detected in expression sequence t

Microbiol Immunol 2011; 55: 790–797 doi:10.1111/j.1348-0421.2011.00377.x

ORIGINAL ARTICLE

Lipopolysaccharide-induced innate immune factors in the bottlenose dolphin (Tursiops truncatus) detected in expression sequence tag analysis Kazue Ohishi1 , Reiko Shishido1,2 , Yasunao Iwata1,2 , Masafumi Saitoh1,2 , Ryota Takenaka3 , Dai Ohtsu3 , Kenji Okutsu3 and Tadashi Maruyama1,2 1

Marine Biodiversity Research Program, Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Yokosuka, Kanagawa 237-0061, Japan Graduate School of Marine Science and Technology, Tokyo University of Marine Science and Technology, Tokyo 104-8477, Japan 3 Yokohama Hakkeijima Sea-Paradise, Yokohama, Kanagawa 236-0006, Japan 2

ABSTRACT EST analysis based on the megaclone-megasorting method was performed using leukocytes from the bottlenose dolphin (Tursiops truncatus) with or without LPS stimulation. A total of 849 upregulated and 384 downregulated EST clones were sequenced, annotated, and functionally classified. Ferritin heavy peptide I was the most abundant upregulated transcript, suggesting that LPS stimulation induced high production of reactive oxygen species, which were sequestered in ferritin. Among the immune factors, the transcripts coding for an IL-1Ra, homologs to bovine serum amyloid A3, and canine intercellular adhesion molecule-1 were highly expressed. Markedly downregulated transcripts of immune factors were those for homologs of calcium-binding proteins belonging to the S100 family, S100A12, S100A8, and S100A6. Time-course experiments on the expression of some immune factors including IL-1Ra suggested that these factors interact and control cetacean innate immunity. Key words Cetacean, expressed sequence tag, innate immunity, lipopolysaccharide.

Many antibiotics had been discovered and used to control bacterial infectious diseases by the end of the twentieth century. However, in the twenty-first century, bacterial infectious diseases are again posing great threats to human and wild animal health, including marine mammals. Infection with Brucella spp. has been reported in marine animals from oceans worldwide (1, 2). For the conservation of marine mammals, studies on both infectious agents and protective immune mechanisms against bacteria are important. Mammals have two immune systems: innate immunity for non-specific rapid immune responses; and

acquired immunity for highly specific responses with gene arrangement and memory. The host antimicrobial defense response is initiated by the innate immune system, which involves multiple coordinated factors such as complements, acute-phase proteins, C-type lectins, pattern recognition molecules, and various cytokines (3, 4). The TLR family is a group of well-characterized pattern recognition molecules sensing microbial components, which not only plays an important role in innate immunity but also activates acquired immunity (5, 6). LPS is a major constituent of the outer membrane of Gram-negative

Correspondence Kazue Ohishi, Marine Biodiversity Research Program, Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Yokosuka, Kanagawa 237-0061, Japan. Tel: +81 46 867 9524; fax: +81 46 867 9525; email address: [email protected] Received 23 June 2011; revised 17 July 2011; accepted 21 July 2011. List of Abbreviations: EST, expressed sequence tag; FACS, fluorescence-activated cell sorting; ICAM, canine intercellular adhesion molecule; IL-1Ra, interleukin-1 receptor antagonist; LPS, lipopolysaccharide; MD-2, myeloid differentiation factor; MLR, mixed lymphocyte reaction; ROS, reactive oxygen species; TLR, Toll-like receptor; TNF-α, tumor necrosis factor-α.

790

c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

Innate immune factors in cetacean leukocytes

bacteria and is known to be a strong elicitor of innate immune responses. TLR4 recognizes LPS in cooperation with MD-2 and induces the expression of inflammatory cytokines such as IL-1, IL-6, and TNF-α (7, 8). In addition, recent studies have shown that TLRs also recognize self-antigens released from stressed or damaged host tissues, and such self-recognition factors are known to promote the development of autoimmune diseases or cancer in humans (9–11). In cetaceans, the genome of the bottlenose dolphin (Tursiops truncatus) has been reported, although the annotation of the sequences is not complete. Extensive studies on the expression of immune factors in cetaceans have also been reported (12, 13). However, it is still necessary to accumulate immunological information including the time-course of and interactions among the expression of immune factors to understand the cetacean innate immune system and for progress in veterinary medicine. In this study, we first examined how certain innate immune factors respond to LPS in cetacean leukocytes by performing EST analysis using a megaclone-megasorting method. This method, which was developed by Brenner et al. (14), is based on in vitro cloning of DNA mixtures on microbeads and the separation of differently expressed cDNA. It is suitable for determining differences in gene expression with or without immune stimulation. We also studied the time course of the expression of LPS-stimulated innate immunity-related genes together with those of inflammatory cytokines, TLR4, and MD-2.

