genomic DNA as well as an assay with no added sample were performed with each experiment. The sensitivity of the EBV EBNA PCR reaction on fixed tissue was determined by amplifying formalin-fured, paraffin-embedded mixtures of Raji cells (50 EBV copies per cell24)and a non-EBVinfected T-cell line (Molt 3). Deparaffinized slices containing approximately 50,000 cells were boiled and directly amplified as above. The assay can detect at least 0.01% infected cells or an average of 0.005 EBV copies per cell (data not shown). Amplifications were performed in a blinded fashion without knowledge of the HIV or lymphoma status. The EBNA PCR assay was performed at least twice for each biopsy. In some cases, a sample was positive on one run but negative on the second. For these samples, five PCR assays were performed. A sample was considered positive for EBV if most of the amplifications were

positive. If two of the five amplifications were positive, the sample was considered weakly positive (l+),as indicated in Table 1. EBV DNA was not detected from any of the negative biopsies except for one specimen (case 15), which was considered negative because only one of the five assays was positive. The relative amounts of EBV DNA were further characterized by subjecting serial dilutions of the DNA extracted from the formalin-fixed specimens to 50 PCR cycles. The EBNA’ formalin-fixed specimens were amplified with a second set of primers that immediately flank the portion of the EBV lymphocyte-determined membrane antigen (LYDMA) gene composed of variable numbers of tandem 33 bp repeats.z”6 The primers (SL18, GGCGCACCTGGAGGTGGTCC, and SLlY, TTTCCAGCAGAGTCGCTAGG) were used at 2.5 p,mol/L with 40 amplification cycles at 95°C for 45 seconds, 50°C for 30 seconds, and 72°C for 2 minutes with a final extension for 10 minutes at 72°C. The PCR products were Southern-blotted after electrophoresis through a 3% NuSieve (FMC, Rockland, ME), 0.5% agarose gel, using a ”P-labeled probe (SL20, TGACAATGGCCCACAGGACCCTG) homologous to the tandem repeats. In situ DNA hybridization was performed using an 3SS-labeled BumHI-W fragment of the EBV genome.’ Negative controls consisting of normal lymph nodes from individuals not in this study were also analyzed. HIV infection was determined by HIV enzyme-linked immunosorbent assay (ELISA) testing (Abbott Laboratories, Chicago, IL) and by PCR analysis of the lymph node biopsies. The HIV gag gene was amplified using the primers SK 38 and SK 39.27The HIV PCR results for seven of the non-HIV-infected and 16 of the HIV-infected patients were reported previously.” Clinical follow-up, subsequent to the time of initial PGL biopsy, was obtained by review of the medical records. Statistical analysis was performed with the chi-square test.

Table 1. Summary of Resultsof PGL and Lymphoma Biopsies Lymphoma Biopsy

Benign Lymph Node Biopsy EBV Case

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15-17 18-32 33-34 35

Type

FH FH Flt FH FH FH FH FH FH FH FH FI FI FI FH FH FI DM

HIV PCR

PCR

+ +

-

-

+ + + + + + + + + + + + + + +

I+ 1+ 3+ 4+ 3+ 3+ 2+ 2+ 2+ 2+ 1+ 2+ 2+ -

In Situ

Negative Rare + Atypical cells Atypical cells + ND Rare Germinal centers Negative Rare Rare + Germinal centers Negative Rare Rare Negative Not done Not done Not done

+

+

+

+ +

+

+

Type

Months From PGL BX

SNC SNC IBL IBL SNC SNCt

1 22 5 0 0 0

EBV PCR

5+ ND* 1+ 1+ 5+ -

In Situ

SNC cells ND* IBL cells IBL cells SNC cells SNC cells

+

+ + + +

NA NA NA NA NA NA NA NA NA NA NA NA

Negative (-); positive (+I; weak amplification (1+) (described in the Results section and legend t o Fig 2); amplification to the 10-fold dilution (2+); amplification t o the 100-fold dilution (3+);amplification to the 1,000-fold dilution (4+); and amplification t o the 10,000-fold dilution (5+). Abbreviations: PGL, persistent generalized lymphadenopathy; EBV, Epstein-Barr virus; HIV, human immunodeficiency virus; FH, follicular hyperplasia; FI, follicular involution; DM, dermatopathic lymphadenitis; SNC, small non-cleaved lymphoma; IBL, immunoblastic lymphoma; NA, not applicable. *Lymphoma cells were obtained by fine-needle aspiration; insufficient material was available for EBV studies. tB5-Fixed tissue; amplification of genomic sequences was not possible (described in the Results section).

