Journal of Microbiology (2017) Vol. 55, No. 6, pp. 488–498 DOI 10.1007/s12275-017-7088-x
eISSN 1976-3794 pISSN 1225-8873
Coptidis Rhizoma extract inhibits replication of respiratory syncytial virus in vitro and in vivo by inducing antiviral state Byeong-Hoon Lee1†, Kiramage Chathuranga1†, Md Bashir Uddin1,2, Prasanna Weeratunga1, Myun Soo Kim3, Won-Kyung Cho4, Hong Ik Kim3, Jin Yeul Ma4, and Jong-Soo Lee1* 1
College of Veterinary Medicine, Chungnam National University, Daejeon 34134, Republic of Korea 2 Faculty of Veterinary and Animal Science, Sylhet Agricultural University, Sylhet 3100, Bangladesh 3 Vitabio Corporation, Daejeon 34540, Republic of Korea 4 Korean Medicine (KM) Application Center, Korea Institute of Oriental Medicine, Daegu 41062, Republic of Korea (Received Feb 27, 2017 / Accepted Mar 15, 2017)
Coptidis Rhizoma is derived from the dried rhizome of Ranunculaceous plants and is a commonly used traditional Chinese medicine. Although Coptidis Rhizoma is commonly used for its many therapeutic effects, antiviral activity against respiratory syncytial virus (RSV) has not been reported in detail. In this study, we evaluated the antiviral activities of Coptidis Rhizoma extract (CRE) against RSV in human respiratory tract cell line (HEp2) and BALB/c mice. An effective dose of CRE significantly reduces the replication of RSV in HEp2 cells and reduces the RSV-induced cell death. This antiviral activity against RSV was through the induction of type I interferon-related signaling and the antiviral state in HEp2 cells. More importantly, oral administration of CRE exhibited prophylactic effects in BALB/c mice against RSV. In HPLC analysis, we found the presence of several compounds in the aqueous fraction and among them; we confirmed that palmatine was related to the antiviral properties and immunemodulation effect. Taken together, an extract of Coptidis Rhizoma and its components play roles as immunomodulators and could be a potential source as promising natural antivirals that can confer protection to RSV. These outcomes should encourage further allied studies in other natural products. Keywords: coptidis rhizoma (CR), palmatine, respiratory syncytial virus (RSV), antiviral effect Introduction In 1956, RSV was discovered and isolated from a captive Chimpanzee (Simoes, 1999). It was soon identified as a human †
These authors contributed equally to this work. *For correspondence. E-mail:
[email protected]; Tel.: +82-42-821-6753; Fax: +82-42-825-7910 Copyright G2017, The Microbiological Society of Korea
pathogen when it was recovered from infants with lower respiratory tract infections (LRTI) (Chanock et al., 1957). RSV, a negative-strand non-segmented RNA virus, belongs to the genus Pneumovirus of the family Paramyxoviridae (Falsey et al., 2000). It is considered to be a leading cause of lower respiratory tract illness in infants and children worldwide, and at least 33 million children under 5 years of age were suffering from RSV-related disease (Hall et al., 2009; Nair et al., 2010; Lambert et al., 2014). It is also an important cause of acute respiratory illness in the elderly (Collins et al., 2011). Moreover, RSV can be devastating in immune-compromised individuals (Dudas et al., 1998). Although the majority of individuals are infected with RSV at an early age, susceptibility to re-infection with RSV is common throughout life and old age (Varga and Braciale, 2013). Almost six decades later, it remains the most common viral cause of serious respiratory illness, and a licensed RSV vaccine is not yet available (Durbin et al., 2003). The continued lack of any specific therapeutic or a safe and effective vaccine indicates the vital importance in making progress toward reducing global mortality and morbidity from RSV infection. There is also no effective therapeutics targeting RSV. Ribavirin is the only approved medicine for RSV infection, and immunoglobulin preparations do exist for RSV prevention. However, neither of these options is cost-effective or simple to administer (Kneyber et al., 2000; Pelaez et al., 2009) and they are currently under clinical trials for all RSV vaccines as prophylactic and therapeutic candidates (Lindsay et al., 2015). Therefore, other effective therapies for overwhelmed RSV infection warrant investigation. Medicinal uses of natural plants began with human civilization, and their use eventually spread around the globe (Hoareau et al., 1999). Approximately 70,000 plant species are used for herbal medicinal purposes (Neelesh et al., 2014). Among many herbal medicines, Coptidis Rhizoma (CR) is the dried rhizome of Coptischinensis Franch, which belongs to the Ranunculaceae family, and is recorded in the Chinese Pharmacopeia with the Chinese name of Huang Lian (Hui et al., 2014; Bing et al., 2015). Aqueous extracts of CR have been used in China since ancient times to treat vomiting, diarrhea, and abdominal pain (Hu et al., 2000). Moreover, recent research on CR has discovered that CR has anti-inflammatory, anti-viral, anti-cancer, anti-bacterial, and antiAlzheimer activities (Hu et al., 2000; Tang et al., 2009; Chin et al., 2010). However, no study currently exists on the CR inhibition of RSV replication and immune modulation. Initially, almost 200 natural oriental herbs were screened against RSV infection in HEp2 cells and among them Coptidis Rhizoma extract (CRE) was selected. In this present study, we demonstrated that CRE has the ability to inhibit
Antiviral activities of Coptidis Rhizoma extract
RSV replication in vitro cell culture and in vivo mouse model. Additionally, we confirmed the antiviral activity of Palmatine, a key component of CRE and the immune-modulatory potential of CRE which regulates the anti-RSV immune responses was evaluated.
489
cells were infected with RSV-GFP (0.1MOI) containing 1% FBS DMEM. At 2 h post infection (hpi), wells were washed with PBS and replaced the media with DMEM (10% FBS). GFP expression was measured at 24 hpi with Glomax multidetection system following manufacturer’s directions. RSVGFP titer was determined in supernatant and cells by plaque assay (Nguyen et al., 2010).