MATERIALS AND METHODS EST analysis

Blood samples were obtained from eight healthy bottlenose dolphins kept at Yokohama Hakkeijima SeaParadise Aquarium (Yokohama Aqua Resort Co. Ltd., Yokohama, Japan). Leukocytes were separated from each of the blood samples following a previously reported method (15), and the samples from eight dolphins were mixed for EST analysis. One-half of the leukocytes (approximately 7×107 cells) was stimulated with 25 μg/mL LPS from Salmonella minnesota strain R595 (ENZO Life Science Co., Farmingdale, NY, USA) for 5 hr at 37◦ C. Total RNA was extracted from both stimulated and unstimulated leukocytes and converted to cDNA using 5’-biotinylated T7-Oligo-dT primer and a reverse transcriptase (Takara Bio Inc., Ohtsu, Japan). EST analysis was performed using a megaclonemegasort technique (Takara Bio Inc.), which was a modc 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

Fig. 1. Flow cytometry profile of competitive hybridization of cDNA clones from LPS-stimulated and unstimulated lymphocytes on microbeads. Approximately 4×105 megaclone beads were hybridized with a 1:1 mixture of cDNA probes prepared from LPSstimulated (Cy5) and unstimulated (fluorescein) leukocytes as described in the Materials and Methods. The microbeads were applied to a FACStype cell sorter. The microbeads with signals appearing in gates U and D were collected and their sequences were analyzed.

ification of the method originally described by Brenner et al. (14). Half of both the LPS-stimulated and unstimulated cDNA libraries was labeled with Cy5 or fluorescein using T7 RNA polymerase and designated as LPS-stimulated or unstimulated probes for later hybridization. The remaining half of each cDNA library was fractioned to the range of 400–600 bp by sonication, and the 3’ ends of cDNA fragments were cloned onto microbeads (megaclone beads). Approximately 400 000 megaclone beads were competitively hybridized with the differentially labeled probes and sorted with a cell sorter. We set two gates, U (upregulated) and D (downregulated), in the zones where upregulated and downregulated transcripts (cDNA) in the LPS-stimulated lymphocytes were more heavily labeled with Cy5 and fluorescein, respectively (Fig. 1). For analysis of differential gene expression, 3963 and 3974 beads were collected from the U and D gates, respectively. The DNA fragments on beads in these fractions were amplified using PCR and sequenced. Although the lymphocytes of eight dolphin individuals were mixed and the MLR might occur, the changes of gene expression induced by the MLR occurred in the same way in the LPS stimulated and unstimulated lymphocyte 791

K. Ohishi et al.

Table 1. Primers used in this study Gene IL-1Ra IL-1β TNF-α IL-6 IFN-β TLR4 MD-2 β-actin

Direction F R F R F R F R F R F R F R F R

Sequence (5’ to 3’)

Reference

TCAGGATCTGGGATGTCAACCAGAAGATCT CTACTAGTCCTGCTGGAAGTAGAACTTGGTGAC TACCTGAACCCACCAACGAA GTCTTGTGTGATGAAAGGCGAT ATGAGCACTGAAAGCATGATCC AAGGTCAACCTCCTCTCTGCCAT ATGATACCACTTCAGACAGAC GCATCGAGGCTGTGCAGAT TTCTCCACCACAGCTCTTTCC CACTCGCACTACTGTCCAGG TCCAGCTTCCCAGAACTGCA TATTGAACCAGGCACCTTTA GAGTCTGATGATTAGTTAC GGATCTGTAACTCCTCTG ACAGCCTGGATAGCAACGTA CCACACCTTCTACAATGAGC

16 12 12 12 Present study 17 17 18

F, forward; R, reverse.

populations. Thus, the gene expression changes induced by the MLR were not detected in the present megaclonemegasort analysis.