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only.

1529

EBV IN PGL

RESULTS

The EBV EBNA PCR was performed on histologically benign lymph node biopsies from 16 non-HIV-infected patients and 35 HIV-infected patients. The results are shown in Fig 1and Tables 1 and 2. EBV could be detected in biopsies from 13 of the 35 HIV-infected patients and from none of those from the 16 non-HIV-infected patients (P < .01). The lymph node biopsies from the non-HIVinfected patients were classified either as normal (n = 1) or as reactive with follicular hyperplasia (n = 9) or dermatopathic lymphadenitis (n = 6). The EBNA PCR' formalin-fixed specimens were also amplified for the portion of the EBV LYDMA gene composed of variable numbers of tandem 33 bp repeats. The size of this heterogeneous region is characteristic for a given EBV isolate and can vary between EBV Each EBNA PCR' formalin-fixed specimen was also LYDMA PCR+,and the LYDMA PCR products were variable in size (Fig 2). An exception was the lymphoma of case 1, which was EBNA PCR' but LYDMA PCR-. In situ hybridization (described below) confirmed the presence of EBV DNA in this lymphoma. Under the conditions used, a single major PCR product band was produced from each EBV-infected cell line, although multiple minor bands could be detected after prolonged exposure. Mixtures of

A B

A B

1

Table 2. EBV in Benign Lymph Node Biopsies From HIV-Infected and Non-HIV-Infected Patients EBV PCR HIV Status ~

+ -

+

-

EBV+ (%)

13 0

22 16

37 0

( P < .01)

Doslnea Abbreviations as in Table 1.

the EBV-infected cell lines produced multiple predominant bands. A single predominant LYDMA PCR band was produced from the specimens in this study except for cases 12 and 14, which produced multiple predominant bands, indicating the presence of at least two EBV species. In case 5, the only instance in which formalin-fixed material was available for both the lymphoma and the PGL biopsy, a single identical LYDMA band was produced. Of the 13 HIV-infected patients with EBV PCR' PGL biopsies, 3 had lymphoma diagnosed by biopsy at another site (concurrent lymphoma) and 2 subsequently developed lymphoma. In contrast, only 1 of 22 HIV-infected patients (median follow-up 12 months) with EBV- PGL biopsies developed lymphoma (Table 3, P < .05). To characterize further the relative amounts of EBV DNA present, we amplified serial dilutions of 14 EBV PCR' formalin-fixed samples (Table 1and Fig 3). The EBV PCR' formalin-fixed lymphomas and the Raji cell line could be diluted at least 10,000-fold, with persistence of PCR positivity for both EBV and the genomic sequence. In contrast, the benign biopsies became negative for EBV at lesser dilutions.

A B C D E

2 3

394-

4

5

298-

6

220154-

EBV

GENOMIC BP

Fig 1. Representative autoradiograph of the PCR products. Specimens A1-7 and 81-3 are PGL biopsies from HIV-infected patients. Positive specimens are Al, 2,5, and 6 and B2.3. Controls are 84 (SiHa cells, EBV-), 85, 6 (Raji cells, EBV'), and 87 (blank with no added sample). As expected, all of the samples except 87 (blank) were positivefor the genomic sequence.

Fig 2. Representative Southern blot analysis of the PCR products amplified from a region of the LYDMA gene composed of variable numbers of tandem repeats. Single bands of different sizes were producedfrom the specimens (A, case 8; B, case 13; D, case 9) except for C (case 12) and E (case 14), from which multiple predominant bands were detected.

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only.

SHIBATA ET AL

1530 Table 3. EBV as a Risk Factor for Lymphoma in HIV-Infected Patients EBV PCR in PGL Biopsy

+ -

Lymphoma' Present

Absent

5 1

21

a ( P < .05)

DISCUSSION

*Patients with concurrent lymphoma or patients subsequently developed lymphoma. Abbreviations as in Table 1.