Materials and Methods Determination of cytotoxicity of Coptidis Rhizoma in vitro Plant materials and total aqueous extract preparation The CR crude plant material was purchased from a local store (Jaecheon Oriental Herbal Market) and verified by Professor Ki-Hwan Bae at the College of Pharmacy, Chungnam National University. Water-soluble herbal extract of CR was prepared by Vitabio Corporation, Daejeon, and Republic of Korea. Briefly, 100 g of the dried bark was placed in 1 L of distilled water and extracted by heating for 2.5 h at 105°C. After the extraction, CRE was filtered using a filter paper (0.45 μm) and stored at 4°C for 24 h. Then, the extract was centrifuged at 12,000 rpm for 15 min. The supernatant was collected, and the pH was adjusted to 7.0. The total successive aqueous extract was then subjected to membrane syringe filtration (0.22 μm) and stored at -20°C until further use. Cells and viruses HEp2 (ATCC CCL-23) cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Hyclone) and 1% antibiotic / antimycotic solution (Gibco) at 37°C with a 5% CO2 environment. The Green Fluorescent Protein fused Respiratory syncytial virus (RSV-GFP) from Dr. Jae U. Jung, Department of Molecular Microbiology and Immunology, University of Southern California, USA. RSV-GFP propagated on confluent HEp2 cells and titer was determined by a standard plaque assay. Reagents, chemicals, and antibodies Recombinant human interferon (IFN) beta and ribavirin was purchased from Sigma-Aldrich. Trypan blue solution was purchased from Gibco. Antibodies used in immunoblotting study were as follows: anti-IRF3 (Abcam, #ab25950), antiphospho IRF3 (Ser396) (Cell Signaling, #4947), anti-p65 (Cell Signaling, #4764S), anti-phospho p65 (Cell Signaling, #3031S), anti-TBK1 (Cell Signaling, #3504S), anti-phospho TBK1 (Cell Signaling, #5483S), anti-p38 (Cell Signaling, #9212), antiphospho p38 (Cell Signaling #4631S), anti-ERK (Cell Signaling, #9102), anti-phospho ERK (Cell Signaling, #9102S), and anti-β-actin (Santa Cruz SC 47778). Antiviral assays in Coptidis Rhizoma or Palmatine treated HEp2 cells Inhibition of virus replication assay was performed using the RSV-GFP virus as described previously with some modifications (Moon et al., 2012). Briefly, HEp2 cells were cul5 tured in 12 well plates (2.5 × 10 cells/well) and incubated for 12 h. Cells were treated with 1,000 U/ml IFN-β, CRE 0.5 or 1 μg/ml (5 μl/ml or 0.5% and 10 μl/ml or 1.0%) or palmatine 40 or 55 μM respectively and incubated for 12 h. HEp2
The cytotoxicity of CRE was evaluated through trypan blue exclusion test as described previously (Strober, 2001). Increasing concentrations of CRE (1–100 μg/ml) were treated with HEp2 cell monolayer cultured in 12well cell culture plates 5 (2.5 × 10 cells/well). The cell viability was determined by 0.4% trypan blue (Invitrogen) (ratio 1:1) at 24 h post-treatment (hpt) and mounted to the hemocytometer to obtain the percentages of viable cells. The concentrations of CRE plotted to the cell viabilities in HEp2 cells, and cytotoxicity was calculated as the concentration of the extract resulting 50% cell viability. Detection of IFN-β and pro-inflammatory cytokines 5
Cells were cultured in 6 well cell culture plates (5 × 10 cells/ well) and treated with 1,000 U/ml and 1.0 μg/ml CRE (10 μl or 1.0%) or palmatine 55 μM in DMEM supplemented with 10% FBS or media alone, and then incubated at 37°C with atmospheric 5% CO2. The supernatants were harvested at 12 and 24 hpt and kept -20°C until analyzed. Using commercial ELISA kits, Human IFN-β (PBL Interferon Source) and Human IL-6 (BD Biosciences) were measured according to manufacturer’s instructions. Immunoblot analysis Phosphorylation of type I IFN related proteins were evaluated by immunoblot analysis. Briefly, HEp2 cells were cultured in 6 well plates (5 × 105 cells/well) and incubated for 12 h. Cells were treated with 1,000 U/ml IFN-β and 1.0 μg/ml CRE (10 μl or 1.0%) in DMEM supplemented with 10% FBS or media alone, and then incubated at 37°C with atmospheric 5% CO2. Cells were harvested at 0, 8, 12 and 24 hpt and subjected to immunoblot analysis. Briefly, cell pellets were lysed by radio-immunoprecipitation assay (RIPA) lysis buffer. Whole cell lysates (WCL) were mixed with 10x sample buffer (Sigma) at 1:1 ratio to separate by SDS-PAGE and transferred on to PVDF membrane (BioRad) in buffer containing 30 mM Tris, 200 mM glycine, and 20% methanol for 2 h. Then membrane was blocked in 5% bovine serum albumin (BSA, Sigma) and probed with the target protein antibody in 5% FBS or TBST. After washing three times with Tris-buffered saline containing 0.05% Tween 20, membrane was incubated with horseradish peroxidase (HRP) conjugated secondary antibodies for one hour in room temperature and developed by Enhanced Chemiluminescence Detection (ECL) system. Level of mRNA quantification by real-time polymerase chain reaction (RT-PCR) in vivo and in vitro 5 HEp2 cells were cultured in 6 well plates (5 × 10 cells/well)
490
Lee et al.
Table 1. Human primer sets used for RT-PCR Gene IFN-β MX-1 GBP 1 IL-6 TNF-α IL-8 ISG-15 ISG-54 ISG-56 β-Actin
Primers Forward 5���-CATCAACTATAAGCAGCTCCA-3��� 5���-CCAAAGACACTTCCTCTC-3��� 5���-AGAGATCACGGACTACAGAA-3��� 5���-CCACACAGACAGCCACTCACC-3��� 5���G-ATGAGCACTGAAAGCAT-3��� 5���-CTCTCTTGGCAGCCTTCCTGATT-3��� 5���- GAGAGGCAGCGAACTCATCT -3��� 5���-GGAGGGAGAAAACTCCTTGGA-3��� 5���-AAGGCAGGCTGTCCGCTTA-3��� 5���-CCAACCGCGAGAAGATGACC-3���
and incubated for 12 h. Cells were treated with 1,000 U/ml IFN-β (Positive control) and 1.0 μg/ml CRE (10 μl or 1.0%) in DMEM supplemented with 10% FBS or media alone, and then incubated at 37°C with atmospheric 5% CO2. Total RNA was isolated by using RNeasy Mini kit (Qiagen) from whole cell or 1 g of lung homogenate. Complementary DNA (cDNA) synthesis was conducted using reverse-transcriptase PCR (Toyobo). The cDNAs were quantified by SYBR (Qiagen) based RT-PCR using various cytokine-specific primers and normalized to actin or GAPDH and expressed as fold induction. The sequences of the primers used in RT-PCR are listed in Tables 1 and 2.
