Dehalogenase gene detection and microbial diversity ...

World J Microbiol Biotechnol DOI 10.1007/s11274-011-0713-7

ORIGINAL PAPER

Dehalogenase gene detection and microbial diversity of a chlorinated hydrocarbon contaminated site Algasan Govender • Rehana Shaik • Nathlee Samantha Abbai • Balakrishna Pillay

Received: 17 November 2010 / Accepted: 4 March 2011 Ó Springer Science+Business Media B.V. 2011

Abstract In recent years large quantities of mixtures of chlorinated hydrocarbons have accumulated in the environment due to the widespread use and production of these compounds. Microbes have been found to demonstrate a widespread and diverse potential to adapt to the dechlorination of such compounds. Therefore the aim of this study was to investigate the presence and diversity of reductive and hydrolytic dehalogenase genes in a site contaminated with a mixture of chlorinated hydrocarbons. Primers targeting reductive and hydrolytic bacterial dehalogenase genes were designed. In addition, DGGE analysis was performed in order to determine the presence of any known dehalogenase-producing organisms. Total DNA isolated from borehole water samples was used as the template for the amplification reactions. All PCR products obtained with the reductive and hydrolytic gene primers, as well as the dominant bands present on the DGGE gel were cloned and sequenced. Sequencing of the individual amplicons revealed significant identities to the tceA gene of Dehalococcoides ethenogenes 195, the vcrA gene of Dehalococcoides sp. VS as well as the dhlA and dhlB genes of Xanthobacter autotrophicus GJ10. DGGE analysis indicated a high level of commonality with the different sampling times and depths. However, sequence analysis revealed that 66% of the cloned fragments showed significant (95–99%) identity with uncultured microorganisms. Phylogenetic analysis of the sequences revealed that the DGGE clones clustered into two groups when compared to known bacteria having hydrocarbon degradative capabilities. This indicated that the

A. Govender R. Shaik N. S. Abbai B. Pillay (&) Discipline of Microbiology, Faculty of Science and Agriculture, University of KwaZulu-Natal (Westville Campus), Private Bag X54001, Durban 4000, Republic of South Africa e-mail: [email protected]

sequences of the clones were diverse when compared to known microorganisms. This diversity represents a largely untapped genetic pool that can be exploited for the discovery of novel biocatalysts that can be employed in bioremediation. In addition, the presence of both hydrolytic and reductive dehalogenases provided strong evidence that bacteria capable of dehalogenation of chlorinated hydrocarbons may be present in sites contaminated with these compounds. Keywords Chlorinated hydrocarbons Hydrolytic dehalogenases Reductive dehalogenases DGGE analysis

Introduction The contamination of groundwater with organic pollutants due to industrial activity has become a serious threat to terrestrial and aquatic ecosystems. The duration, cost and uncertain success of treating contamination is a daunting obstacle, both to the protection of groundwater and to the recycling and re-development of industrially contaminated land (Rees et al. 2007). Chlorinated compounds are probably the most important class of environmental pollutants and include numerous halogenated compounds (Marchesi and Weightman 2003). Chlorinated organic solvents, such as tetrachloroethene (PCE) and trichloroethene (TCE) have been recognized worldwide as some of the most serious environmental pollutants (Futagami et al. 2006). In anaerobic environments, chlorinated ethenes can be biologically degraded to less-chlorinated and, in some cases, completely dechlorinated to the non-toxic end product ethene. This process is referred to as reductive dechlorination or, when coupled with energy conservation, halorespiration (Johnson et al. 2005).

