position. Fragments are located by Southern blotting with specific mtDNA probes. With just .... mtDNA clones can be used to probe the same samples of. DNA, resulting in a ... to clear blood; then homogenized by hand in a ground glass Ten-Broeck ... 2). Hybridization was performed overnight at 65°C in a solution contain-.
ANALYTICAL
BIOCHEMISTRY
196,427-432
(19%)
Denaturing Gradient Gel Method for Mapping Single Base Changes in Human Mitochondrial DNA Kyunglim
L. Yoon, Josephine S. Modica-Napolitano,
Mitochondrial
Received
Physiology
February
Unit, Department
of Biology,
Inc.
Mitochondrial DNA (mtDNA) analysis is useful in many areas of research, such as anthropology (1,2), evolution (3,4), population genetics (4), and human metabolic disease (5). Unlike nuclear DNA, the mitochon1 To whom dressed.
Medford,
Massachusetts
02155
26,199l
A denaturing gradient gel electrophoresis (DGGE) method is described that detects even single base pair changes in mitochondrial DNA (mtDNA). In this method, restriction fragments of mtDNA are electrophoresed in a urealformamide gradient gel at 60°C. Migration distance of each mtDNA fragment in the gel depends on melting behavior which reflects base composition. Fragments are located by Southern blotting with specific mtDNA probes. With just four carefully chosen restriction enzymes and as little as 50-100 ng of mtDNA, the method covers almost the entire human mitochondrial genome. To demonstrate the method, human mtDNA was analyzed. In six normal individuals, DGGE revealed melting behavior polymorphisms (MBPs) in mtDNA fragments that were not detected by restriction fragment length polymorphism (RFLP) analysis in agarose gels. Another individual, shown to have a melting behavior polymorphism in the cytochrome b coding region, was studied in detail. By mapping, the mutation was deduced to lie between nt 14905 and 15370. The affected fragment was amplified by PCR and sequenced. Specific base changes were identified in the region predicted by the gel result. This method will be especially useful as a diagnostic tool in mitochondrial disease for rapid localization of mtDNA mutations to specific regions of the genome, but DGGE also could complement RFLP analysis as a more sensitive method to follow maternal lineage in human and animal popo 1991 Academic ulations in a variety of research fields. Press,
Susan G. Ernst, and June R. Aprille’
Tufts University,
correspondence
0003-269’7/91 $3.00 Copyright 0 1991 by Academic Press, All rights of reproduction in any form
and
reprint
requests
should
be ad-
drial genome in animals has high rates of mutation and fixation and it is maternally inherited. These characteristics result in mtDNA polymorphisms whose maternal lineage can be followed to study population dispersal and subgroup isolation in a particular species, as well as evolutionary relationships among different species. In medicine, mtDNA analysis is being used to investigate the molecular basis of mitochondrial disease. So far, standard RFLP’ analysis has been the method most widely used to study mtDNA. However, RFLP analysis can routinely detect only length changes of >50 bp or mutations at restriction sites for the particular enzymes that are employed. Although resolution can be improved by specialized techniques (6), the number of enzymes that can be used may be limited by the size of the DNA sample. The alternative of sequencing large portions of the mitochondrial genome to look for mutations is not practical, especially when the study involves a large number of samples that might have unique differences in mtDNA. The purpose of this paper is to demonstrate the application of a denaturing gradient gel electrophoresis (DGGE) method (described first by Gray et al., 1991, for nuclear DNA) to the analysis of mtDNA for rapid screening of mtDNA mutations. In contrast to RFLP analysis, the DGGE method is sensitive enough to detect even single base pair changes in restriction fragments (7). We developed the method for mtDNA in order to make rapid and specific molecular diagnoses in cases of human mitochondrial disease, but it has the potential to be applied much more broadly. For example, because DGGE routinely detects many more base changes than does RFLP analysis, it reveals more poly-
’ Abbreviations used: RFLP, restriction fragment length polymorphism; DGGE, denaturing gradient gel electrophoresis; MBP, melting behavior polymorphism; BSA, bovine serum albumin; SSC, standard saline citrate; SDS, sodium dodecyl sulfate; PCR, polymerase chain reaction. 427
Inc. reserved.