Reverse 5���-TTCAAGTGGAGAGCAGTTGAG-3��� 5���-CAGTGTGGTGGTTGTACT-3��� 5���-TCTGTGGACGTGTCATAGAT-3��� 5���-CTACATTTGCCGAAGAGCCCTC-3��� 5���-TCGACGGGGAGTCGAACT-3��� 5���-AACTTCTCCACAACCCTCTGCAC-3��� 5���- CTTCAGCTCTGACACCGACA -3��� 5���-GGCCAGTAGGTTGCACATTGT-3��� 5���-TCCTGTCCTTCATCCTGAAGCT-3��� 5���-GATCTTCATGAGGTAGTCAGT-3���
SIF was collected by infusing 1ml of PBS into small intestine directly using syringe and then clarified by centrifugation (10,000 × g at 4°C for 10 min). BALF was collected by lavaging 1 ml of Hank’s Balanced Salt Solution (HBSS, Gibco) 3 times into lung via trachea using 24 guage catheter (Angiocath Plus, BD Bioscience) and clarified by centrifugation (10,000 × g at 4°C for 10 min). Mouse immunoglobuline A (IgA), IL-6, IFN-λ, and IFN-β in BALF, serum and SIF were investigated using mouse ELISA kit following the manufacturer’s directions. Lung tissues were collected for RT-PCR following collecting of BALF and keep in -70°C until analyzed. RSV challenge and lung RSV titration
Oral administration of Coptidis Rhizoma to mice Mice were administrated safe and less amount of CRE than previously described oral lethal dose of CRE in mice (Ma et al., 2010). Five weeks old female BALB/c mice were used for the in vivo experiments. Mice were orally administered 0.1 mg/ml concentration of CRE at a total volume of 200 μl for 3 times following every alternate day before infection. The control group mice were treated with 200 μl of PBS in the same method. Cytokine quantification by ELISA in bronchoalveolar lavage fluid (BALF), blood serum, and small intestinal fluid (SIF) and RT-PCR of lung tissue Mice were anesthetized after 12 h from the last administration of CRE. Blood was collected from heart puncture under aseptic condition and kept in 4°C for 1 h. Blood serum was separated by centrifugation (10,000 × g at 4°C for 15 min).
Mice were anesthetized with ketamine after 12 h from the 5 last oral administration of CRE and RSV-GFP (2 × 10 PFU) in 40 μl per mouse was infected intranasally. Lung tissues from euthanized mice were collected aseptically at 3 and 5 days post infection (dpi). Lung RSV titration was determined using both standard plaque assay and RSV-G protein mRNA quantification. For plaque assay, lungs were homogenized in 500 μl of PBS adding 1% anti-anti (Gibco) and tungsten bead by homogenizer (Qiagen). Lung homogenates were clarified by centrifugation (10,000 × g at 4°C for 10 min). The supernatants from lung homogenates were used for lung RSV titration by standard plaque assay. RSV-G protein mRNA level was quantified as described in previous section. Identification of palmatine through HPLC The liquid chromatography-mass spectrometry (LC-MS) analysis was performed on an Agilent 1200 Series high-perfor-
Table 2. Mouse primer sets used for RT-PCR Gene IFN-β ISG-15 ISG-20 ISG-56 Mx1 PKR OAS IL-6 GAPDH RSV G
Primers Forward 5���-TCCAAGAAAGGACGAACATTCG-3��� 5���-CAATGGCCTGGGACCTAAA-3��� 5���-AGAGATCACGGACTACAGAA-3��� 5���-AGAGAACAGCTACCACCTTT-3��� 5���-ACAAGCACAGGAAACCGTATCAG-3��� 5���-GCCAGATGCACGGAGTAGCC-3��� 5���-GAGGCGGTTGGCTGAAGAGG-3��� 5���-TCCATCCAGTTGCCTTCTTGG-3��� 5���-TGACCACAGTCCATGCCATC-3��� 5���-CCAAACAAACCCAATAATGATTT-3���
Reverse 5���-TGCGGACATCTCCCACGTCAA-3��� 5���-CTTCTTCAGTTCTGACACCGTCAT-3��� 5���-TCTGTGGACGTGTCATAGAT-3��� 5���-TGGACCTGCTCTGAGATTCT-3��� 5���-AGGCAGTTTGGACCATCTTAGTG-3��� 5���-GAAAACTTGGCCAAATCCACC-3��� 5���-GAGGAAGGCTGGCTGTGATTGG-3��� 5���-CCACGATTTCCCAGAGAACATG-3��� 5���-GACGGACACATTGGGGGTAG-3��� 5���-GCCCAGCAGGTTGGATTGT-3���
Antiviral activities of Coptidis Rhizoma extract
mance liquid chromatography (HPLC) (Agilent technologies CO) connected to a linear ion trap mass spectrometer 4,000 QTRAP system (AB Sciex Co., Ltd.) equipped with an ESI TurboV source. Chromatography was carried out on a column ZORBAX Eclipse XDB-C18 (4.6 × 150 mm, I.D. -5 μm) (Agilent technologies Co., Ltd.). The mobile phase consisted of 1% Formic acid (Solvent A) and Acetonitrile (Solvent B) in the gradient mode as follows: 0–8 min 0–25% B; 8–12 min 25–35% B; 12–17 min 35–50% B; 17–25 min 50–100% B; 25–28 min 100–0% B at flow rate of 1.0 ml/min at 30°C. Conditions of the MS analysis were as follows: positive ion mode, spectra range from m/z 100 to 500, nebulizer; 70.0
491
psi. Molecular weight identification of palmatine was carried out by electrospray ionization mass spectrometry (ESI-MS). Statistical analysis Graphs and all Statistical analysis were performed using GraphPad Prism software version 6 for Windows. Data are presented as the means ± standard deviations (SD) and are representative of at least three independent experiments. Unpaired t-test was performed at each time points to compare the control and infected extract-treated groups. P < 0.05 or P < 0.01 was regarded as significant.
