Detection and quantification of viable Bacillus cereus ... - Springer Link

Eur Food Res Technol (2011) 232:951–955 DOI 10.1007/s00217-011-1465-1

ORIGINAL PAPER

Detection and quantification of viable Bacillus cereus in food by RT–qPCR Juan Francisco Martıńez-Blanch • Gloria Sańchez Esperanza Garay • Rosa Aznar

•

Received: 17 January 2011 / Revised: 22 February 2011 / Accepted: 2 March 2011 / Published online: 24 March 2011 Ó Springer-Verlag 2011

Abstract A reverse-transcription real-time PCR (RT– qPCR) procedure, targeting the phosphatidylcholine-specific phospholipase C (pc-plc) mRNA, was developed for the specific detection and quantification of viable Bacillus cereus. Initial experiments focused on evaluating the performance of various RNA extraction kits and optimizing the DNase I digestion. After optimization, RNA from B. cereus was isolated, and following DNase treatment, the RNA was amplified by RT–qPCR. The assay was used to construct a calibration curve from purified RNA of B. cereus CECT 148T, and it had a wide quantification range of 5 log units. The detection limit was 30 CFU per reaction and the efficiency 0.88. When the developed methodology was applied in artificially contaminated liquid egg, the detection limit was found to be 850 CFU per reaction or 1.1 9 104 CFU per mL of food sample without an enrichment step. To the best of our knowledge, this is the first time that an assay for the detection and quantification of viable B. cereus in food has been described.

J. F. Martıńez-Blanch E. Garay Spanish Type Culture Collection (CECT), University of Valencia, Valencia, Spain J. F. Martıńez-Blanch G. Sańchez R. Aznar Institute of Agrochemistry and Food Technology (IATA), Spanish Council for Scientific Research (CSIC), Paterna, Spain E. Garay R. Aznar Department of Microbiology and Ecology, University of Valencia, Valencia, Spain R. Aznar (&) Departamento de Biotecnologıá, Instituto de Agroquı´mica y Tecnologıá de Alimentos, Avda. Agustıń Escardino 7, Paterna, Valencia, Spain e-mail: [email protected]

Keywords Bacillus cereus Reverse transcription real-time PCR Viable forms Food

Introduction Bacillus cereus is a Gram-positive spore-forming food pathogen that has been implicated in many foodborne outbreaks causing two types of food poisoning syndromes: emesis and diarrhea [1–3]. Besides its resistance to pasteurization, psychrotrophic B. cereus strains can grow at refrigeration temperatures and can produce enterotoxin both aerobically and anaerobically [4]. Therefore, it is an increasing problem, especially in heat-treated food, such as convenience food and food used in catering. For instance, in the EFSA report-2007 on foodborne outbreaks [1], B. cereus was the causative agent in 77 outbreaks and caused 17.1% of the cases due to bacterial toxins. Generally, levels below 103 CFU of B. cereus per g or mL of food are considered safe [5]. The current culture techniques used for the detection of B. cereus in food include isolation on selective media and further bacterial identification. Besides being laborious and time consuming, these procedures usually lead to misidentifications due to the high phenotypic relatedness between the species in the B. cereus group. As an alternative, rapid and accurate detection and identification of B. cereus isolates can be accomplished by molecular techniques such as PCR and even quantitative detection can be approached by real-time PCR (qPCR). Recently, our group has developed a qPCR assay based on the phosphatidylcholine-specific phospholipase C gene (pc-plc) for the detection and quantification of enterotoxigenic B. cereus group strains. Using this procedure as low as 60 CFU or spores per mL were quantitatively detected in artificially

123

952

inoculated liquid egg and infant formula, without an enrichment step [6, 7]. Even though the newly developed qPCR procedure allows detection of both B. cereus group vegetative cells and spores, the major obstacle with PCR or qPCR assays is how to distinguish between DNA from dead and live cells. Intact DNA can be present although the organisms are dead. This is particularly relevant for qPCR quantification which may overestimate the number of live cells due to the relatively long persistence of DNA after cell death. The most commonly used strategy to avoid this overestimation relies on the detection of mRNA, which is a direct indicator of active bacterial metabolism. Thus, reverse transcription (RT)–PCR [8–10] and nucleic acid sequence amplification, NASBA [11] have been considered promising techniques. Other alternative assays consist of the use of DNA binding molecules like ethidium monoazide (EMA) and propidium monoazide (PMA) as a sample treatment previous to the PCR [12–15]. The aim of this study was to develop a RT–qPCR assay for the detection and quantification of viable toxigenic members of the B. cereus group in food samples. Performance of the newly developed method was evaluated in inoculated liquid egg, since an increasing number of food industries are using pasteurized liquid whole egg to formulate their products. Besides, the presence of B. cereus in raw and pasteurized liquid whole egg has previously been reported [16].