428
YOON
morphisms in mtDNA, thus allowing maternal lineage in populations to be followed in greater detail. In the DGGE procedure, restriction fragments of mtDNA are electrophoresed on a denaturing gradient gel at 6O’C. As a fragment migrates, it reaches denaturing conditions sufficient for the dsDNA to form a melting domain, and the migration rate of the DNA fragment then decreases abruptly. Any change in base pairing will alter the melting behavior of the restriction fragment, resulting in an altered rate of migration through the gel compared to control or wild-type. We use the term “melting behavior polymorphism,” or MBP, to describe these differences, because fragments are distinguished by melting behavior, not by length as in RFLPs. The final position of restriction fragments in the gel is detected and compared by standard Southern blotting and hybridization techniques. Since nylon membranes can be reprobed as many as 20 times without a decrease in signal, all 15 of the available human mtDNA clones can be used to probe the same samples of DNA, resulting in a complete scan of the whole genome with very small amounts of DNA. If a MBP is found, the amount of sequencing required to define the mutation can be minimized by mapping to localize the mutation to a particular defined restriction fragment. Preliminary reports of the use of DGGE for analysis of mtDNA have been presented elsewhere (8,9). MATERIAL
Isolation
AND
METHODS
of Mitochondria
Human liver and muscle samples were obtained as amounts available in excess of that needed for pathology following surgical or autopsy procedures, all performed with consent. A mitochondrial fraction was isolated from frozen tissue by differential centrifugation essentially as described by Bookelman et al. (10). The tissue was minced in ice-cold 0.25 M sucrose, 50,000 units heparin/liter, and 1 mM Tris-HCl, pH 7.4; rinsed to clear blood; then homogenized by hand in a ground glass Ten-Broeck homogenizer. The homogenate was centrifuged at 600g for 10 min; the resulting supernatant fraction was centrifuged at 14,000g for 10 min. For liver, the 14,OOOg pellet was washed once by resuspending and centrifuging again. For muscle, the surface of the pellet was rinsed by gently shaking with a few drops of homogenizing solution which was aspirated and discarded along with any dislodged material. Total mtDNA
Probes for RFLP
Analysis
MtDNA was isolated from mitochondrial fractions by standard procedures (11). Twenty nanograms of PvuIIlinearized mtDNA from human liver was separated by electrophoresis in 0.8% low melting agarose and labeled directly from molten agarose by the random-primer
ET
AL. ATPase6l6
1 0
2
4
6
6
10
12
14
16 kb
Ddel
Haelll
Hphl
Mboll
FIG.
1. The distribution of 200 to 700-bp fragments of human mtDNA which were produced by four restriction enzymes. The top panel is a map of mtDNA. In the other panels, the 200 to 700-bp fragments are indicated by shaded areas for each of the four enzymes used. The combination of enzymes used generates DNA fragments that cover almost the entire mitochondrial genome.