(A)
(B)
(C)
(E)
(D)
(F)
Fig. 1. Antiviral activity and cell cytotoxicity of CRE in HEp2 cells. HEp2 cells were treated with 0.5 μg/ml or 1.0 μg/ml CRE or 1,000 unit/ml human IFN-β for 12 h. Next medium was changed to 1% DMEM and cells were infected with RSV-GFP (0.1 MOI) for 2 h. At 24 hpi, GFP images were obtained under fluorescence microscopy (200 × magnification). GFP expression levels were measured by Gloma multi detection luminometer (A and B). Cell viability was determined by trypan blue exclusion assays at 24 hpi (C). Virus titer was measured at 24 hpi from both supernatants and cells by standard plaque assay (D). Cytotoxicity and effectiveness of CRE were also measured in HEp2 cells; HEp2 cells were treated with various concentration of CRE for 12 h. Cytotoxicity was measured by trypan blue exclusion assay (E). Before virus infection CRE were treated with increasing concentration and florescence were measured at 24 hpi (F). Florescence, Cell viability and viral replication as mean ± SD. Error bars indicate the range of values obtained from counting in triplicate in three independent experiments (*P < 0.05 and **P < 0.01 indicates a significant difference between groups compared by Unpaired t-test).
492
Lee et al.
Results Inhibition of RSV replication in Coptidis Rhizoma treated HEp2 cells The antiviral effects of CRE were evaluated by observing the level of GFP expression and inhibition of viral replication in vitro. HEp2 cells treated with 0.5 and 1.0 μg/ml of CRE exhibited a marked (approximately 50% and 75% respectively) reduction in GFP expression as compared to the untreated group against RSV-GFP (Fig. 1A and 1B). Furthermore, we tested whether CRE can contribute to inhibit RSV replication in infected cells. Interestingly, CRE treated HEp2 cells displayed significantly reduced RSV titers by logs compared to control cells infected with RSV-GFP (Fig. 1D). Moreover, cell death induced by RSV infection was reduced in CRE
(A)
treated HEp2 cells. Both 0.5 and 1.0 μg/ml of CRE treated HEp2 cells exhibited ≥ 80% cell viability within 24 hpi for RSV, compared to untreated cells which had significantly higher cell death following RSV infection (Fig. 1C). These results showed that CRE has potential to inhibit RSV replications in HEp2 cells. Determination of cytotoxicity and effective concentrations of Coptidis Rhizoma The cell viability assay was used to determine the cytotoxicity of CRE extract in HEp2 cells as described previously (Pomerantz et al., 1999; Moon et al., 2012). The results indicated that the cytotoxic concentration (CC50) of CRE aqueous extract was 19.2 ± 2.1 μg/ml in HEp2 cells and the cell viability with the same concentration was more than 90%
(B)
(C)
Fig. 2. Induction of cytokine and phosphorylation of type I IFN pathway related signaling molecules by CRE in HEp2 cells. HEp2 cells were treated with 1.0 μg/ml CRE or 1,000 unit/ml human IFN-β. Cell supernatant were harvest at 12 and 24 hpt and IFN-β and IL-6 were measured by ELISA (A). The tests were performed in triplicate. Immunoblot analysis was performed on the cell lysates of HEp2 cells treated with or without CRE to assess the expression of the phosphorylated and non-phosphorylated forms of IRF3, p65, TBK1, p38, ERK, and β-actin time dependently (B). HEp2 cells were treated with 1.0 μg/ml CRE or 1,000 unit/ml human IFN-β. IFN related antiviral gene mRNA level was measured at 0 and 24 hpt by RT-PCR and β-actin was used for the normalization (C). Error bars indicate the range of values obtained from at least two independent experiments.
Antiviral activities of Coptidis Rhizoma extract
(Fig. 1E). Safety of CRE was estimated through selectivity index (SI) rather than CC50. We next evaluated the effective concentration (EC50) of CRE with a modified GFP assay (Pomerantz et al., 1999; Moon et al., 2012) against RSV in vitro. The aqueous extract of CRE inhibited RSV-GFP replication by 50% at an EC50 of 0.48 ± 0.11 μg/ml (Fig. 1F). The selective index (SI) of CRE against RSV was 40. Based on this data, it could be determined that CRE is relatively nontoxic and both 0.5 and 1.0 μg/ml concentrations of CRE are suitable and effective for anti-RSV assays. Induction of IFN-β and pro-inflammatory cytokine IL-6 in Coptidis Rhizoma treated HEp2 cells To investigate the inhibitory effect of CRE extracts on RSV replication, the induction levels of Interferon-β (IFN-β) and pro-inflammatory cytokine, IL-6 was evaluated in the CRE treated cell supernatant of HEp2 cells. As shown in Fig. 2A, CRE (1.0 μg/ml) induced significantly high secretion of IFN-β and IL-6 at 12 and 24 hpt compared to control, or similar to the pattern observed in IFN-β treated HEp2 cells. Thus, these results point out that CRE can mediate the antiviral responses (A)
(C)
(B)
(D)
(E)
493
in epithelial cells by triggering the IFNs and pro-inflammatory cytokines expression which may elicit the antiviral state in cells, playing a critical role in preventing RSV replication. Activation of type I IFN signaling pathway in Coptidis Rhizoma treated HEp2 cells Since CRE can induce IFN-β and IL-6 secretion, we hypothesized that CRE extract may enhance the antiviral response in epithelial cells. To test this hypothesis, we investigated the activation of type I IFN signal transduction and NF-κB signaling pathway upon CRE treated HEp2 cells. Phosphorylation levels of IFN related signal molecules and NF-κB signaling pathway molecule (p65) were measured in CRE treated HEp2 cells. As shown in Fig. 2B, CRE treated HEp2 cells significantly up-regulated the signaling molecules in the type I IFN and NF-κB pathways mainly IRF3, TBK1, p65, p38, and ERK phosphorylation, similar to the pattern observed in IFNβ treated HEp2 cells. Especially the phosphorylation of IRF3, the key indicator of IFN signal transduction was induced at 8 hpt, and this consequence was noticeably increased with the time (Fig. 2B). In addition to activation of type I IFNs,
(F)
Fig. 3. Inhibition of RSV replication and activation of immune system in vivo. CRE was orally administered at a dose of 20 μg/mouse at 1, 3, and 5 days before infection. After 12 h from last administration, RSV-GFP was intranasally infected to BALB/c mice. For lung RSV titer, at 3 and 5 dpi, lung tissues were collected and RSV titers were measured by standard plaque assay (n = 6) (A). Transcription of RSV G protein mRNA level was determined by Real Time-PCR (n = 6) (B). BALF, blood serum and small intestinal fluid (SIF) were collected at the same time and IgA, IL-6, IFN-λ, and IFN-β were detected by ELISA using antibody-coated ELISA plate (n = 4) (C, D, and E). Lung tissues were collected after 12 h from the last inoculation of CRE and IFN-β, IL-6 and interferon stimulated genes (ISGs) were analyzed from by Real Time PCR (n = 4) (F). The tests were performed in duplicate. (*P < 0.05 and **P < 0.01 indicates a significant difference between groups compared by unpaired t-test)
494
Lee et al.