RT-PCR analysis of TLR4 and related factors

Leukocytes collected from eight healthy bottlenose dolphins were incubated for various periods with 5 μg/mL LPS from S. minnesota strain R595 or from Escherichia coli strain 055:B5 (ENZO Life Science Co.). To compare the responses of leukocytes to LPS from S. minnesota and that from E. coli, two leukocyte samples from two animals were used. Each leukocyte sample was divided into two groups and incubated with each type of LPS for 3 hr. The remaining six animal samples were used for the time-course experiments with or without stimulation with Salmonella LPS; three were incubated for 0.5, 1, 3, and 5 hr, and the other three were incubated for 0.5, 1, 3, 5, 12, 18, 24, 48, and 72 hr with Salmonella LPS. The cDNA fragments were amplified from the extracted RNA by RT-PCR (Qiagen Co. [Duesseldorf, Germany] OneStep RT-PCR Kit) using the primers specific to the inflammatory cytokines IL-1β, TNF-α, IL-6, and IFNβ, TLR4, and MD-2. The primers are listed in Table 1 to detect various factors (12, 16–18). The RT-PCR protocol involved a conversion to cDNA (50◦ C for 30 min and 95◦ C for 15 min), followed by 30 cycles of DNA amplification, denaturation (94◦ C for 30 s), annealing (54–58◦ C for 30 s), and extension (72◦ C for 1 min). The sequences of the PCR products were confirmed using a dye-terminator method (BigDye, ABI Co., Foster City, CA, USA). 792

RESULTS Identification of up- and downregulated transcripts in EST analysis

From the respective U and D gates, 849 and 384 clones were randomly selected, sequenced, and annotated in a BLASTn database search. Among 849 upregulated clones, 807 formed 41 clusters (Table 2). Among them, one cluster, which contained two clones, could not hit any sequences in GenBank. Forty-two clones did not form any clusters, and were regarded as singlets. These total 44 clones were together categorized as “others” in Table 2. Thirty-five percent of the clones belonged to the category of immune factor (Table 2). The transcripts coding for the dolphin IL-1Ra (159 clones) was the most abundant in this category (53.2% of 299 clones). Genes homologous to those of bovine serum amyloid A3 (SAA3, 80 clones = 26.8%), ICAM-1 (32 clones = 10.7%), and swine interferon-γinducible protein 30 (IFI30, 11 clones = 3.7%) were also highly expressed (Table 2). Among all of the ESTs, ferritin heavy polypeptide I, which was not categorized as an immune factor but as an oxygen-related protein, was the most abundant in the upregulated transcripts (337 clones = 39.7% of 849 clones, Table 2). The 384 downregulated clones formed 32 clusters. Three clusters, each of which contained two clones, did not match any sequences in GenBank and are categorized as “others” in Table 3. Conspicuously abundant downregulated transcripts of immune factors were genes for proteins homologous to calcium-binding proteins belonging to the S100 family, e.g., S100A12 (80 clones = 66.7% of 120 clones), S100A8 (34 clones = 28.3%), and S100A6 c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

Innate immune factors in cetacean leukocytes

Table 2. Upregulated cluster-forming ESTs and genes showing the highest similarity Expected gene function

Gene accession no.

Clone no.

Immune factors Interleukin-1 receptor antagonist ‡ Serum amyloid protein A3 (SAA3) Intercellular adhesion molecule 1 (ICAM-1) ‡ Interferon γ-inducible protein 30 STEAP family member 4 Chemokine ligand 4 (CCL4) TNF receptor superfamily, member 1B ‡ Minor histocompatibility 13 ‡

FS999807 FS999808 FS999809 FS999810 FS999811 FS999812 FS999813 FS999814

Enzymes Tryptophanyl-tRNA synthetase CYP1A1 ‡ Nucleoside phosphorylase ‡ Apolipoprotein B mRNA editing protein Interferon-induced very large GTPase 1 Cathepsin Z ‡ Prostaglandin E synthase Cathepsin L1 Cathepsin B ‡ α-mannosidase, class 2B, member 1 Oxygen-related proteins Ferritin, heavy polypeptide 1 Hemoglobin, β4 Hemoglobin, α 2 Cytochrome C oxidase subunit 7A-related protein ‡ Ribosomal proteins Ribosomal protein S17 Ribosomal protein S28 Ribosomal protein L17 Ribosomal protein L23 Other functions EGF-like module containing, mucin-like, hormone receptor-like sequence 1 ‡ G protein-coupled receptor 43 ‡ Zinc finger and BTB domain containing protein 34 ‡ G protein pathway suppressor 2 Nucleolin-related protein NRP Histone H3.B2 protein ‡ G protein-coupled receptor 109A ‡ Lymphocyte G0/G1 switch protein 2 ‡ α-1 acid glycoprotein Short interspersed element (SINE) DNA: Clone PM(1-II)5 Unknown Pig genomic DNA Clone: KNP-1511G3 Human genomic DNA clone: ABC12-46987300E12 Human genomic DNA Clone: RP11-214N16 Human genomic DNA Clone: RP11-414J4 Others Total

Most similar organism (gene accession no.)