method cm/w
(12). The specific activity
was about 7 X 10’
RFLP Analysis Total cellular DNA was isolated by standard methods from frozen tissues (13). Five to 10 pg of each DNA sample were digested with EcoRI, &r&II, PstI, and XbaI, electrophoresed through 0.8% agarose, and transferred to nitrocellulose filters. The filters were then probed with total human linearized mtDNA that was 32P labeled by random priming as described above (14). Denaturing Gradient Gel Electrophoresis MtDNA was isolated from a mitochondrial fraction prepared from frozen tissue as described above. Twenty-nanogram aliquots of mtDNA were digested with DdeI, HaeIII, HphI, and MboII. These particular enzymes were chosen from the mtDNA restriction map to generate fragments of 200-700 bp which is the optimal size for DGGE analysis and to cover almost the entire mitochondrial genome (Fig. 1). The mtDNA fragments were electrophoresed in 6.5% acrylamide gels
GRADIENT
GEL
ASSAY
FOR
ATPawS/ ND3 co2 I co3 1
16s
ND1
ND2
4 ND4U4
co1
BASE
ND6
4 4 iA 125
MAPPING
ND5
Wb
I
I
I
I
I
I
I
I
I
0
2
4
6
0
10
12
14
16kb
00 0 13
15
14
FIG. 2. Localization of the mitochondrial clones which were employed as the mtDNA probes in denaturing gradient gel analysis. The mtDNA clones are indicated by numbered boxes 1-15. Each fragment corresponds to the following sequences: 1 (41-2578), 2 (25784122), 3 (4122-5274), 4 (5274-6204), 5 (6204-7441), 6 (7441-8287), 7 (82878592), 8 (8592-9648), 9 (8729-10,254), 10 (10,254-11,922), 11 (11,92212,641), 12 (11,680-12,570), 13 (14,956-16,053), 14 (15,591-16,569), and 15 (16,134-41).
with either a 20-80% or a 30-80% denaturant range (100% denaturant = 7 M urea/40% formamide). The gel was poured between glass plates at a thickness of 0.85 mm using a gradient maker (Hoefer SG 100). The gel was submerged in a 60°C aquarium (Green Mountain Lab Supplies) filled with 1X TAE buffer (40 mM Tris, 20 mM sodium acetate, 1 mM EDTA, pH 7.4, with glacial acetic acid), and run at 65 V for 18 h. After electrophoresis, the gel was eIectroblotted onto a Nytran (Schleicher and Schull) membrane and hybridized with nick-translated specific mtDNA clones which were kindly provided by Dr. Giuseppi Attardi (Fig. 2). Hybridization was performed overnight at 65°C in a solution containing 10X Denhardt’s solution (50X Denhardt’s = 1% polyvinyl pyrrolidone, 1% BSA, and 1% Ficoll), 5~ SSC, 1% SDS, and 100 pg/ml denatured salmon sperm DNA. Filters were washed three times for 30 min in a solution containing 1X SSC and 1% SDS at 65°C. Films were exposed for only l-6 h to avoid signals from nuclear DNA. Prior to each subsequent hybridization, the probe was removed from the Nytran membrane by boiling in water for 10 min.
CHANGES
IN
MITOCHONDRIAL
429
DNA
plete, the reactions were incubated an additional 7 min at 72°C to ensure completion of final extensions. In the example we present here, primers for PCR (synthesized by Operon Technologies) were designed to bracket the mtDNA sequence represented by probe 13 (Fig. 2). The nucleotide sequences of the oligonucleotide primers are as follows: Primer A: 5’ 16085 GCGGTTGTTGATGGGTGAGT 16066 3 Primer B: 5’ 14947 CCACATCACTCGAGACGTAA 14966 3 DNA Sequencing The DNA fragment amplified by PCR was purified by electrophoresis in a 1% agarose gel followed by electroelution of the fragment. The resulting fragments were digested with XhoIIKpnI and cloned into XhoIIKpnI sites in pGEM-7zf(+). Two different batches of PCR products were used for sequencing to avoid a possible PCR error due to Taq polymerase. The insert was deleted subsequently using the Erase-A-Base system (Promega). The nucleotide sequence of ordered sets of the deleted insert was determined by the dideoxy nucleotide method (15). A sequencing kit (United States Biochemicals) was used for the sequenase reaction. Samples were loaded and run on a 6% polyacrylamidel7 M urea sequencing gel and autoradiographed. RESULTS
To demonstrate the sensitivity of the method for detecting mutations, we determined the number of polymorphisms that could be found in normal individuals by DGGE as compared to RFLP analysis using limited
Pst 1 i234567ab
I
EcoR
I
Polymerase Chain Reaction A selected region of mtDNA was amplified from 200 ng of total DNA using a Gene Amp DNA amplification reagent kit (Perkin-Elmer Cetus). The reactions were performed in a DNA thermal cycler (Perkin-Elmer Cetus) using the following cycle profile: denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 1 min, for a total of 25 cycles. There was a preincubation without Taq DNA polymerase at 95°C for 10 min before cycling. After the last cycle was com-
FIG. 3. Southern blot normal individuals (I-VI). was digested with PstI or ted, and hybridized with lane 2, II-L, lane 3, III-L; lane 7, V-L; lane 8, V-M;
analysis of total DNA from six unrelated Total DNA from liver (L) and muscle (M) EcoRI, resolved in 0.8% agarose gels, blotlabeled total human mtDNA. Lane 1, I-L, lane 4, III-M, lane 5, IV-L; lane 6, IV-M; lane 9, VI-M.