CRE treated HEp2 cells were able to show clear activation of p38, p65 and ERK molecules that are ultimately leading to induce secretion of pro-inflammatory cytokines and upregulate the antiviral state. These results revealed the CRE induces activation of the type I IFN and NF-κB signaling pathways, so that RSV replication could be controlled.
kine mRNA level (45 fold, 28 fold, and 13 fold) and ISG15, ISG54, ISG56, GBP1, and MX1 like ISGs mRNA level (12 fold, 3 fold, 5 fold, 6 fold, and 9 fold), respectively at 24 hpt (Fig. 2C). Interestingly, mRNA transcription level of almost all tested genes in extract treated cells had higher fold induction than IFN-β positive control except ISG54 but in that fold induction was also higher in extract treated cells than the non-treated group. Furthermore, this up regulation of important antiviral related gene mRNA level by CRE could have positive co-relation with its’ antiviral ability that were shown in HEp2 cells (Fig. 1A and 1C).
Induction of IFN-β and related genes expression in Coptidis Rhizoma treated HEp2 cells On the basis of cytokine induction and type I IFN signaling activation, we further investigated the induction of different interferon stimulatory gene and pro-inflammatory cytokine genes expression at the transcriptional level in accordance with CRE treatment using real-time PCR. CRE treated HEp2 cells increased the transcription of IFN-β mRNA level (14 fold), IL-6, IL-8, TNF-α like pro-inflammatory cyto(A)
(C)
Oral administration of Coptidis Rhizoma increase protection against RSV infection in BALB/c mice To further confirm the anti-viral effect of CRE upon RSVGFP infection in HEp2 cells, we evaluated the in vivo effects (B)
(D)
(E)
(F)
(G)
Fig. 4. Chemical characterization of CRE by HPLC analysis and antiviral activity of palmatine. Chemical compounds in CRE were analyzed by the reversedphase HPLC (A and B). HEp2 cells were treated with 40 or 55 μM of Palmatine or 1,000 unit/ml human IFN-β for 12 h. Cells were infected with RSV-GFP (0.1 MOI) for 2 h. At 24 hpi, GFP images were obtained under fluorescence microscopy (200 × magnification). GFP expression levels were measured by Gloma multi detection luminometer (C). Cell viability was determined by trypan blue exclusion assays at 24 hpi (D). Virus titer was measured at 24 hpi from both supernatants and cells by plaque assays (E). Supernatant from plamatine and IFN-β treated HEp2 cells were collected at 12 and 24 hpt and IFN-β and IL-6 were measured by ELISA (F and G). Error bars indicate the range of values obtained from triplicate in three independent experiments. (PAL: Palmatine) (*P < 0.05 indicates a significant difference between groups compared by unpaired t-test)
Antiviral activities of Coptidis Rhizoma extract
of CRE in BALB/c mice upon RSV-GFP infection. CRE and PBS treated mice were infected by intranasally with RSVGFP (2 × 105 PFU/mouse) and Lungs from all infected mice were collected at 3 and 5 dpi. As shown in Fig. 3A, CRE treated mice showed significantly low lung virus titer in standard plaque assay than control (PBS) treated group. Similarly, transcription of RSV-G protein mRNA level was significantly low in extract treated group compare to control (PBS) group at 3 and 5 dpi (Fig. 3B). These findings indicate that CRE has ability to induce the inhibition of RSV replication in lungs and give protection to mice from RSV infection. Oral administration of Coptidis Rhizoma enhances IFNs and cytokines and promotes mRNA induction in serum, BALF and SIF of BALB/c mice Our previous experiments have shown the oral administration of mice with CRE conferred protective benefits upon RSV infection. Therefore, we next investigated the possible mechanism that CRE could protect mice from RSV infection, thus we measured the level of IgA, IL-6, IFN-β, and IFN-λ in Serum, BALF, SIF of mice. CRE treated mice showed Significantly high IgA, IL-6, IFN-β, and IFN-λ level in the blood serum and BALF than the PBS-treated group (Fig. 3C and 3D). Furthermore, CRE inoculated mice induced high levels of IgA and IL-6 in SIF of BALB/c mice (Fig. 3E). Consequently, these data indicate that CRE can mediate the antiviral response in BALB/c mice by eliciting the expression of immunoglobulin, pro-inflammatory cytokines and IFNs that may remarkably stimulate the antiviral state in BALB/c mice, showing an important role in preventing RSV replication. Therefore, we next examined the induction of different antiviral and interferon-stimulating genes in response to CRE treatment in lung homogenates. The transcription level of various interferon stimulating genes, the pro-inflammatory cytokine and IFNs mRNA was significantly induced by the CRE when compared with PBS-treated BALB/c mice. Furthermore, CRE extract enhances the transcription of ISGs, such as ISG-15, ISG-20, and ISG-56 by 2-fold, 25-fold and 3-fold respectively and IFN-β, the pro-inflammatory cytokine such as PKR, OAS, and Mx1 by 3.5-fold, 3-fold, 7-fold, and 2.5-fold, respectively (Fig. 3F). Taken together, these results suggest that orally administered CRE induces systemic immune responses and could protect mice from RSV infection. Palmatine inhibits RSV replication and induces IFN-β and IL-6 in HEp2 cells To identify the active component of CRE, we performed a reversed phase high performance liquid chromatography (HPLC) analysis. Through HPLC analysis, palmatine was confirmed as one of the main component of CRE and it was detected at a wavelength and flow rate of 280 nm and 1 ml/ min respectively (Fig. 4A and 4B). The antiviral effect of identified fraction was tested in HEp2 cells. An effective dose (40 and 55 μM) was selected based on our preliminary experiments (data not shown). Cell death induced by RSV infection was reduced in palmatine treated HEp2 cells compared with untreated cells (Fig. 4D). Both 40 and 55 μM of palmatine treated HEp2 cells showed almost 75% higher cell sur-
495