To identify the cells infected with EBV, in situ DNA hybridization was performed (Fig 4). EBV DNA was identified in the lymphoma cells of all five cases examined. The diagnosis of lymphoma was made by fine-needle aspiration in case 2, and lymphoma tissue was not available for further analysis. Cells containing EBV DNA could also be identified in most of the EBV PCR' PGL biopsies, although the PCR was more sensitive. The in situ DNA hybridization technique, however, could analyze the B-5fixed tissues unsuitable for the PCR. In PGL cases 3 and 4, small clusters of large atypical cells present in interfollicular and pericapsular adipose tissue were positive. In the remaining positive PGL cases, scattered large to small cells constituting less than 1% of the cells were positive in focal follicular as well as interfollicular areas. Presence of EBV DNA was limited to the cells in several germinal centers alone in cases 7 and 11. HIV DNA was detected from 34 of the 35 benign lymph nodes of the HIV-infected patients (Table 1). Unlike some

DILUTION

> po

A B C

..-

2 Controls genomic

0.1 0.01

of the EBV amplifications, the HIV PCR assays were consistently positive. EBV DNA was detected from the one HIV PCR- PGL biopsy. HIV sequences were not detected from any of the 16 lymph node biopsies from uninfected patients.

blank

w oo.ool

Fig 3. Dilution analysis of the EBV' specimens. DNA extracted from the lymph node biopsies was serially diluted before the EBV EBNA PCR, with 1.0 representing 1 pL of the original extraction. Both the Raji cell line and specimen A, the lymphoma of case 1, were strongly positive for EBV even at the 0.001 (4+) dilution. In contrast, specimen B (PGL biopsy from case 5) was weakly positive for EBV at the 0.001 (4+) dilution, and specimen C (PGL biopsyfrom Case 9) was positive for EBV only to the 0.1 (2+) dilution. The genomic sequence was positive in all the specimens t o the 0.001 dilution. The controls were a genomic sample (SiHa cell line, EBV-) and a blank (no added sample).

After an acute EBV infection, a life-long persistent infection is established, reflecting a balance between viral replication and host immunity.) EBV can be cultured from the pharynx of most asymptomatic seropositive individuals?' EBV can also be cultured from a very small proportion ( < 1 in 1,000,000) of PB mononuclear cells.' Direct detection of EBV-infected cells by nucleic acid hybridization techniques during latent infection has not been possible, however?29Therefore, we used the PCR'8.'9to enhance the sensitivity of EBV detection. Despite this increased sensitivity (at least an average of 0.005 EBV genomes per cell), EBV could not be detected in the lymph node biopsies from 16 normal individuals. Similarly, EBV has not been detected in benign lymph node biopsies from normal individuals by other investigators using the PCR.M83'These results, analogous to the values obtained by culture assays for EBV, indicate that the numbers of EBV-infected lymph node cells is normally extremely small in latent infection. In contrast, individuals infected with HIV may be immunocompromised, with resultant increased numbers of EBVinfected cells. Serologic data have demonstrated that more than 90% of HIV-infected individuals are also EBV infected and that reactivation of the EBV infection may be a common occurrence3233;eg, EBV can be cultured from a higher but still small proportion (- 1 in 100,000) of PB B cells: Despite this increase in the numbers of EBV-infected peripheral blood mononuclear cells, detection of EBV sequences within PGL tissues has been extremely diffiIn the current study, by using the PCR technique, EBV DNA was successfully detected in 37% of benign PGL biopsies. The EBV-infected cells present in the PGL biopsies were identified using very sensitive in situ DNA hybridization techniques. Only a small proportion ( < 1%) of small and large lymphoid cells located in focal follicular and interfollicular regions were positive. In cases 7 and 11, infected cells were identified predominantly within isolated germinal centers. The patterns of EBV infection in the PGL lymph node biopsies are markedly different from the patterns present in infectious mononucleosis, in which greater numbers of EBV-infected cells are located almost exclusively in interfollicular areas and are predominantly immunoEBV-infected cells are otherwise not detectable in reactive lymph node biopsies from normal individuals. Because approximately half of all HIV-related lymphomas have been shown to contain EBV sequences,s"' the presence of detectable EBV-infected cells in the current PGL biopsies was studied for possible correlations with the presence of lymphoma. EBV positivity was significantly associated with the concurrent presence of EBV' nonHodgkin's lymphoma at another site or subsequent development of EBV' lymphoma. These findings demonstrate that

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only.

1531

EBV IN PGL

!