123

World J Microbiol Biotechnol

To date, all known halorespiration processes are catalyzed by reductive dehalogenase enzymes (RDases). RDases are membrane-associated enzymes with low levels of nucleotide identity but with some common traits (Marzorati et al. 2007). The best characterized RDases for halogenated aliphatics are those specific for chloroalkenes, such as RDases from some Dehalococcoides, the RDases for tetrachloroethene (PCE) from Dehalobacter restrictus strain DSMZ 9455, Desulfitobacterium strain Y51, Desulfitobacterium hafniense strain PCE-S, and the RDase for trichloroethene and PCE Desulfitobacterium hafniense strain TCE1. Haloalkane dehalogenases are unique enzymes which catalyse hydrolytic dehalogenation of corresponding hydrocarbons without participation of oxygen or coenzymes. The haloalkane dehalogenase (DhlA) from Xanthobacter autotrophicus GJl0 has been extensively studied and the sequence of the dhlA gene determined (Janssen et al. 1989). Microorganisms can aid environmental restoration by oxidizing, binding, immobilizing, volatilizing or otherwise transforming toxic compounds. There is significant interest in such microbially mediated bioremediation because it promises to be simpler, cheaper and more environmentally friendly (Lovely 2003). Substantial knowledge regarding diverse groups of bacteria that partially dechlorinate tetrachloroethene (PCE) or trichloroethene (TCE) to cis1,2-dichloroethene (cis-DCE) or trans-DCE has been accrued over the past decade (Ritalahti et al. 2006). However, the identification of these organisms may be limited by culturing and isolation challenges. A means to overcome these challenges is to use culture-independent molecular techniques to study microorganisms involved in dechlorination (Grostern and Edwards 2006). In the present study reductive and hydrolytic dehalogenases were PCR amplified using total DNA extracted from a contaminated site with the purpose of determining which microorganisms and gene products are involved in the biodegradation of chlorinated hydrocarbons. In addition, a diversity assessment of the site was performed by Denaturing Gradient Gel Electrophoresis (DGGE) analysis.

Materials and methods Site sampled Samples were collected from a borehole at a contaminated site in KwaZulu-Natal (South Africa). Preliminary assessment of the sample was performed in order to determine the level of volatile organic compounds (VOC) present. The analysis was carried out at the Council of Scientific and Industrial Research (CSIR) in Modderfontein, South Africa. Analysis was performed in duplicate by purge and trap GC– MS. Temperature and pH of the samples were measured

123

immediately after collection. The site has been in operation since 1907, during which time a diverse range of chemicals including chlorine, herbicides, pesticides, paints and explosives have been manufactured. Samples were collected in February 2009 (end of summer) and August 2009 (end of winter), S1 and S2, respectively and at depths of 10 and 15 m using a bailer. Upon collection, samples were transferred to sterile Schott bottles, sealed and transported to the laboratory at 4°C. A total volume of 5 l was collected. Isolation of total DNA A total volume of 5 liters was filtered using a 47 mm Advantec water filtration system (Toyo Roshi Kaisha, Ltd) fitted with a 0.22 lm nylon filter (Satorius). Filters were then washed overnight in PBS at 4°C. DNA was isolated from the resulting suspension using the UltraClean Soil DNA Kit (MoBio Laboratories, Inc.). The resulting DNA preparation was quantified and checked for purity using the Nanodrop 1000 Spectrophotometer (Thermo Scientific). Primer design Polymerase Chain Reaction (PCR) primers were designed based on conserved regions of known hydrolytic and reductive dehalogenase genes. Sequences were downloaded from the nucleotide database of the National Centre for Biotechnology Information (NCBI) and aligned using the DNAMAN DNA analysis software (Lynon Biosoft). For the hydrolytic dehalogenases the DNA sequences of the dhlA gene (accession number: M26950) from X. autotrophicus GJ10, the linB gene (accession number: D14594) of Sphingomonas paucimobilis UT26, the dhaA gene (accession number: AJ250371) from Pseudomonas pavonaceae 170 and Rhodococcus erythropolis NCIMB13064; and the dhmA gene from Mycobacterium tuberculosis H37Rv (accession number: Z77724) were aligned to identify conserved regions. These hydrolytic dehalogenases are capable of cleaving the carbon-chlorine bond of 1,2-dichloroethane. It was found that the dhaA and linB genes showed 56% identity at the gene level therefore these were aligned to form the LIN primer set. The remaining two genes dhlA and dhmA were found to have 50% identity at the gene level therefore these were aligned to form the DHM primer set. The hydrolytic dehalogenase primer sets were designed based on regions showing a significant level of identity and suitably far apart to generate a PCR product from known genes as well possible related genes (Table 1). Primers were synthesized by Inqaba Biotech (South Africa). The known reductive dehalogenase genes were found to vary significantly between the different genera of bacteria and were thus allocated eight different groups based on sequence similarity, with each group having differing product sizes. Primers

World J Microbiol Biotechnol Table 1 Primers designed for the amplification of hydrolytic dehalogenase genes Primer Genes aligned