vival than untreated HEp2 cells. Similarly in the CRE, inhibition of RSV replication was determined in Hep2 cells upon palmatine treatment. Importantly, palmatine (55 μM) treated HEp2 cells showed almost 35% reduction of GFP expression compared with untreated cells (Fig. 4C). Consequently, palmatine treated HEp2 cells displayed significantly reduced RSV titer compared to untreated cells (Fig. 4E). Therefore, these results showed that palmatine treated HEp2 cells resisted RSV replication and reduced RSV induced cell death. Next, we investigated the secretion of IFN-β and IL-6 levels following palmatine treatment in HEp2 cells. Interestingly, as shown in Fig. 4F and 4G, palmatine induced secretion of IFN-β and IL-6 in HEp2 cells at a significant level. Taken together, these results suggest that palmatine of CRE has a potential ability to prevent virus replication via enhancing the innate immunity of HEp2 cells. Discussion RSV is responsible for a massive health burden, causing 33.8 million lower respiratory tract infections (LRTI) cases, approximately 3.4 million hospitalizations and up to 199,000 deaths worldwide each year (Hall et al., 2009; Nair et al., 2011; Lotz et al., 2012). RSV vaccines are in preclinical or clinical development stage and Ribavirin is the only approved medicine for RSV infection. However, there are no commercial RSV vaccines and application of ribavirin to manage RSV infection is limited by its side effects (Empey et al., 2010). Therefore, novel antiviral agents for RSV with better effects and safety than ribavirin is target for study. Globally, the use of traditional therapies is increasing (Hoarean and DaSilva, 1999; Bell et al., 2006). A large number of traditional herbs and their isolated components have shown a wide spectrum of beneficial antimicrobial effects on various pathogens, including anti-oxidant, anti-inflammatory, antibacterial, anti-fungal, anti-plasmodial and immune-modulatory effects (Abdulrazak et al., 2015). Among the favorable herbs, Coptidis Rhizoma is derived from the dried rhizome of Ranunculaceous plants and is commonly used in traditional Chinese medicine (Tang et al., 2009). Aqueous extracts of CR have been used in China since ancient times to treat vomiting, diarrhea, and abdominal pain (Hu et al., 2000). Moreover, recent research on CR has discovered that CR has anti-inflammatory, anti-viral, anti-cancer, anti-bacterial, and anti-Alzheimer activities (Hu et al., 2000; Tang et al., 2009; Chin et al., 2010). However, antiviral and immunemodulatory effects of CR on RSV infection remain unknown. In this present study, we demonstrated several lines of evidence showing that Coptidis Rhizoma extract (CRE) has the immunemodulatory ability to inhibit RSV replication. First, an effective dose of CRE significantly reduced the replication of RSV in HEp2 cells and reduces the RSV-induced cell death. Second, this antiviral activity against RSV was through the induction of type I interferon-related signaling and the antiviral state in HEp2 cells. Third, oral administration of CRE exhibited prophylactic effects in BALB/c mice against RSV. Additionally, we found the presence of several compounds in the aqueous fraction and among them; we confirmed that
496
Lee et al.
palmatine was related to the antiviral properties and immune-modulation effect. Taken together, these findings indicate that an extract of Coptidis Rhizoma and its components play roles as immunomodulators and could be a potential source for Anti-RSV agent. Even though, CR have been using in Chinese traditional medicines for a variety of purposes and no considerable toxicity/side effects was reported (Liao, 1982). It is notable that CRE did not show any cytotoxic effect on HEp2 cell line (Fig. 1E). Furthermore, the cytotoxicity concentration (CC50) was 19.2 ± 2.1 μg/ml and that value was several magnitudes higher than effective concentration (EC50) 0.48 ± 0.11 μg/ml by which CRE suppress the replication of RSV-GFP by 50% (Fig. 1E and F). The recommended dose of CRE should vary depending on the various infectious diseases and treatment efficacies (Zhu et al., 2014; Bing et al., 2015). In this study, the EC50 value was ranged from 0.5 and 1.0 μg/ml; however, selection indexes (SI) of CRE for RSV indicate the higher safety margin of the extract for therapeutic and/or prophylactic purposes (data not shown). Following viral infection including RSV, host cells initially recognize the virus infection and rapidly induce the production of type I IFNs and cytokines to enhance the antiviral innate immunity as cellular defense mechanisms (Takeuchi and Akira, 2007). Secretion of IFNs and cytokines induce an antiviral state, which is important to protect the host cells against invading viruses (Tenoever et al., 2007). Induction of an antiviral state at an early stage of virus infection is critical to control the spread and pathogenesis of viruses (Boasso, 2013) and the induction of innate immune responses which can stimulated by specific agents could be important approaches for limiting viral infection (Jackson, 2012; Perlman, 2012). Likewise, we hypothesized that CRE induces an antiviral state via the induction of Interferon and pro-inflammatory cytokines, and we determined the induction of antiviral, IFN-stimulated genes (ISGs) (Fig. 2C) and the secretion of IFN-β and IL-6 (Fig. 2A) by CRE in vitro. To elucidate the features in antiviral signaling, we also evaluated the effect of CRE on the signaling molecules including IRF-3, TBK1, p65, ERK and p38 in the type I IFN and NF-κB signaling pathways (Fig. 2B). Consequently, CRE can activate the antiviral signaling molecules and lead to the rapid production of Type I IFNs and various inflammatory cytokines that play a crucial role in stimulating the antiviral state and the subsequent inhibition of RSV. Interestingly, we found that oral administration of CRE significantly reduces the lung virus titer at the 3 and 5 dpi than the control group and also, RSV G protein mRNA transcription level was significantly reduced in the CRE inoculated mice at the 3 and 5 dpi in lung homogenate (Fig. 3A and 3B). These in vivo results are positive correlates with the low viral titer observed in in vitro (HEp2 cell) with the CRE treatment. To support the effects of CRE in vivo, we checked the immune status in blood serum, BALF and SIF of CRE inoculated BALB/c Mice. As shown in Fig. 3, after inoculation with CRE into mice, we could detect significant level of IL6, IFN-β, and IFN-λ in blood serum, BALF and SIF (Fig. 3C–3E). In addition, CRE up-regulated the transcriptional levels of IFN-β, ISGs, and various antiviral genes (Fig. 3F).