430
YOON
Hm III
A.
ET
AL.
Hph I
-123456123456123456
Hae Ill 0.
1234
FIG. 4. Denaturing gradient gel analysis of human mtDNA from liver (L) and muscle (M) of three normal restriction enzyme digested mtDNAs were electrophoresed in a 20-80% denaturing gradient gel (A) or a 30-80% and hybridized with probe 6. The arrow in (B) denotes the second band with Hoe111 that was resolved as a MBP the denaturant gradient from 20-80% (A) to 30-80% (B). Lane 1, IV-M; lane 2, IV-L; lane 3, V-M; lane 4, V-L;
amounts of mtDNA. Nine control tissue samples from six different individuals (paired liver and muscle from three different individuals, one other muscle sample and two additional liver samples) were first analyzed by RFLP. The DNA fragments generated by four restriction enzymes (HindIII, EcoRI, PstI, and X&I) did not show any length differences or restriction site polymorphisms. Figure 3 is representative of the blots and shows the DNA samples cut with PstI (fragments 14.5 and 2 kb) and EcoRI (fragments 8, 7.4, and 1.1 kb). When these same samples were further analyzed by the more sensitive DGGE method, several polymorphisms were detected among individuals. Twenty-nanogram aliquots of each mtDNA sample were digested with D&I, HphI, and HueIII, electrophoresed in a 2080% denaturing gradient gel, and electroblotted to a nylon membrane as described under Materials and Methods. We happen to be especially interested in coding regions for COX I, COX II, COX III, and cytochrome b, so. specific mitochondrial clones 5 (nt 6204-7441), 6 (nt 7441~8287), 9 (nt 8729-10,254), and 13 (nt 14,95616,053) were used here as probes to illustrate DGGE analysis (Fig. 2). For three of the probes (5,9, and 13), restriction fragments from all nine mtDNA samples migrated identically (not shown). However, when the filter was hybridized with probe 6 which encodes the gene for COX II, the DdeI and Hoe111 restriction fragments from liver and muscle of one individual (lanes 3 and 4 in Fig. 4A) migrated differently compared to the other individuals. From the result in Fig. 4A, it appeared that mtDNA from individual V might be missing one of the
individuals (III, IV, V). The denaturing gradient gel (B) in individual V by narrowing lane 5, III-M; lane 6, III-L.