Sequence of primers (50 –30 )*

DHM

dhlA and dhmA F: GGCGAGCCCACCTGGAGYTAC

LIN

linB and dhaA F: CTGTGGCGCAAYATCATSCCG

R: GWMKYGTCRGGGAARGGCGC R: GAGGAAGGGCTCGCGATAGKSGKC * IUPAC ambiguity code used: B = C, G, or T; D = A, G, or T; K = G or T; M = A or C; N = A, C, G, or T; R = A or G; S = C or G; W = A or T; Y = C or T

were designed using the NCBI primer design algorithm (http://www.ncbi.nlm.nih.gov/tools/primer-blast/index. cgi). The sequences of the primers are represented in (Table 2). Polymerase chain reaction The PCR mixtures (50 ll) contained 10 ng DNA, 100 pmol of each of the appropriate primers, 100 lM of each of the deoxynucleoside triphosphates (dNTPs), 1 9 Super-therm Taq DNA polymerase buffer and 0.5 U Super-therm Taq DNA polymerase (Southern Cross Biotech) finally brought to volume with sterile de-ionised water. PCR was performed using the PE Applied Biosystems GeneAmp PCR System 9700 (Perkin Elmer) programmed to perform an Table 2 Primers designed for the amplification of reductive dehalogenase genes

initial denaturation at 94°C for 5 min and 30 cycles consisting of 94°C for 2 min, 60°C for 1 min and 72°C for 2 min followed by a final extension step of 72°C for 5 min. The PCR conditions were the same for both primer sets. The dhlA gene of X. autotrophicus GJ10 and A. aquaticus AD27 are identical (Van den Wijngaard et al. 1992) and were used as controls for amplification of the dhlA gene. The dhaA genes of P. pavonaceae 170 and R. erythropolis NCIMB13064 are identical (Poelarends et al. 1998) and were used as controls for the dhaA gene. The expected size of the PCR product in the control bacteria using either primer set is 450 bp. Cloning and sequencing Following amplification, PCR products were visualized on a 2% agarose gel. PCR products were purified using the QIAquick PCR Cleanup Kit (Qiagen). Purified products were ligated to the pGEM-T Easy Vector System I (Promega) and electro-transformed into electro-competent E. coli DH5a cells. Transformants were selected on LB agar (10 g tryptone, 5 g yeast extract, 5 g NaCl and 12 g bacteriological agar per litre) plates containing 100 lg/ml ampicillin. Selection of vectors containing inserts were carried out by spreading 20 ll of 1 M IPTG and 50 ll of a 20 mg/ml stock of X-gal onto plates prior to inoculation. Positive transformant colonies (cream in colour) were grown

Group/Primer

Gene

Accession number

Primer sequence (50 –30 )

Group 1

pceA

AP008230.1

F: TGGGAGAAATCAACAGGAGG

pceA

AP008230.1

R: GCTACATCGTGGTTCCAGGT

pceA

AY706985.2

pceA

AY706985.2

cprA

AF321226.2

F: CAGGTTCATCCGGTTCAGTT

rdfA

AY013362.1

R: CAGCAGCATAGTTGGCAAAA

rdfA

AY013366.1

rdfA

AY013364.1

cprA

AB194705.1

F: CGCTAAGCATCCTTTTGGAG

cprA

AF259790.1

R: CAAACCCCTGCTTTATGGAA

cprA

AF259791.1

Group 2

Group 3

cprA

AF403182.1

Group 4

tceA

AF228507.1

Group 5

pceA

AF022812.1

F: GAATAACCTGCCGCATGAGT R: GGCAATACAAGAGCATGGGT F: GCAGCTGAAATTCGTCAACA R: TTCAACAGCAAAGGCAACTG

Group 6

vcrA

AY322364.1

Group 7

cprA

AF204275.2

F: GAAAGCTCAGCCGATGACTC R: TGACACATACCGCACTGGTT R: AAGGCACTATCCATCAACCG F: GTTCTGGGCACAGTGGTTTT

Group 8

rddA

AY013361.1

R: CTTGTCCAACGGGTGCTATT

rddA

AY013363.1

R: AATCACTAATTGCCGCTGCT

123


overnight in 3 ml LB broth (10 g tryptone, 5 g yeast extract, 5 g NaCl) containing 100 lg/ml ampicillin. Plasmid DNA was isolated using the High Pure Plasmid Isolation Kit (Roche) and sequenced by Inqaba Biotech from both directions using the T7 and SP6 primers. DNA sequences were edited and aligned using DNAMAN DNA analysis software (Lynon Biosoft). The Basic Local Alignment Search Tool (BLAST) program (Altschul et al. 1997) was used to screen DNA databases for sequences that share identity with new sequence information.