Previous report has indicated that increased levels of serum IL-6 or IFN-β correlate with induction of the antiviral state and therefore play a significant role in the inhibition of virus replication (Spellberg and Edwards, 2001; Melchjorsen et al., 2003). Also, IFN- λ, which is an exciting chapter in the field of IFN research is also able to activate many of the similar biological activities as those displayed by Type I IFNs in a wide variety of target cells (Lazear et al., 2015). Moreover, we also found significant level of secreted IgA (SIgA) in BALF and SIF, after inoculation with CRE (Fig. 3C, D, and E). SIgA is the main effector of the mucosal immune system and represents the most abundant immunoglobulin in the body. It provides an important first line of defense against most pathogens that invade the body at the mucosal surfaces (Mantis et al., 2011). Specifically, the mucosal surfaces of the lungs and airway epithelial cells are the most common sites for the replication of respiratory tract viruses (Vareille et al., 2011; Rossi et al., 2015). Thus, significant level of IL-6, IFN-β, IFNλ or SIgA which was induced in serum, BALF and SIF by CRE, induces an antiviral state and could correlate with the inhibition of RSV observed in the BALB/c mice. Coptidis Rhizoma is composed of numerous and diverse alkaloids, mainly berberine, palmatine, jatrorrhizine, coptisine, epiberberine, worenine, and magnoflorine, all of which are considered to be active components (Sun et al., 2006; Bing et al., 2015). To confirm this information, we conducted HPLC analysis to identify the active compounds present in CRE (Fig. 4A) and palmatine was identified as one of major constituents in CRE. Since berberine shows cell toxicity (Yi et al., 2013), we checked the antiviral effects of palmatine. Palmatine can reduce the RSV induce-cell death and treatment of 55 μM of palmatine significantly reduces the viral replication in HEp2 cells (Fig. 4C–4E). Furthermore, 55 μM treatment of palmatine induces the secretion of IFN-β and pro-inflammatory cytokine IL-6 in HEp2 cells (Fig. 4F and 4G) similar to the treatment of CRE in HEp2 cells (Fig. 2A). Thus, the antiviral and immunomodulatory effects of CRE could be due to the cumulative effect of palmatine or various other known or unknown active compounds present in CRE. In conclusion, it is obvious that CRE could be a promising source as natural antiviral agent to arrest RSV replication. Interestingly, oral administration of CRE exhibited prophylactic effects in BALB/c mice against RSV by creating an antiviral state in the lungs. Additionally, we found that palmatine was related to the antiviral properties and immunemodulation effect. Based on this evidence, although the exact underlying antiviral mechanism of CRE is still under investigation, CRE is able to suppress RSV replication and induce immunemodulatory effects. These outcomes should encourage further allied studies in other natural products. Acknowledgements This work was supported by the Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea (Grant No. 112013033, 315044031, 316043-3), the Small and Medium Business Administration (Grant No. S2130867, S2165234), the Korean Institute of Oriental Medicine by the Ministry
Antiviral activities of Coptidis Rhizoma extract
of Education, Science and Technology (MEST) (Grant No. K16281) and the research fund of Chungnam National University in 2016. Author Contributions Byeong-Hoon Lee, Kiramage Chathuranga designed and executed all cell biological experiments and mouse experiments; Md Bashir Uddin, Prasanna Weeratunga, Myun Soo Kim, Won-Kyung Cho performed virus infection and mouse experiments, Jin Yeul Ma, Hong Ik Kim analyzed the data. JongSoo Lee designed the overall study and wrote the paper. Ethical Approval The animal study was conducted under appropriate conditions with the approval of the Institutional Animal Care and Use Committee of Bioleaders Corporation, Daejeon, Korea. Protocol number: BSL-ABSL-16-008. Conflicts of Interest None of the authors have any financial or personal relationships with other people or organizations that could inappropriately influence or bias this study. References Abdulrazak, N., Asiya, U.I., Usman, N.S., Unata, I.M., and Farida, A. 2015. Antiplasmodial activity of ethanolic extract of root and stem back of Cassia sieberiana DC on mice. J. Intercult. Ethnopharmacol. 4, 96–101. Bell, R.A., Suerken, C.K., Grzywacz, J.G., Lang, W., Quandt, S.A., and Arcury, T.A. 2006. Complementary and alternative medicine use among adults with diabetes in the United States. Altern. Ther. Health Med. 12, 16–22. Bing, P., Xiao, T.Y., Qiang, Z., Tian, Y.Z., Han, W., Cheng, J.G., and Xiao, L.T. 2015. Effect of Rhizoma coptidis (Huang Lian) on treating diabetes mellitus. Evid. Based Complement Alternat. Med. Article ID 921416. Boasso, A. 2013. Type I interferon at the interface of antiviral immunity and immune regulation: the curious case of HIV-1. Scientifica Article ID 580968. Chanock, R., Roizman, B., and Myers, R. 1957. Recovery from infants with respiratory illness of a virus related to chimpanzee coryzaagent. I. isolation, properties and characterization. Am. J. Hyg. 66, 281–290. Chin L.W., Cheng, Y.W., Lin, S.S., Lai, Y.Y., Lin, L.Y., Chou, M.Y., Chou, M.C., and Yang, C.C. 2010. Anti-herpes simplex virus effects of Berberine from Coptidis rhizoma, a major component of a Chinese herbal medicine, Ching-Wei-San. Arch. Virol. 155, 1933–1941. Collins, P.L. and Melero, J.A. 2011. Progress in understanding and controlling respiratory syncytial virus: still crazy after all these years. Virus Res. 162, 80–99. Dudas, R.A. and Karron, R.A. 1998. Respiratory syncytial virus vaccines. Clin. Microbial. Rev. 11, 430–439. Durbin, A.P. and Karron, R.A. 2003. Progress in the development of respiratory syncytial virus and parainfluenza virus vaccines.