two Hue111 fragments that are normally detected with probe 6. However, by narrowing down the denaturant gradient from 20-80% to 30-80%, both bands were resolved with one appearing as a MBP (Fig. 4B). In some applications of the method, especially in studies of mitochondrial disorders, it is important to know the base changes that are responsible for the MBPs detected by DGGE. Only a limited amount of sequencing is required, since any mutation can be localized to a specific fragment by mapping. Another individual’s mtDNA was studied to illustrate the principles and procedures involved. Once again, no polymorphisms were detected by RFLP analysis using four restriction enzymes (data not shown). DGGE analysis showed no polymorphisms with probes 5 and 6 (data not shown). However, a MBP was detected with probe 13 (band b in Fig. 5A). At this point, it would be logical to sequence only the affected fragment rather than the entire region of mtDNA covered by the probe used in order to minimize the sequencing task. However, fragment position in DGGE gels depends on nucleotide composition and consequent melting behavior, and not on fragment size. Therefore, the mtDNA fragments in the gels must be mapped in order to know which portion of the genome corresponds to the affected fragment. Ultimately, we plan to map all the mtDNA fragments that are detected in this gel system for the combination of restriction enzymes and the mtDNA clones that we use routinely. Such mapping can be done by eluting individual restriction fragments that are separated by size on agarose gels and then using those fragments as probes to find the
GRADIENT
GEL
I234
ASSAY
FOR
MAPPING
I234 B.
-a
C.
*
14905
I13
15475
-a
# 14
4
*
*
16255
7
FIG. 5. An example of mapping of MBPs in liver (L) and muscle (M) mtDNA using overlapping clones. A 30-80% denaturing gradient gel blot was hybridized with probe 13 (A) or probe 14 (B). The mtDNA in all lanes was digested with HphI. Lane 1, example case M; lane 2, example case L; lane 3, control M; lane 4, control L. (C) Illustrates the mtDNA fragments (200-700 bp) resulting from digestion with HphI that will be detected with the probes. There are two fragments hybridized with probe 13 (hatched and shaded boxes) and three fragments hybridized with probe 14 (shaded and dotted boxes). The shaded box indicates the region of overlap which defines the “a” fragment. The hatched box corresponds to the “b” fragment and dotted boxes represents the “c” and “d” fragments. The region covered by each of the probes used is shown by lines with arrows. Numbers denote the HphI restriction enzyme sites (in nucleotides) of the mtDNA.
same fragment in DGGE gels. Meanwhile, it has been possible to do some mapping by probing the DGGE gels with overlapping clones. For example, to map the MBP detected with probe 13 in Fig. 5A, we probed the same gel with another probe, clone 14 (Fig. 5B). Figure 5C shows that with HphI, two fragments are expected with probe 13 (nt 14,905-15,370 and nt 15,475-16,060) and three fragments are expected with probe 14 (nt 15,47516,060, nt 16,061-16,255, and nt 16,256-7). Since one of the fragments (nt 15,475-16,060) is detected by both probes, it must be the one marked “a” in Fig. 5A and 5B, which migrates identically for both mtDNA samples shown. Therefore, the other fragment detected with probe 13 must be nt 14,905-15,370; it is this fragment, labeled “b” in Fig. 5A, that shows a MBP in our example case. The “c” fragment in Fig. 5B shows another MBP that must be either nt 16,061-16,255 or nt 16,256-7, which is in the highly variable D loop region of the mito-
BASE
CHANGES
IN
MITOCHONDRIAL
DNA
431
chondrial genome (16). For some reason, the extra bands above “a” in Fig. 5B showed up in every lane when the filter was hybridized with probes 14 and 15. Now, to find the specific base change(s) responsible for the MBP in Fig. 5A, it was only necessary to sequence fragment “b.” For this demonstration, we chose to amplify the entire region defined by probe 13 (nt 14,956-16,053) and then to sequence from the 5’ end. Accordingly, the probe 13 region of the genome was amplified from total mtDNA in the example case, using the primers and procedures detailed under Materials and Methods. The expected l.l-kb product was obtained and was cloned into the XhoIIKpnI site of a pGEM vector for sequencing. Compared to the published sequence for human mtDNA (16), two G to A base changes were found, at nt 15,301 and nt 15,314, which are in the region predicted by mapping. Base changes that lower GC content are expected to cause melting at lower concentrations of denaturant; the