Fig 4. In situ DNA hybridization for EBV. (A) An HIV-related non-Hodgkin‘s lymphoma positive for EBV with autoradiographic signals present in all the lymphoma cells. (B) A PGL biopsy (case 7) in which the autoradiographic signals existed predominantly in a few germinalcenters (GC).

existence of increased numbers of EBV-infected cells commonly precedes or is associated with development of lymphoma in HIV-infected individuals and supports the hypothesis that EBV may play a significant role in its genesis. None of the 37 HIV-infected individuals with PGL developed lymphomas negative for EBV. HIV-related lymphomas appear to be a heterogeneous group, and patients with PGL and detectable EBV sequences apparently have a greater risk for EBV+ but not EBV- lymphoma, although the small numbers of patients in this study precludes definitive analysis. This association between EBV in the PGL biopsies and EBV’ lymphoma is not unexpected. As hypothesized by other inve~tigators,5.”’~~~~~~’ EBV-related lymphoproliferations that occur secondary to immunodeficiency may allow development of genetic aberrations such as the chromosomal translocation 8;14,activation of c-myc oncogene, and eventual termination in lymphoma. This study provides definitive evidence that the hypothesized EBV-related lymphoproliferations do occur in benign PGL lymph node biopsies. Amplification of the polymorphic LYDMA gene

sequence can provide some information about the clonal nature of the EBV-related lymphoproliferation. Although polyclonal and clonal proliferation cannot be distinguished if an individual is infected with EBV species homogeneous for the polymorphic region, multiple bands were detected in two individuals in this study, indicating that these individuals were infected with at least two different EBV species. Unless the same cell was infected by the different EBV species, these EBV-related lymphoproliferations were probably oligoclonal or polyclonal. Increased numbers of EBV-infected cells, however, are neither necessary nor sufficient for development of lymphoma. In case 1, EBV was not detected in the PGL biopsy performed 1 month before development of an EBV’ lymphoma. In this case, EBV-related lymphoproliferation may have been extremely focal and not present in the lymph node biopsied. In other currently reported PGL cases, EBV lymphoproliferations were not associated with lymphoma; whether the EBV reactivation represented a transient phenomenon in these patients or whether lymphoma will eventually develop during longer follow-up is unknown.

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only. 1532

SHIBATA ET AL

HIV-related lymphomas are characterized by the presence of widely disseminated disease. Therefore, in some instances, detection of EBV in the morphologically benign PGL biopsies may represent occult involvement with EBVcontaining lymphoma cells. This may have occurred in cases 3 and 4 because the small number of EBV-infected cells identified by in situ hybridization appeared to have the abnormal morphology of lymphoma cells. Similar examples of histologically occult lymphoma detected by molecular techniques have been well described previ0usly.3~.~~ Although the number of HIV-infected cells in PGL lymph nodes is HIV provirus, in contrast to EBV, was detected in virtually all benign lymph node biopsies from HIV-seropositive individuals. This difference may be related to the progressive nature of HIV infection as compared with the stable latent infection typically established by EBV. HIV can stimulate B cells to proliferate4’ and may promote follicular hyperplasia of the EBV- benign

biopsies. Certain growth factors produced by HIV-infected monocytes and T lymphocytes, such as interleukin-6 (IL6 ) y may be operative in this regard. In summary, the detectable presence of EBV DNA in benign PGL biopsies was a significant risk factor for EBV DNA‘ lymphoma and suggests the need for close surveillance of these individuals. The presence of EBV in the PGL lymph node biopsies from AIDS patients with lymphoma may reflect widely disseminated occult lymphoma or increased immunosuppression leading to EBV reactivation. The exact biologic mechanisms responsible for the association between EBV reactivation and B-cell lymphoma are currently unknown. ACKNOWLEDGMENT

We are indebted to Jackie Bonis for technical assistance and to Dr John Sninsky of the Cetus Corporation for supplying the Taq enzyme used in this study.