497
Clin. Infect. Dis. 37, 1668–1677. Empey, K.M., Peebles, R.S., and Kolls, J.K. 2010. Pharmacologic advances in the treatment and prevention of respiratory syncytial virus. Clin. Infect. Dis. 50, 1258–1267. Falsey, A.R. and Walsh, E.E. 2000. Respiratory syncytial virus infection in adults. Clin. Microbiol. Rev. 13, 371–384. Hall, C.B., Weinberg, G.A., Iwane, M.K., Blumkin, A.K., Edwards, K.M., Staat, M.A., Auinger, P., Griffin, M.R., Poehling, K.A., Erdman, D., et al. 2009. The burden of respiratory syncytial virus infection in young children. N. Engl. J. Med. 360, 588–598. Hoareau, L. and DaSilva, E.J. 1999. Medicinal plants: a re-emerging health aid. Electron. J. Biotechnol. 2, 1–70. Hu, J.P., Takahashi, N., and Yamada, T. 2000. Coptidis Rhizoma inhibits growth and proteases of oral bacteria. Oral Dis. 6, 297–302. Hui, W., Wei, M., Hongcai, S., Jia, L., and Xiang, L. 2014. The antihyperglycemic effects of Rhizoma coptidis and mechanism of actions. Biomed Res. Int. Article ID 798093. Jackson, D.C. 2012. Intranasal administration of the TLR2 agonist Pam2Cys provides rapid protection against influenza in mice. Mol. Pharm. 9, 2710–2718. Kneyber, M.C.J., Moll, H.A., and Groot, R.D. 2000. Treatment and prevention of respiratory syncytial virus infection. Eur. J. Pediatr. 159, 339–411. Lambert, L., Sagfors, A.M., Openshaw, P.J.M., and Culley, F.J. 2014. Immunity to RSV in early-life. Front. Immunol. 5, 466. Lazear, H.M., Nice, T.J., and Diamond, M.S. 2015. Interferon-λ: immune functions at barrier surfaces and beyond. Immunity 43, 15–28. Liao, C.L. 1982. Preliminary observation on physiological jaundice (fetal jaundice) of the newborn baby related by YinchenHao decoction and Rhizoma coptidis. Private School of Chinese Medicine Researches of Annual Report (Taiwan), 13, 1. Lindsay, B., Helen, G., Michael, D.S., and Ultan, F.P. 2015. RSV, an on-going medical dilemma: an expert commentary on RSV prophylactic and therapeutic pharmaceuticals currently in clinical trials. Influenza Other Respir. Viruses 9, 169–178. Ma, B.L., Ma, Y.M., Shi, R., Wang, T.M., Zhang, N., Wang, C.H., and Yang, Y. 2010. Identification of the toxic constituents in Rhizoma Coptidis. J. Ethnopharmacol. 128, 357–364. Mantis, N.J., Rol, N., and Corthésy, B. 2011. Secretory IgA’s complex roles in immunity and mucosal homeostasis in the gut. Mucosal Immunol. 4, 603–611. Melchjorsen, J., Sørensen, L.N., and Paludan, S.R. 2003. Expression and function of chemokines during viral infections: from molecular mechanisms to in vivo function. J. Leukoc. Biol. 74, 331– 343. Moon, H.J., Lee, J.S., Choi, Y.K., Park, J.Y., Talactac, M.R., Chowdhury, M.Y., Poo, H., Sung, M.H., Lee, J.H., Jung, J.U., et al. 2012. Induction of type I interferon by high-molecular poly-gammaglutamate protects B6.A2G-Mx1 mice against influenza A virus. Antiviral Res. 94, 98–102. Nair, H., Brooks, W.A., Katz, M., Roca, A., Berkley, J.A., and Madhi, S.A. 2011. Global burden of respiratory infections due to seasonal influenza in young children: a systematic review and meta-analysis. Lancet 378, 1917–1930. Nair, H., Nokes, D.J., Gessner, B.D., Dherani, M., Madhi, S.A., Singleton, R.J., O’Brien, K.L., Roca, A., Wright, P.F., Bruce, N., et al. 2010. Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis. Lancet 375, 1545–1555. Neelesh, S., Kalpa, W.S., Rajendra, G., Yang, H.P., Sung, J.L., Sung, J.O., Tae, K.L., and Dong, K.J. 2014. Evaluation of the antioxidant, anti-inflammatory, and anticancer activities of Euphorbia hirta ethanolic extract. Molecules 19, 14567–14581. Nguyen, D.T, De Witte, L., Ludlow, M., Yuksel, S., Wiesmuller, K.H., Geijtenbeek, T.B.H., Osterhaus, A.D.M.E., and De Swart, R.L. 2010. The synthetic bacterial lipopeptide pam3csk4 modulates
498
Lee et al.
respiratory syncytial virus infection independent of tlr activation. PLoS Pathog. 6, e100104. Pelaez, A., Lyon, G.M., Force, S.D., Allan, M.R., David, C.N., Marianne, F., Naik, P.M., Anthony, A.G., Patrick, O.M., and Lawrence, E.C. 2009. Efficacy of oral ribavirin in lung transplant patients with respiratory syncytial virus lower respiratory tract infection. J. Heart Lung Transplant. 28, 67–71. Perlman, S. 2012. Intranasal treatment with poly (I:C) protects aged mice from lethal respiratory viral infections. J. Virol. 86, 11416– 11424. Pomerantz, J.L. and Baltimore, D. 1999. NF-kappaB activation by a signaling complex containing TRAF2, TANK and TBK1, a novel IKK-related kinase. EMBO J. 18, 6694–6704. Rossi, G.A., Silvestri, M., and Colin, A.A. 2015. Respiratory syncytial virus infection of airway cells: role of microRNAs. Pediatr. Pulmonol. 50, 727–732. Simoes, E.A. 1999. Respiratory syncytial virus infection. Lancet 354, 847–852. Spellberg, B. and Edwards, J.E. 2001. Type 1/Type 2 immunity in infectious diseases. Clin. Infect. Dis. 32, 76–102. Strober, W. 2001. Trypan blue exclusion test of cell viability. Curr. Protoc. Immunol. 64, 9.2.1–9.2.26. Sun, J., Ma, J.S., Jin J., Huai, S.W., Qing, H.W., Hong, G.Z., and Qiu, L.Z. 2006. Qualitative and quantitative determination of the main
components of Huanglian Jiedu decoction by HPLC-UV/MS. Yaoxue Xuebao 41, 380–384. Takeuchi, O. and Akira, S. 2007. Recognition of viruses by innate immunity. Immunol. Rev. 220, 214–224. Tang, J., Feng, Y.B., Tsao, S., Wang, N., Curtain, R., and Wang, Y.W. 2009. Berberine and Coptidis Rhizoma as novel antineoplastic agents: a review of traditional use and biomedical investigations. J. Ethnopharmacol. 126, 5–17. Tenoever, B.R., Ng, S.L., Chua, M.A., McWhirter, S.M., Garciaastre, A., and Maniatis, T. 2007. Multiple functions of the IKK related kinase IKK-epsilon in interferon-mediated antiviral immunity. Science 315, 1274–1278. Vareille, M., Kieninger, E., Edwards, M.R., and Regamey, N. 2011. The airway epithelium: soldier in the fight against respiratory viruses. Microbiol. Rev. 24, 1210–2291. Varga, S.M. and Braciale, T.J. 2013. The adaptive immune response to respiratory syncytial virus. Curr. Top. Microbiol. Immunol. 372, 155–171. Yi, J., Ye, X., Wang, D., He, K., Yang, Y., Liu, X., and Li, X. 2013. Safety evaluation of main alkaloids from Rhizoma Coptidis. J. Ethnopharmacol. 145, 303–310. Zhu, G.X., Zhou, Q., and Tong, X.L. 2014. Points on the clinical practice of Rhizoma Coptidisin the treatment of diabetes mellitus. Zhong Yi Za Zhi 55, 1969–1971.