%†

E-value

159 80 32 11 6 6 3 2

18.7% 9.4% 3.8% 1.3% 0.7% 0.7% 0.4% 0.2%

0 4.00E-162 2.00E-84 2.00E-151 0 7.00E-107 2.00E-20 1.00E-48

Tursiops truncatus (AB038268.1) Bos taurus (BC108181.1) Canis lupus famililair (NM_001003291.1) Sus scrofa (NM_001131046.1) Bos taurus (XM_583351.4) Bos taurus (NM_001075147.1) Homo sapiens (BC052977.1) Bos taurus (BC112454.1)

FS999815 FS999816 FS999817 FS999818 FS999819 FS999820 FS999821 FS999822 FS999823 FS999824

31 7 6 4 4 4 3 2 2 2

3.7% 0.8% 0.7% 0.5% 0.5% 0.5% 0.4% 0.2% 0.2% 0.2%

7.00E-154 5.00E-178 4.00E-110 0 2.00E-55 4.00E-32 5.00E-51 1.00E-149 5.00E-16 6.00E-107

Bos taurus (BC102806.1) Balaenoptera acutorostrata (AB231891.1) Bos taurus (BC103291.1) Bos taurus (XM_594173.5) Equus caballus (XM_001499898.2) Bos taurus (NM_001077835.1) Bos taurus (BC120228.1) Bos taurus (NM_001083686.1) Bos taurus (BC102997.1) Bos taurus (NM_174561.2)

FS999825 FS999826 FS999827 FS999828

337 27 16 2

39.7% 3.2% 1.9% 0.2%

0 0 0 6.00E-68

Bos taurus (NM_174062.3) Delphinus delphis (FJ411056.1) Delphinus delphis (FJ389671.1) Sus scrofa (XM_003125203.1)

FS999829 FS999830 FS999831 FS999832

2 2 2 2

0.2% 0.2% 0.2% 0.2%

6.00E-111 6.00E-126 8.00E-169 2.00E-156

Bos taurus (NM_001099210.1) Bos taurus (BC102565.1) Bos taurus (NM_001034459.1) Bos taurus (NM_001035014.1)

FS999833

9

1.1%

4.00E-85

Sus scrofa (XM_003123136.1)

FS999834 FS999835

6 2

0.7% 0.2%

1.00E-50 2.00E-106

Pan troglodytes (XM_512587.2) Macaca mulatta (XM_001097093.2)

FS999836 FS999837 FS999838 FS999839 FS999840 FS999841 FS999842

2 2 2 2 2 2 2

0.2% 0.2% 0.2% 0.2% 0.2% 0.2% 0.2%

3.00E-110 3.00E-143 5.00E-114 6.00E-108 8.00E-74 8.00E-106 1.00E-28

Bos taurus (XM_00107574.1) Rattus norvegicus (AF151373.1) Canis lupus (XM_853711.1) Homo sapiens (BC063461.1) Bos taurus (XM_001192147.1) Bos taurus (XM_001040502.1) Globicephala macrorhynchus (AB010590.1)

FS999843 FS999844

14 2

1.6% 0.2%

2.00E-32 1.00E-45

Sus scrofa (FN673811.1) Homo sapiens (AC23175.2)

FS999845 FS999846

2 2 44 849

0.2% 0.2% 5.2% 99.5%

4.00E-35 7.00E-44

Homo sapiens (AL161626.20) Homo sapiens (AC091230.23)

†Percentage in the annotated and clustered clones ‡ESTs matched to 3’-non-coding region of each gene.

c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

793

K. Ohishi et al.

Table 3. Downregulated cluster-forming ESTs and genes showing the highest similarity

Expected gene function

Gene accession no.

Clone no.