Table 3 Chlorinated aliphatic hydrocarbons present in the contaminated site following VOC analysis Compound

Concentration (lg/L)

Vinyl chloride

2,800

trans-1,2 dichloroethene cis-1,2 dichloroethene 1,2 dichloroethene Trichloroethene

24 1,300 39 260

Tetrachloroethene

15

1,1,2,2 tetrachloroethene

46

Denaturing Gradient Gel Electrophoresis (DGGE) 16S rRNA gene amplicons were separated by DGGE using the D-Code Universal Mutation Detection System (BioRad) (Muyzer et al. 1997) following PCR amplification. A 6% polyacrylamide gel with a denaturant gradient from 30 to 60% was used for analyzing fragments amplified using F341-357-GC and R907-926 primer sets (Muyzer et al. 1997). DGGE was conducted at a constant voltage of 60 V in 1 9 TAE buffer at 60°C for 16 h. Sequencing of DGGE fragments Dominant bands were excised from the DGGE gel and subcloned into pGEM-T Easy vector System I (Promega) according to the manufacturer’s instructions. The clones were sequenced at Inqaba Biotech using an ABI 3130XL genetic analyzer (Applied Biosystems, Foster City, CA), incorporating the ABI Big Dye Terminator Cycle Sequencing kit version 3.1 (Applied Biosystems, Foster City, CA). Electropherograms generated from the sequences were inspected with FinchTV software (Geospiza). Nucleotide sequences were compared to known sequences in the NCBI database, using a standard nucleotide BLAST (Altschul et al. 1997). Phylogenetic analysis of the clones was performed in order to determine how the clones cluster in relation to each other and known degraders present in the NCBI database. The known bacterial sequences that were included in the analysis were from the groups of bacteria that were used for the design of the primers coding for genes involved in degradation. The phylogenetic tree was constructed using the, neighbour joining method which is part of the MEGA version 4.1 software package (Kumar et al. 2008). Results Sample assessment and DNA isolation The data from the VOC analysis is represented in Table 3. The site contained extremely high concentrations of vinyl

123

chloride (2,800 lg/l) and cis-1,2-dichloroethene (1,300 lg/l). The A260/280 ratio following spectrophotometric analysis of isolated DNA was 1.8 indicating that the DNA was suitably pure for downstream reactions. Reductive and hydrolytic dehalogenase gene detection and sequence analysis Table 4 indicates the approximate sizes of possible reductive dehalogenase and hydrolytic dehalogenase gene products (bp) from the contaminated site at different sampling times and depths. No amplification products were obtained for reductive dehalogenases of Groups 2 and 7. A reductive dehalogenase, pceA gene product (575 bp) from Group 1, which is involved in reductive dechlorination of tetrachloroethene (PCE) was detected only at a depth of 10 m in the sample site. Sequence analysis of the amplification product showed an 87% identity to Candidatus Methylomirabilis oxyfera (Accession number: FP565575). Sequence data obtained for products from Groups 3, 5 and 8, indicated low complexity reads due to rich homopolymer regions. New primer sets are currently being designed for these groups. The 1,052 bp product from Group 4 showed significant identity to an uncultured Dehalococcoides sp. (99%–Accession number: AB274949) while the 723 bp product was of low complexity. The 586 bp product produced from the Group 6 primer set showed significant identity to Deinococcus geothermalis DSM 11300 plasmid, pDGEO01 (85%–Accession number: CP000358); while the 669 bp product showed similarity to uncultured Dehalococcoides sp., vcrA gene (99%–Accession number: EU137842). Both tceA and vcrA are involved in the dechlorination of trichloroethene (TCE) and vinyl chloride (VC) in Dehalococcoides sp. (Ernst 2009). The hydrolytic dehalogenase genes were identified at all sampling depths. Amplification products obtained with the dhlA and dhlB primer sets showed 100% identity to X. autotrophicus GJ10 [dhlA and dhlB] (Accession numbers: M26950 and M81691). Previous studies have shown

World J Microbiol Biotechnol Table 4 Approximate size of possible reductive and hydrolytic dehalogenase gene products (bp) from the contaminated site at different sampling times and depths

* N/D No product detected

Primer group

S1 (10 metres)

S1 (15 metres)

S2 (10 metres)