result in Fig. 5A is consistent with this prediction, since the fragment “b” MBP is nearer the top of the gel in the example case. The G to A transition at nt 15,301 is silent (Leu). The one at nt 15,314 changes amino acid 190 from alanine to threonine in one of the a! helical transmembrane domains of cytochrome b; this is probably a benign polymorphism (17). Compared to the published sequence we noted one other base difference, G instead of A at nt 15,326; however, this is likely to represent a polymorphism in the published sequence because all individuals studied subsequently have a G at nt 15,326 (Dr. Neil Howell, personal communication). DISCUSSION In the present study, we have demonstrated that DGGE analysis of mtDNA can detect polymorphisms that are not readily detectable by RFLP analysis. We found two MBPs in the region of probe 6 (COX II) in one of six individuals who were apparently identical by limited RFLP analysis. It is interesting that no polymorphisms were found in the regions of probes 5,9, and 13 which suggests that COX II is less conserved than COX I, COX III, and cytochrome b. It has been demonstrated that COX II has the least conserved amino acid sequence among the highly conserved mitochondrial proteins (16). In another individual, we found MBPs in the cytochrome b region. Because benign polymorphisms will be detected with high frequency by DGGE as shown in our demonstration cases, MBPs could be judged for pathological significance in patients with mitochondrial disease by comparing them to the mother or siblings before sequencing, provided these relatives are asymptomatic. In the example case in Fig. 5A, the shift of the “b” fragment which was mapped between nt 14,905-15,370 was ascribed to two G to A base changes at nt 15,301 and nt 15,314. These changes caused an increase in the AT
432
YOON
content of the DNA sequences, which enhances melting. Thus the AT-enriched fragment migrated a shorter distance into the gel and stopped where the denaturant concentration was lower compared to the same fragment in controls. In DGGE, optimum separations are obtained with fragments that are 200-700 bp. In our study, DdeI, HaeIII, HphI, and Mb011 were chosen to generate fragments of suitable length and to cover most of the mitochondrial genome. Only four restriction enzymes are used so that a minimum amount of mtDNA is required for complete analysis. Also four digests can conveniently be examined in a single gel. Only a few small regions, those at nt 626-676 (12 S), 945-973 (12 S), 9476-9741 (COX III), 10,226-10,357 (ND3), and 12,007-12,297 (ND4, tRNAhi” and tRNA=‘), which together comprise less than 4% of the genome, are not covered by using this set of restriction enzymes. Although DGGE can be used as a rapid screening method for mapping single base changes as well as small deletions, insertions, and rearrangements, mutations are detectable only in the first melting domain of each fragment which is often just 100-200 bp in length. Base differences outside the melting domain or sequences in the second melting domain (highest GC content) will not be detected. However, this is overcome to a great extent by using four restriction enzymes that expose different melting domains of the DNA. Further improvement might be made by using a “GC clamp” (18); in this technique a GC-rich DNA sequence is attached next to the target DNA fragment so base differences in the second melting domain of the native fragment can be detected more readily. Approximately 77% of single base changes were detected in rosy locus of Drosophila melunogczster without the GC clamp (19) and almost all single base changes were detected in the P-globin promoter by attaching a GC clamp (18). By adjusting the range of denaturant concentration, any shifts in the gel can be magnified to increase resolution as shown in Fig. 4. Most of the fragments should appear as sharp and focussed bands if they are electrophoresed long enough. However, as seen in Fig. 5B, band “c” was diffuse, probably because of the simultaneous melting of two regions of the DNA fragments (19). There are other gel methods for detecting single base changes that could be applied to analysis of mtDNA. For example, mismatches in RNA-DNA hybrids can be cleaved by RNAase and can be detected in acrylamide gels without denaturant (20). Also mutations in denatured unlabeled DNA can be detected in denaturing gels using a single-stranded labeled probe because mutant mismatched heteroduplexes alter melting behavior compared to the wild-type homoduplexes (21,22). These other methods can complement the use of DGGE for
ET
AL.