%†

E-value

Immune factors S100A12 S100 A8 S100A6 Prothymosin α FYN binding protein

FS999847 FS999848 FS999849 FS999850 FS999851

80 34 2 2 2

20.8% 8.9% 0.5% 0.5% 0.5%

1.00E-130 8.00E-132 8.00E-157 1.00E-140 4.00E-116

Bos taurus (D49548.1) Bos taurus (NM_001113725.1) Sus scrofa (NM_001044557.1) Sus scrofa (NM_001160086.1) Bos taurus (NM_001105414.1)

Enzymes Glutathione peroxidase 1 Transketolase Ornithine decarboxylase antizyme 1 Phosphodiesterase 4B Aminolevulinate dehydratase

FS999852 FS999853 FS999854 FS999855 FS999856

4 2 2 2 2

1.0% 0.5% 0.5% 0.5% 0.5%

3.00E-26 0 2.00E-105 2.00E-133 4.00E-121

Bos taurus (NM_174076.3) Bos taurus (BC153211.1) Bos taurus (NM_001127243.1) Equus caballus (XM_001500300.2) Bos taurus (BC112596.1)

Oxygen related proteins Hemoglobin β4 Hemoglobin α2 Cytochrome C oxidase subunit 7A-related protein ‡ Sideroflexin 3

FS999857 FS999858 FS999859 FS999860

24 12 4 2

6.3% 3.1% 1.0% 0.5%

0 0 5.00E-68 3.00E-85

Delphinus delphis (FJ411056.1) Delphinus delphis (FJ389671.1) Sus scrofa (XM_003125203.1) Bos taurus (NM_001101946.1)

Ribosomal proteins Ribosomal protein S10 Ribosomal protein S21 Ribosomal protein L37 Mitochondrial ribosomal protein S34

FS999861 FS999862 FS999863 FS999864

2 2 6 2

0.5% 0.5% 1.6% 0.5%

4.00E-121 1.00E-129 2.00E-164 2.00E-62

Bos taurus (NM_001034716.1) Bos taurus (NM_001040581.1) Bos taurus (NM_001078132.1) Bos taurus (NM_001035500.1)

Cytoskeletons Thymosin β10 Tubulin α 1b

FS999865 FS999866

160 4

41.7% 1.0%

0 1.00E-172

Sus scrofa (NM_001097482.1) Sus scrofa (NM_001044544.1)

Other functions Rho-GDP-dissociation inhibitor Adaptor-related protein complex 3, δ-1 subunit FYVE, RhoGEF and PH domain containing 4 Rho family, small GTP binding protein Rac2 Heterogeneous ribonuclear protein A1 Cell division cycle 25 homolog B Chromatin modifying protein 1A-like protein

FS999867 FS999868 FS999869 FS999870 FS999871 FS999872 FS999873

8 4 2 2 2 2 2

2.1% 1.0% 0.5% 0.5% 0.5% 0.5% 0.5%

6.00E-39 2.00E-75 1.00E-27 1.00E-129 2.00E-36 9.00E-138 0.012

Canis familliaris (XM_543793.2) Sus scrofa (AB271938.1) Homo sapiens (NG_008626.1) Bos taurus (BC102255.1) Bos taurus (NM_001045911.1) Bos taurus (NM_00191415.1) Homo sapiens (NM_001083314.1)

FS999874 FS999875

4 2 6 384

1.0% 0.5% 1.6% 99.6%

3.00E-25 3.00E-47

Homo sapiens (AC015804.14) Homo sapiens (AC010746.8)

Unknown Human genomic DNA Clone: RP11-62J1 Human genomic DNA Clone: RP11-550E21 Others Total

Most similar organism (gene accession no.)

†Percentage in the annotated clustered clones. ‡ESTs matched to 3’-non-coding region of each gene.

(two clones = 1.7%). Thymosin β10 transcripts were abundant downregulated transcripts (160 clones = 41.7% of 384 clones). Although we did not categorize thymosin β10 as an immune factor, it may be involved in the regulation of immune systems. Expression of IL-1Ra and immune factors in response to LPS

We focused our attention on the expression of IL-1Ra, the most abundant transcripts in the upregulated immune genes (Table 2). The expression of the IL-1Ra gene 794

in the LPS-stimulated dolphin leukocytes was examined together with those of the inflammatory cytokines IL1β, TNF-α, IL-6, and IFN-β, as well as TLR4 and MD-2 in RT-PCR. The expression responses of those immune factors were compared between lymphocytes stimulated for 3 hr either by LPS from Salmonella or that from E. coli. However, no difference was observed between them (Fig. 2a). Time-courses of the expression of these factors, except for IFN-β, were examined using six animal samples. The expression of IL-1Ra, TNF-α, and IL-6 genes was low or not detected before LPS stimulation, and that

c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

Innate immune factors in cetacean leukocytes

Fig. 2. Expression of immunity-related genes in response to LPS stimulation analyzed in dolphin leukocytes by RT-PCR analysis. (a). Agarose gel electrophoresis of RT-PCR products of immunity-related genes in leukocytes from dolphin no. 1 after 3-hr incubation with or without LPS. Lane 1, lymphocytes without LPS stimulation; lane 2, stimulated with E. coli LPS; lane 3, stimulated with Salmonella LPS. (b). Time-course of gene expression in leukocytes from dolphin no. 6 incubated with LPS from Salmonella. Agarose gel electrophoresis of the RT-PCR products of immunity-related genes in lymphocytes after various periods of incubation with Salmonella LPS.