S2 (15 metres)*

RD Group 1

575

N/D

622

N/D

RD Group 2

N/D

N/D

N/D

N/D

RD Group 3

637

N/D

637

N/D

RD Group 4

723

1,052

723

1,052

RD Group 5

896

896

896

896

RD Group 6

586

669

586

669

RD Group 7

N/D

N/D

N/D

N/D

RD Group 8

420

N/D

420

N/D

dhlA

950

950

950

950

dhlB

850

850

850

850

that X. autotrophicus GJ10 was isolated using 1,2-dichloroethane (1,2-DCA) as the sole carbon and energy source and was also able to grow on a variety of shortchain halogenated aliphatic compounds (van Der Ploeg et al. 1995). According to the VOC analysis 1,2-DCA is present at a moderate level in the contaminated sample and is possibly being utilized as a carbon source by X. autotrophicus GJ10. DGGE Analysis The resolution of the 16S rRNA amplifications by DGGE and the banding profiles of the contaminated site, analysed at different times i.e. summer (S1) and winter (S2) and at different depths (10 and 15 m) is shown in (Fig. 1). There appeared to be common bacterial populations at the different sampling times and depths. The more intense bands indicated in (Fig. 2) were sequenced in order to determine the

Fig. 1 DGGE analysis of the individual samples from the different levels and depth of the borehole. The arrows indicate the bands that were excised, cloned and sequenced. The numbering of the bands is indicated on the left hand side of each lane. Lane1: S1 (10 m); lane 2: S1 (15 m); lane 3: S2 (10 m); and lane 4: S2 (15 m)

dominant populations. The sequence data provided insight into the dominant types of microorganisms present in the contaminated sample. The sequences were trimmed to *400 bp in length, and the problematic parts of the reads were edited out. Table 5 represents the 15 clones with their significant hits; the alignments of the edited sequences were checked by confirming complementary base-pairing in known regions of the alignment. The phylogenetic analysis allowed easy identification of the position of the DGGE clone sequences within known bacterial groups. According to the BLAST analysis, the more intense bands identified at depths 10 m and 15 m and at the different sampling times showed significant identity (99%) to Denitromonas aromaticus (Accession number: AB049763). Sequences of other bands that may have originated from a common species include DGGE5; DGGE6; and DGGE7 which were shown to have significant identity (99%) to Denitromonas aromaticus (Accession number: AB049763). A similar observation was made with sample S2 at a depth of 15 m where bands were shown to have originated from a common specie (pDGGE9 [Accession number: AB456168]; pDGGE10 [Accession number: EU662609]; pDGGE11 [Accession number: AB456168]; and pDGGE12 [Accession number: AB456168]). In addition, 66% of the cloned sequences found in this study showed significant identity to uncultured microorganisms, indicating the vast potential of identifying novel variants of known genes. The remaining clones showed significant identities (96–99%) to microorganisms capable of degrading aromatic compounds (Denitromonas aromaticus [Accession number: AB049763]; Alicycliphilus sp [Accession number: DQ342277]). According to the phylogenetic analysis, the clones did not cluster with any of the known bacteria indicating the diversity of the clonal sequences (Fig. 2). An outgroup was not selected due to the large number of unknown bacterial populations present in the sample material as evidenced by the BLAST analysis. Thus, an unrooted tree was constructed as this did not require any a-prior assumption in outgroup selection or relationship.

123

World J Microbiol Biotechnol Desulfitobacterium hafnienseY51 (AB049340) 42

Desulfitobacterium sp . PCES (AJ512772)

49 Desulfitobacterium frappieri (DFU40078)

Desulfitobacterium hafniensestrain (NR027603) 85 49 Desulfitobacterium chlororespirans (NR0260)

Desulfitobacterium sp. Viet1 (AF357919)

97

Desulfitobacterium dehalogenans (L28946) 99

Dehalobacter restrictus strain (NR026053) Ancylobacter aquaticus (FJ572209)

68 55

28

Dehalospirillum multivorans (L28946)

pDGGE 1

Uncultured bacteria

23

pDGGE 11, 12 29 76

pDGGE 5, 6, 7 (Denitromonas aromaticus )