screening single base changes as an alternative to sequencing lengthy DNA fragments. DGGE already has been used to study human nuclear DNA polymorphisms (22) and genetic disease such as /3-thalassemia (21). The extension of the method to mtDNA analysis should prove useful for many interesting problems in a variety of research fields. ACKNOWLEDGMENTS We are grateful to Dr. Mark Gray for advice about denaturing gradient gel analysis, Alec Gross for helping with isolation of mitochondria, and Dr. Giuseppi Attardi and Dr. Eric Schon for providing the mitochondrial clones. This work will be submitted by K. L. Yoon in partial fulfillment of requirements for the Ph.D in Biology. The work was supported by NIH HD16936, NIH BRSG, the Charles H. Hood
Foundation,andNSF DCB 9009scl. REFERENCES 1. Krtiger,
J., and Vogel,
F. (1989)
2. Schurr, T. G., Ballinger, wether, D. A., Lawrence, Wallace, D. C. (1990) 3. Cann, R. L., Stoneking,
Human Genet. 82,308-312.
S. W., Gan, Y. Y., Hodge, J. A., MerriD. N., Knowler, W. C., Weiss, K. M., and
Am. J. Hum. Genet. 46,613-623. M., and Wilson, A. C. (1987) Nature 326,
31-36. 4. Gray, M. W. (1989) Annu. Rev. Cell Biol. 5, 25-50. 5. Grossman, L. I. (1990) Am. J. Hum. Genet. 46,415-417. 6. Cann, R. L., and Wilson, A. C. (1983) Genetics 104,699-711. 7. Fisher, S., and Lerman, L. (1983) Proc. Natl. Acad. Ski. USA 80, 1579-1583. 8. Yoon, K.
L., Aprille,
J. R., and Ernst, 1112-1115. 9. Aprille, J. R., Yoon, K. L., Modica-Napolitano, S. G. (1990) Ped. Res. 27(4), A128.
S. G. (1991)
Biochem.
Biophys. Res. Comm. 176,
J. S., and Ernst,
M. F., Sengers, R. C. A., and Janssen, Med. 19, 366-373. 11. Palva, T. K., and Palva, E. T. (1985) FEBS L&t. 192,267-270. 12. Feinberg, A. P., and Volgelstein, B. (1983) Anal. Biochem. 132, 6-13. 13. Davids, L. G., Dibner, M. D., and Battey, J. F. (Eds.) (1986) Basic 10. Bookelman, H., Trijbels, A. J. M. (1978) Biochm.
Methods 14. Zeviani, Schon, 1346. 15. Sanger,
in Molecular
J.
Biology,
pp. 47-50.
Elsevier,
New
York.
M., Moraes, C. T., DiMauro, S., Nakase, H., Bonilla, E., E. A., and Rowland, L. P. (1988) Neurology 38, 1339F., Nicklen,
S., and Coulson,
A. (1977)
Proc. Natl. Acad.
Sci. USA 74,5463-5467. 16. Anderson, S., Bankier, A. T., Barrell, B. G., deBrujin, M. H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., and Young, I. G. (1981) Nature 290,457-465. 17. Howell, N., and Gilbert, K. (1988) J. Mol. Biol. 203,607-618. 18. Myers, (1985)
R. M., Nucleic
Fischer,
S. G., Lerman, L. S., and Maniatis, 3131-3145.
T.
Acids Res. 13(g),
19. Gray, M., Charpentier, A., Walsh, K., Wu, P., and Bender, W. (1991) Genetics 127, 139-149. 20. Myers, R. M., Larin, Z., and Maniatis, T. (1985) Science 230, 1242-1246. 21. Myers, R. M., Lumelsky, N., Lerman, L. S., and Maniatis, T.
(1985) Nature 313, 495-498. 22. Noll, W. W., and Collins, M. (1987) 84.3339-3343.
Proc. Natl. Acad. Sci. USA