in three to five of the six samples increased transiently during 3–12 hr after the stimulation (Fig. 2b). The IL-1β gene was expressed in all of the samples even before LPS stimulation and increased after LPS stimulation in half of the samples. Although the expression of TLR4 and MD-2 was detected in three to five of the six samples, they did not appear to be affected by LPS stimulation (Fig. 2a).

DISCUSSION EST analysis of dolphin leukocytes using the megaclonemegasort method sheds light on several immune factors in response to LPS. Markedly enhanced expression of the immune factors IL-1Ra, SAA3, and ICAM-1 was observed (Table 2). Recombinant dolphin IL-1Ra was shown to inhibit dolphin IL-1β (16). SAA protein is a well-known clinical indicator of acute-phase inflammation (19), and ICAM-1 is activated by TNF-α or IFN-β and plays an important role in the migration and retention of inflammatory cells (20). Ferritin, the most abundant upregulated transcript (Table 2), which is a ubiquitous iron storage protein found in the majority of living organisms, binds and retains iron in a nontoxic form to prevent irondependent ROS production (21). On the other hand, the expression of some calciumbinding proteins (S100) was significantly downregulated. S100A8 and S100A12, belonging to calgranulins, a subgroup of the S100 family, were reported to show multiple immune functions in anti-infective and antiinflammatory responses, such as stimulation of phagocytosis and chemotaxis, or to scavenge ROS (22). LPS from several bacteria such as Porphyromonas gingivalis is

c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

known to induce the expression of genes for calgranulins in leukocytes such as neutrophils and monocytes (23, 24). We also found that the gene for thymosin β10 was the most abundant among downregulated transcripts. It is involved in the cytoskeletal system as a G-actin-sequestering peptide (25), but it is not clear why it was downregulated by LPS-stimulation. In addition to preventing bacterial infection, some factors shown in the present EST analysis were reported to be involved in endogeneous inflammation such as tumor development or autoimmune disease. IL-1Ra-deficient patients develop autoimmune diseases accompanied by elevated production of autoreactive T-cells (26), and IL-1Ra knockout mice develop arthritis, psoriasis-like skin lesions, and arteritis (27, 28). Those previous reports indicated that IL-1Ra tightly controls the expression of IL-1 to suppress autoimmunity or immune disorders. Our timecourse experiment showed transient expression of the IL1Ra gene (Fig. 2). This indicates that IL-1Ra expression is also tightly controlled, probably due to its cytotoxicity. This concept may be supported by the results that TNF-α, which is cytotoxic and involved in septic shock, showed a similar pattern in the time-course experiment (Fig. 2) (29). S100A8 and SAA3 were shown to act as ligands for TLR4 and to be involved in cancer development or autoimmunity (10, 11, 30, 31). Recently, the interaction among S100A8, SAA3, and TLR4 in tumor metastasis has been reported: in the premetastatic phase, highly expressed S100A8 induces the expression of SAA3, which is recognized by TLR4 and promotes the migration of primary tumor cells to the lung (10). From the present results together with previously reported information, we

795

K. Ohishi et al.

deduce the following scenario of the immune response in dolphin lymphocytes: (i) LPS immediately induces the production of inflammatory cytokines such as IL-1, TNF-α, or IFN-β, which triggers an increase in the expression of IL-1Ra, SAA3, and ICAM-1; (ii) LPS simultaneously induces the production of ROS, which require a large amount of ferritin for protection against oxidative stress; and (iii) LPS induces a response involving the production of many calgranulin proteins of the S100 family, and their overexpression results in the downregulation of the calgranulin genes and upregulation of SAA3 in the next stage. We could not find the transcripts of IL-1β, TNF-α, IL-6, and IFN-β in the present EST, although the expression was observed in the time-course experiment. In the present analysis, the expression differences of these factors were probably too small to be detected. It would be interesting to examine the expression and interaction of these factors in cetacean tissues to clarify the defense system of innate immunity against pathogens and its relationship with homeostatic inflammation.