Uncultured bacteria pDGGE 3 (Alicycliphilus sp. )

pDGGE 15

pDGGE 4

Uncultured bacteria

pDGGE 8, 9 pDGGE 13

99

Uncultured bacteria

pDGGE 10

38

pDGGE 2

29 58

pDGGE 14

0.2

Fig. 2 The evolutionary history was inferred using the NeighbourJoining method. The optimal tree with the sum of branch length = 2.76501392 is shown. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary

distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. Codon positions included were 1st ? 2nd ? 3rd ? Noncoding. All positions containing gaps and missing data were eliminated from the dataset (Complete deletion option). There were a total of 384 positions in the final dataset. Phylogenetic analyses were conducted in MEGA4

Table 5 BLAST hits of cloned DGGE fragments Clone name

Organism and function

% identity

E value

Accession number

pDGGE1

Uncultured bacterium clone V1F71b 16S ribosomal RNA gene

88

0

FJ905723

pDGGE2

Uncultured bacterium clone 654969 16S ribosomal RNA gene, partial

95

0

DQ404639

pDGGE3

Alicycliphilus sp. A8 16S ribosomal RNA gene, partial sequence

96

0

DQ342277

pDGGE4

Uncultured Rhodocyclaceae bacterium clone eub62E11 16S ribosomal RNA gene, partial sequence

97

0

GQ390172

pDGGE5

Denitromonas aromaticus gene for 16S rRNA

99

0

AB049763

pDGGE6


99

0

AB049763

pDGGE7


99

0

AB049763

pDGGE8

Uncultured bacterium gene for 16S rRNA, partial sequence

99

0

AB456168

pDGGE9


99

0

AB456168

pDGGE10

Uncultured bacterium clone MC1 16S 40 16S ribosomal RNA gene

95

0

EU662609

pDGGE11


99

0

AB456168

pDGGE12


99

0

AB456168

pDGGE14


94

0

AB234252

pDGGE15


96

5.00E121

AB252958

123


Discussion In the last decade the study of the stepwise degradation of chlorinated ethanes and ethenes has concentrated on isolates with particular focus on members of the genus Dehalococcoides (Van den Wijngaard et al. 1992). Several RDases specific for chlorinated aliphatics were characterized and sequenced, including genes from Dehalococcoides, Dehalospirillum, Clostridium, Desulfitobacterium and Dehalobacter (Marzorati et al. 2007). The application of culture-independent nucleic acid technology has greatly advanced the detection and identification of microorganisms in natural environments (Hurt et al. 2001). The use of molecular biology techniques with environmental samples has allowed researchers to examine facets of natural microbial communities that were previously inaccessible (Mumy and Findlay 2004). Microbial ecologists, systematicists, and population geneticists have become increasingly interested in methods for complete, unbiased isolation of DNA from the environment because such procedures promise to make the genomes of uncultured indigenous microorganisms available for molecular analysis (More et al. 1994). In this study, total DNA was isolated directly from a chlorinated hydrocarbon contaminated site in order to investigate the presence of reductive and hydrolytic dehalogenases. For the amplification of the reductive dehalogenases, 2 of the 8 primer sets used did not yield any amplicons. Sequencing of the individual amplicons generated with the remaining six primer sets revealed identities to Candidatus Methylomirabilis oxyfera (87%–Accession number: FP565575), Dehalococcoides sp. (99%–Accession number: AB274949); Deinococcus geothermalis DSM 11300 plasmid pDGEO01 (85%–Accession number: CP000358); and uncultured Dehalococcoides sp., vcrA gene (99%–Accession number: EU137842). A study conducted by Ettwig et al. (2010) involving the metagenomic sequencing of an enrichment culture, identified the anaerobic, denitrying, bacterium Candidatus Methylomirabilis oxyfera as the dominant organism in the population. The genome of this organism was sequenced and assembled (Ettwig et al. 2010). Annotation of the genes revealed that the bacterium encoded, transcribed and expressed the well-established aerobic pathway for methane oxidation; whereas it lacked known genes for dinitrogen production. The results obtained from this study extended an understanding of hydrocarbon degradation under anoxic conditions and explained the biochemical mechanism of a poorly understood freshwater methane sink (Ettwig et al. 2010). Organisms that have been explored or already used in bioremediation include some of the most solvent and broadly chemical tolerant species known (Pieper and Reineke 2000). In addition to Pseudomonas, species of Rhodococcus, Burkholderia, Enterobacter, Deinococcus, Bacillus,