REFERENCES

1. Rocchi G, de Felici A, Ragona G, Heinz A Quantitative evaluation of Epstein-Barr-virus-infected mononuclear peripheral blood leukocytes in infectious mononucleosis. N Engl J Med 296:1332,1977 2. Weiss LM, Movahed LA: In situ demonstration of EpsteinBarr viral genomes in viral-associated B cell lymphoproliferations. Am J Pathol134651,1989 3. Thorley-Lawson D A Basic virologic aspects of Epstein-Barr virus infection. Semin Hematol25:247,1988 4. Harrington DS, Weisenburger DD, Purtilo DT: Epstein-Barr virus-associated lymphoproliferative lesions. Clin Lab Med 8:97, 1988 5. Birx DL, Redfield RR, Tosato G: Defective regulation of Epstein-Barr virus infection in patients with acquired immunodeficiency syndrome (AIDS) or AIDS-related disorders. N Engl J Med 3142374,1986 6. Levine AM, Meyer PR, Begandy MK, Parker JW, Taylor CR, Irwin L, Lukes RJ: Development of B-cell lymphoma in homosexual men. Ann Intern Med 100:7,1984 7. Knowles DM, Chamulak GA, Subar M, Burke JS, Dugan M, Wemz J, Slywotzky C, Pelicci G, Dalla-Favara R, Raphael B: Lymphoid neoplasia associated with the acquired immunodeficiency syndrome (AIDS). Ann Intern Med 108:744,1988 8. Pelicci P-G, Knowles DM, Arlin ZA, Wieczorek R, Luciw P, Dina D, Basilico C, Dalla-Favera R: Multiple monoclonal B cell expansions and c-myc oncogene rearrangements in acquired immune deficiency syndrome-related lymphoproliferative disorders. J Exp Med 164:2049,1986 9. Rechavi G, Ben-Bassat I, Berkowicz M, Martinowitz U, Brok-Simoni F, Neumann Y,Vansover A, Gotlieb-Stematsky T, Ramot B: Molecular analysis of Burkitt’s leukemia in two hemophilic brothers with AIDS. Blood 70:1713,1987 10. Subar M, Neri A, Inghirami G, Knowles DM, Dalla-Favera R: Frequent c-myc oncogene activation and infrequent presence of Epstein-Barr virus genome in AIDS-associated lymphoma. Blood 72:667,1988 11. Ewing EP, Chandler FW, Spira TJ, Brynes RK, Chan WC: Primary lymph node pathology in AIDS and AIDS-related lymphadenopathy. Arch Pathol Lab Med 109:977,1985 12. Meyers PR, Yanagihara ET, Parker JW, Lukes RJ: A distinctive follicular hyperplasia in the acquired immune deficiency syndrome (AIDS) and the AIDS related complex: A prelymphomatous state for B-cell lymphoma. Hematol Oncol2:319,1984

13. Turner RR, Levine AM, Gill PS, Parker JW, Meyer PR: Progressive histopathologic abnormalities in the persistent generalized lymphadenopathy syndrome. Am J Surg Pathol11:625,1987 14. Chadburn A, Metroka C, Mouradian J: Progressive lymph node histology and its prognostic value in patients with acquired immunodeficiency syndrome and AIDS-related complex. Hum Pathol20579,1989 15. The Non-Hodgkin’s Lymphoma Pathologic Classification Project: National Cancer Institute sponsored study of classification of non-Hodgkin’s lymphomas. Cancer 49:2112,1982 16. Shibata D, Arnheim N, Martin WJ: Detection of human papilloma virus in paraffin embedded tissue using the polymerase chain reaction. J Exp Med 167225,1988 17. Shibata D, Brynes RK, Nathwanni BN, Kwok S, Sninsky J, Arnheim N: Human immunodeficiency viral DNA is readily found in lymph node biopsies from seropositive individuals. Am J Pathol 135:697,1989 18. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N: Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 2301350,1985 19. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487,1988 20. Baer R, Bankier AT, Biggin MD, Deininger PL, Farrell PJ, Gibson TJ, Hatfull G, Hudson GS, Satchwell SC, Seguin C: DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature 310:207,1984 21. Spreck SH, Strominger J L Analysis of the transcript encoding the latent Epstein-Barr virus nuclear antigen I: A potentially polycistronic message generated by long-range splicing of several exons. Proc Natl Acad Sci USA 828305,1985 22. Polvino-Bodnar M, Shedd D, Miller G: Deletion mutants that affect expression of Epstein-Barr virus nuclear antigen in COS-1 cells after gene transfer with simian virus 40 vectors containing portions of the Bam HI K fragment. J Virol58:324,1986 23. Li H, Gyllensten UB, Cui X, Saiki RK, Erlich HA, Arnheim N Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature 335:414,1988 24. Pritchett R, Pedersen M, Kieff E: Complexity of EBV homologous DNA in continuous lymphoblastoid cell lines. Virology 74:227,1976

From bloodjournal.hematologylibrary.org by guest on July 24, 2011. For personal use only. EBV IN PGL