ACKNOWLEDGMENT The authors thank Dr Masahiro Sato, of Takara Bio Inc., for technical advice. We also thank Ms Chiaki Saitoh for help with manuscript preparation. REFERENCES 1. Foster G., MacMillan A.P., Godfroid J., Howie F., Ross H.M., Cloeckaert A., Reid R.J., Brew S., Patterson I.A.P. (2002) A review of Brucella sp. infection of sea mammals with particular emphasis on isolates from Scotland. Vet Microbiol 90: 563–580. 2. Ohishi K., Fujise Y., Maruyama T. (2008) Brucella spp. in the western North Pacific and Antarctic cetaceans. J Cet Res Man 10: 67–72. 3. Janeway C.A. Jr., Medzhitov R. (2002) Innate immune recognition. Annu.Rev Immunol 20: 197–216. 4. Kaisho T., Akira S. (2003) Toll like receptor in Alan R.B.E., Jules A.H. eds. Innate Immunity. Totowa, NJ, Humana Press, pp. 177–189. 5. Akira S., Takeda K., Kaisho T. (2001) Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol 2: 675–680. 6. Akira S., Uematsu S., Takeuchi O. (2006) Pathogen recognition and innate immunity. Cell 124: 783–801. 7. Shimazu R., Akashi S., Ogata H., Nagai F., Fukudome K., Miyake K., Kimoto M. (1999) MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J Exp Med 189: 1777–82. 8. Nagai Y., Akashi S., Nagafuku M., Ogata M., Iwakura Y., Akira S., Kitamura T., Kosugi A., Kimoto M., Miyake K. (2002) Essential role of MD-2 in LPS responsiveness and TLR4 distribution. Nat Immunol 3: 667–72. 9. Rafkin I.R., Leadbetter E.A., Busconi L., Viglianti G., Marshak-Rothstein A. (2005) Toll-like receptors, endogeneous ligands, and systematic autoimmune diseases. Immunol Rev 204: 27–42.

796

10. Hiratsuka S., Watanabe A., Sakurai Y., Takamura A.S., Ishibashi, S., Miyake K., Shibuya M., Akira S., Aburatani H., Maru Y. (2008) The S100A8-serum amyloid A3-TLR4 paracrine cascade establishes a pre-metastatic phase. Nat Cell Biol 10: 1349–55. 11. Ehrchen J.M., Sunderkotter C., Foell D., Vogl T., Roth J. (2009) The endogeneous Toll-like receptor 4 agonist S100A8/S100A9 (calprotectin) as innate amplifier of infection, autoimmunity, and cancer. J Leukocyte Biol 86: 557–66. 12. Mancia A., Lundqvist L.M., Romano A.T., Peden-Adams M.M., Fair A.P., Kindy S.M., Ellis C.B., Gattoni-Celli S., McKillen J.D., Trent F.H., Chen A.Y., Almeida S.J., Gross S.P., Chapman W.R., Warr W.G. (2007) A dolphin peripheral blood leukocyte cDNA microarray for studies of immune function and stress reactions. Dev Comp Immunol 31: 520–29. 13. Sitt T., Bowen L., Blanchard M.T., Smith B.R., Gershwin L.J., Byrne B.A., Stott J.L. (2008) Quantitation of leukocyte gene expression in cetaceans. Dev Comp Immunol 32, 1253–59. 14. Brenner S., Williams R.S., Vermaas H.E., Storck T., Moon K., McCollum C., Mao J., Luo S., Kirchner J.J., Eletr S., DuBridge B.R., Burcham T., Albrecht G. (2000) In vitro cloning of complex mixtures of DNA on microbeads: physical separation of differently expressed cDNA. Proc Natl Acad Sci USA 97: 1665–70. 15. Ohishi K., Ando A., Suzuki R., Takishita K., Kawato M., Katsumata E., Ohtsu D., Okutsu K., Tokutake K., Miyahara H., Nakamura, H., Murayama T., Maruyama T. (2010) Host-virus specificity of morbillivirus predicted by structural modeling of the marine mammal SLAM, a receptor. Comp Immunol Microbiol Infect Dis 33: 227–41. 16. Inoue Y., Itou T., Jimbo T., Shouji Y., Ueda K., Sakai T. (2001) Molecular cloning and functional expression of bottle-nosed dolphin (Tursiops truncatus) interleukin-1 receptor antagonist. Vet Immunol Immunopathol 26: 131–41. 17. Shishido S., Ohishi K., Suzuki R., Takishita K., Ohtsu D., Okutsu K., Tokutake K., Katsumata E., Bando T., Fujise Y., Murayama T., Maruyama T. (2010) Molecular characterization of cetacean Toll like receptor 4 (TLR4) and myeloid differentiation factor 2 (MD-2) and their three-dimensional models. Comp Immunol Microbiol Infect Dis 33: e89-e68. 18. Krafft A., Linchy J., Lipscomb T., Klaunberg B., Kennedy S., Taubenberger J. (1995) Postmortem diagnosis of morbillivirus infection in bottlenose dolphin (Tursiops truncatus) in the Atlantic and Gulf of Mexico epizootics by polymerase chain reaction-based assay. J Wildlife Dis 31: 410–15. 19. Badolato R., Wang J.M., Murphy W.J., Lloyd A.R., Michiel D.F., Bausserman L.L., Kelvin D.J., Oppenheim J.J. (1994) Serum amyloid A is a chemoattaractant: induction of migration, adhesion, and tissue infiltration of monocytes and polymorphonuclear leukocytes. J Exp Med 180: 203–09. 20. Hosokawa Y., Hosokawa I., Ozaki K., Nakae H., Matsuo T. (2006) Cytokines differentially regulate ICAM-1 and VCAM-1 expression on human gingival fibroblasts. Clin Exp Immunol 144: 494–502. 21. Reif D.W. (1992) Ferritin as a source of iron for oxidative damage. Free Radic Biol Med 12: 417–27. 22. Hsu K., Champaiboon C., Guenther B.D., Sorenson B.S., Khammanivong A., Ross K.F., Geczy C.L., Herzerg M.C. (2009) Anti-infective protective properties of S100 calgranulins. Antiinflamm. Antiallerg. Agents Med Chem 8: 290–305. 23. Kido J. Kido R., Suryono R., Kataoka M., Fagerhol M.K, Nagata T. (2003) Calprotectin release from human neutrophils is induced by Porphyromonas gingivalis lipopolysaccharide via the CD14-Toll-like receptor-nuclear factor kappa B pathway. J Periodont Res 38: 557–63.