and Nocardioides have been explored (Pieper and Reineke 2000). Examples of the recently explored organisms include Rhodococcus sp. and Deinococcus geothermalis (Nicolaou et al. 2010). The identification of a product showing significant identity (85%) to Deinococcus geothermalis poses an interesting finding for this study since the ultimate aim of working with contaminating material is to establish a bioremediation strategy, whereby microorganisms can be exploited for use as degraders of environmental pollutants. Therefore, the next step in this study involves sequencing of the entire metagenome by massive parallel sequencing (454 sequencing) in order to identify microorganisms producing novel genes that can be employed as biocatalysts. As mentioned previously, several RDases have been characterized and sequenced from Dehalococcoides. The PCR products generated in this study had significant identity (99%) with genes involved in dechlorination in Dehalococcoides. Recent studies conducted by Haest et al. (2010) showed that TCE can be biodegraded to cis-dichloroethene (cis-DCE), vinylchloride (VC) and eventually to the harmless ethene (ETH) through sequential reductive dechlorination reactions which occur under anaerobic conditions. Several bacterial species were able to metabolically convert TCE to cis-DCE, however, to date only Dehalococcoides has been found to perform the final step from VC to ETH (Haest et al. 2010). The identification of Dehalococcoides degradative genes within the metagenome holds promise with respect to bioremediation. In addition to RDases, hydrolytic dehalogenases was also identified in the contaminated material. The PCR amplicons generated showed 100% identity to hydrolytic dehalogenases from X. autotrophicus GJ10, indicating the possible presence of this organism in the bacterial population of the metagenome. The ability to degrade pollutants seems to be a common feature of Xanthobacter species as evidenced by Marchesi and Weightman (2003). In preliminary studies conducted by our research group X. autotrophicus had been isolated from the metagenome by enrichment. A significant advance in the field of microbial ecology was the evidence that the sequences of highly conserved genes that are found in all microorganisms, the 16S rRNA, could provide a phylogenetic characterization of the microorganisms present in a community. In this study, DGGE analysis (primers designed internal to the 16S rRNA) was performed on a multilevel sample in order to determine if diversity among the bacterial populations at the different levels could be detected. However, from the analysis (Fig. 1), a high level of commonality amongst the different levels was observed. The dominant bands present on the denaturing polyacrylamide gel were sequenced in order to gain insight into the type of microorganisms present in the contaminated sample. The sequence analysis revealed that 66% of the cloned fragments showed

123


significant identities (95–99%) with uncultured microorganisms. However, no clones displaying 100% to any of the known microorganisms was detected. Phylogenetic analysis of the sequences revealed that the DGGE clones clustered on their own into two groups when compared to known bacterial CAH degraders. This indicated that the sequences of the clones were diverse. This diversity represents a largely untapped genetic pool that can be exploited for the discovery of novel biocatalysts that can be employed in bioremediation. In conclusion, the results obtained from this study highlighted the presence of both hydrolytic and reductive dehalogenases present at the contaminated site. This finding provides strong evidence that bacteria capable of dehalogenation of chlorinated hydrocarbons may colonise contaminated sites without introduction and this is particularly important from the viewpoints of toxicology and bioremediation. The co-existence of a mixture of chlorinated hydrocarbons and the manner in which the indigenous microorganisms with the introduction of bioaugmentation and biostimulation perform their degradation capabilities is currently being investigated. Acknowledgments The authors wish to thank the National Research Foundation of South Africa for financial support and Inqaba Biotechnical Industries (Pty) Ltd (Pretoria, South Africa) for performing the sequencing reactions.

References Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 Ernst T (2009) Use of Dehalococcoides to bioremediate groundwater contaminated with chlorinated solvents. MMG 445 Basic Biotech 5: ISSN 1944-3277 Ettwig KF, Butler MK, Le Paslier D, Pelletier E, Mangenot S, Kuypers M, Schreiber MM, Dutilh F, Zedelius BE, de Beer J, Gloerich D, Wessels J, van Alen JCT, Luesken T, Wu F, van de Pas-Schoonen ML, Op den Camp KT, Janssen-Megens HJM, Francoijs EM, Stunnenberg KJ, Weissenbach H, Jetten J, Strous MSM (2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria. Nature 464:543–548 Futagami T, Yamaguchi T, Kakayama S, Goto M, Furukawa K (2006) Effects of chloromethanes on growth of and deletion of the pce gene cluster in dehalorespiring Desulfitobacterium hafniense strain Y51. Appl Environ Microbiol 72(9):5998–6003 Grostern A, Edwards EA (2006) Growth of Dehalobacter and Dehalococcoides spp. during degradation of chlorinated ethanes. Appl Environ Microbiol 72(1):428–436 Haest PJ, Springael D, Smolders E (2010) Dechlorination kinetics of TCE at toxic TCE concentrations: Assessment of different models. Water Res 44:331–339