25. Fennewald S, van Santen V, Kieff E: Nucleotide sequence of an mRNA transcribed in latent growth-transforming virus infection indicates that it may encode a membrane protein. J Virol 51:411,1984 26. Hennessy K, Fenwald S, Hummel M, Cole T, Kieff E: A membrane protein encoded by Epstein-Barr virus in latent growthtransforming infection. Proc Natl Acad Sci USA 81:7207,1984 27. Ou CY, Kwok S, Mitchell SW, Mack DH, Sninsky JJ, Krebs JW, Feorino P, Warfield D, Schochefman G: DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 239:295,1988 28. Yao QY, Rickinson AB, Epstein MA: A re-examination of the Epstein-Barr virus carrier state in healthy seropositive individuals. Int J Cancer 35:35,1985 29. Staal SP, Ambinder R, Beschorner WE, Hayward GS, Mann R: A survey of Epstein-Barr virus DNA in lymphoid tissue. Am J Clin Pathol91:1,1989 30. Quinnan GV, Masur H, Rook AH, Annstrong G, Frederick WR, Epstein J, Manischewitz JF, Macher AM, Jackson L, Ames J: Herpesvirus infections in the acquired immune deficiency syndrome. JAMA 25272,1984 31. Saito I, Servenius B, Compton T, Fox RI: Detection of Epstein-Barr virus DNA by polymerase chain reaction in blood and tissue biopsies from patients with Sjogren’s syndrome. J Exp Med 169:2191,1989 32. Peiper SC, Myers JL, Broussard EE, Sixbey JW:Detection of Epstein-Barr virus genomes in archival tissues by polymerase chain reaction. Arch Pathol Lab Med 114:711, 1990 33. Abid-Rahman M, Kingsley LA, Breinig MK, Ho M, Armstrong JA, Atchison RW, Lyter DW, Rinaldo CR Jr: Enhanced antibody responses to Epstein-Barr virus in HIV-infected homosexual men. J Infect Dis 159:472,1989 34. Uccini S, Monardo F, Vitolo D, Faggioni A, Gradilone A, Agliano AM, Manzari V, Ruco LP, Baroni CD: Human immunodeficiency virus (HIV) and Epstein-Barr virus (EBV) antigens and genome in lymph nodes of HIV-positive patients affected by

1533

persistent generalized lymphadenopathy (PGL). Am J Clin Pathol 92729,1989 35. Ernberg I, Altiok E: The role of Epstein-Barr virus in lymphomas of HIV-carriers. Acta Pathol Microbiol Immunol Scand 858,1989 (suppl) 36. Niedobitek G, Hamilton-Dutoit S, Herbst H, Finn T, Vetner M, Pallesen G, Stein H: Identification of Epstein-Barr virusinfected cells in tonsils of acute infectious mononucleosis by in situ hybridization. Hum Pathol20796,1989 37. Crescenzi M, Seto M, Herzig GP, Weiss PD, Griffith RC, Korsmeyer SJ: Thermostable DNA polymerase chain amplification of t( 14;18) chromosomal breakpoints and detection of minimal residual disease. Proc Natl Acad Sci USA 185:4869,1988 38. Weiss LM, Hu E, Wood GS, Moulds C, Cleary ML, Warnke R, Sklar J: Clonal rearrangements of T-cell receptor genes in mycosis fungoides and dermatopathic lymphadenopathy. N Engl J Med 313539,1985 39. Harper ME, Marselle LM, Gallo RC, Wong-Staal F Detection of lymphocytes expressing human T-lymphotropic virus type 111 in lymph nodes and peripheral blood from infected individuals by in situ hybridization. Proc Natl Acad Sci USA 83:772,1986 40. Biberfeld P, Chayt KJ, Marselle LM, Biberfeld G, Gallo RC, Harper ME: HTLV-111 expression in infected lymph nodes and relevance to pathogenesis of lymphadenopathy. Am J Pathol 125:436,1986 41. Schnittman SM, Lane HC, Higgins SE, Folks T, Fauci AS: Direct polyclonal activation of human B lymphocytes by the acquired immune deficiency syndrome virus. Science 233:1084, 1986 42. Groopman JE, Molina JH, Scadden D T Hematopoietic growth factors. Biology and clinical applications. N Engl J Med 321:1449,1989 43. Nakajima K, Martinez-Maza 0, Hirano T, Breen EC, Nishanian PG, Salazar-Gonzalez JF, Fahey JL, Kishimoto T Induction of IL-6 production by HIV. J Immunol142:531,1989