c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

Innate immune factors in cetacean leukocytes

24. Kido J., Hayashi N., Kataoka M., Nagata T. (2005) Calprotectin expression in human monocytes: induction by Porphyromonas gingivalis lipopolysaccharide, tumor necrosis factor-alpha, and interleukin-1 beta. J Periodontol 76: 437–42. 25. Nachmias V.T. (1993) Small actin-binding proteins: the beta-thymosin family. Curr Opin Cell Biol 5: 56–62. 26. Horai R., Saijo S., Tanioka H., Nakae S., Sudo K., Okahara A., Ikuse T., Asano M., Iwakura Y. (2000) Development of chronic inflammatory arthropathy resembling rheumatoid arthritis in interleukin I receptor antagonist-deficient mice. J Exp Med 191: 313–20. 27. Nicklin M.J., Hughes D.E., Barton J.L., Ure J.M., Duff G.W. (2000) Arterial inflammation in mice lacking the interleukin I receptor antagonist gene. J Exp Med 191: 303–12. 28. Askentijevich I., Masters S.L., Ferguson P.J., Dancey P., Frenkel J., Kerkhoff A.R., Laxer R., Tedgard U., Cowen E.W., Pham T.H., Booty M., Estes J.D., Sandler N.G., Plass N., Stone D.L.,

c 2011 The Societies and Blackwell Publishing Asia Pty Ltd 

Turner M.L., Hill S., Butman J.A., Schneider R., Babyn P., Shanti H.I., Pope E., Clarke K.G.I., Ohson K., Nicholoson M., Gadina M., Yang B., Korman B.D., Gregersen P.K., Hagen P.M., Hak A.E., Huizing M., Rohman P., Douek D.C., Remmers E.F., Kastner D.L., Mansky R.G. (2009) An autoinflammatory disease with deficiency of the interleukin-1-receptor antagonist. N Engl J Med 360: 2426–37. 29. Cai B., Deitch E.A., Ulloa L. (2010) Novel insights for systemic inflammation in sepsis and hemorrhage. Mediators Inflamm doi:10.1155/2010/642462. 30. Hermani A., De Servi B., Medunjanin S., Tessier P.A., Mayer D. (2006) S100A8 and S100A9 activate MAP kinase and NF-kappaB signaling pathways and trigger translocation of RAGE in human prostate cancer cells. Exp Cell Res 312: 184–97. 31. Gebhardt C., Nemeth J., Angel P., Hess J. (2006) S100A8 and A100A9 in inflammation and cancer. Biochem Pharmacol 72: 1622–31.

797