123

Hurt RA, Qiu X, Wu L, Roh Y, Palumbo AV, Tiedje JM, Zhou J (2001) Simultaneous recovery of RNA and DNA from soils and sediments. Appl Environ Microbiol 67(10):4495–4503 Janssen DB, Pries F, van der Ploeg J, Kazemier B, Terpstra P, Witholt B (1989) Cloning of 1, 2-dichloroethane degradation genes of Xanthobacter autotrophicus GJ10 and expression and sequencing of the dhlA gene. J Bacteriol 171:6791–6799 Johnson DR, Lee PKH, Holmes VF, Fortin AC, Alvarez-Cohen L (2005) Transcriptional expression of the tceA gene in a Dehalococcoides-containing microbial enrichment. Appl Environ Microbiol 71(11):7145–7151 Kumar S, Dudley J, Nei M, Tamura K (2008) MEGA: A biologistcentric software for evolutionary analysis of DNA and protein sequences. Briefings Bioinf 9:299–306 Lovely DR (2003) Cleaning up with genomics: Applying molecular biology to bioremediation. Microbiology 1:35–44 Marchesi JR, Weightman AJ (2003) Comparing the dehalogenase gene pool in cultivated-halocarboxylic acid-degrading bacteria with the environmental metagene pool. Appl Environ Microbiol 69(8):4375–4382 Marzorati M, de Ferra F, Van Raemdonck H, Borin S, Allifranchini E, Carpani G, Serbolisca L, Verstraete W, Boon N, Daffonchio D (2007) A novel reductive dehalogenase, identified in a contaminated groundwater enrichment culture and in Desulfitobacterium dichloroeliminans strain DCA1, is linked to dehalogenation of 1,2-dichloroethane. Appl Environ Microbiol 73(9):2990–2999 More MI, Herrick JB, Silva MC, Ghiorse WC, Madsen EL (1994) Quantitative cell lysis of indigenous microorganisms and rapid extraction of microbial DNA from sediment. Appl Environ Microbiol 60(5):1572–1580 Mumy KL, Findlay RH (2004) Convenient determination of DNA extraction efficiency using an external DNA recovery standard and quantitative- competitive PCR. J Microbiol Methods 57:259–268 Muyzer G, Brinkhoff T, Nu¨bel U, Santegoeds C, Scha¨fer H, Wawer C (1997) Denaturing gradient gel electrophoresis (DGGE) in microbial ecology. Kluwer Academic Publishers, Dordrecht, pp 1–27 Nicolaou SA, Gaida SM, Papoutsakis ET (2010) A comparative view of metabolite and substrate stress and tolerance in microbial bioprocessing: From biofuels and chemicals, to biocatalysis and bioremediation. Metab Eng doi.org/10.1016 Pieper DH, Reineke W (2000) Engineering bacteria for bioremediation. Curr Opin Microbiol 11(3):262–270 Poelarends GJ, Wilkens M, Larkin J, van Elsas JD, Janssen DB (1998) Degradation of 1,3-dichloropropene by Pseudomonas cichorii 170. Appl Environ Microbiol 64:2931–2936 Rees HC, Oswald SE, Banwart SA, Pickup RW, Lerner DN (2007) Biodegradation processes in a laboratory-scale groundwater contaminant plume assessed by flourescence imaging and microbial analysis. Appl Environ Microbiol 73(12):3865–3876 Ritalahti KM, Amos BK, Sung Y, Wu Q, Koenigsberg SS, Lo¨ffler FE (2006) Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Appl Environ Microbiol 72(4):2765–2774 Van den Wijngaard AJ, van der Kamp KWHJ, van der Ploeg J, Pries F, Kazemier B, Janssen DB (1992) Degradation of 1,2-dichloroethane by Ancylobacter aquaticus and other facultative Methylotrophs. Appl Environ Microbiol 58:976–983 Van der Ploeg J, Willemsen M, van Hall G, Janssen DB (1995) Adaptation of Xanthobacter autotrophicus GJ10 to bromoacetate due to activation and mobilization of the haloacetate dehalogenase gene by insertion element IS1247. J Bacteriol 177(5):1348–1356