Eur Food Res Technol (2011) 232:951–955

digestion, DNase was inactivated by heating at 80 °C for 5 min. Efficacy of DNase treatment was evaluated by conventional PCR and qPCR procedures as previously described [6]. Reverse transcription PCR (RT–PCR) PCER F (50 GGATTCATGGAGCGGCAGTA30 ) and PCER R3 (50 GCTTACCTGTCATTGGTGTAACTTCA30 ) primers targeting the pc-plc gene that have previously been reported to specifically detect members of the B. cereus group [6] were used in a one-step RT–PCR. One-step RT– PCR mixture consisted of 20 ng of DNase-treated RNA, 100 lM of dATP, dGTP and dCTP, 200 lM of dUTP, 3 mM MgCl2, 0.3 lM of each primer, 0.5 U of AmpliTaqÒ Gold DNA polymerase, 1 9 PCR buffer II and 6 U of MultiScribeÒ reverse transcriptase (Applied Biosystems, Foster City, USA) in a final volume of 25 lL. Amplification conditions were as follows: 30 min at 48 °C, 10 min at 94 °C, 35 cycles of 30 s at 94 °C, 45 s at 56 °C and 45 s at 72 °C, followed by a final extension of 5 min at 72 °C. Reactions were performed at least in triplicate. Five micro liters of RT–PCR products were visualized in a 1.8% agarose (Pronadisa, Hispanlab, Madrid, Spain) gel in TBE (45 mM Tris–HCl, 45 mM boric acid, 1 mM Na2EDTA, pH 8.0) and ethidium bromide staining. RT–qPCR assays

Materials and methods Bacterial strain and RNA isolation Bacillus cereus CECT 148T, kindly provided by the Spanish Type Culture Collection (CECT), was grown on Nutrient Agar (Oxoid, Basingstoke, UK) at 30 °C for 18 h. Total RNA from log-phase cultures of B. cereus CECT 148T was extracted by three commercial RNA extraction methods, the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany), the Total Quick RNA cells and tissues kit (Talent, Trieste, Italy) and the UltraClean Microbial RNA kit (MoBIO Laboratories Inc., Carlsbad, USA), according to manufacturer’s instructions. Accurate RNA quantification for RT–qPCR assays was done using the RiboGreenÒ RNA quantitation kit (Molecular Probes, Leiden, The Netherlands) according to manufacturer’s instructions.

The SYBR Green and TaqMan RT–qPCRs were performed using the SYBR-Green I and TaqMan Core Reagents (Applied Biosystems) adding 6 U of MultiScribeÒ reverse transcriptase (Applied Biosystems). Concentrations of primers, probe (FAM-CGAAACAAGATTACICT-MGB for the TaqMan assay), and MgCl2 were optimized at 0.3, 0.05, and 2.5 lM, respectively, in a final volume of 25 lL containing 20 ng of DNase-treated RNA. Amplification was performed for 1 cycle of 48 °C for 30 min, 1 cycle of 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min in a GeneAmp 5,700 Sequence Detection System (PE Biosystems, Foster City, USA). Melting curve analysis (Tm) was performed for 1 cycle of 95 °C for 15 s, 1 cycle of 60 °C for 20 s and 1 cycle from 60 °C to 95 °C for 20 min. Negative and positives controls were included in each run. Quantification assays

DNase treatment For DNA removal, 0.5-lg aliquots of total RNA were treated at various concentrations of RNase-free DNase I (Takara, Saint-Germain-en-Laye, France) in a final volume of 20 lL at 37 °C for 30 or 60 min. Following DNase

123

A standard curve was generated using tenfold dilutions of DNase-treated RNA extracted from log phase culture of B. cereus CECT 148T. For every serial dilution, the 95% confidence interval was calculated according to a binomial distribution using the R software v.2.2


(http://www.R-project.org). The CT values obtained from the assay of each dilution were used to plot a standard curve by assigning the corresponding cell numbers. Four replicates of each dilution were analyzed in two independent assays. The efficiency (E) of the reaction was calculated from the linear regression curve according the formula described by Knutsson and coauthors [17]. Artificially inoculated food assays The detection limit of the TaqMan RT–qPCR assay was experimentally determined by inoculating liquid egg with serial dilutions of strain B. cereus CECT 148T covering a 4 log range determined by plate count. RNA from 1 mL aliquot of inoculated liquid egg was extracted using the Total Quick RNA cells and tissues kit (Talent) following the manufacturer’s instructions. Extracted RNA was treated with 0.5 U of DNase for 60 min at 37 °C and spectrophotometrically quantified using the RiboGreenÒ RNA quantitation kit (Molecular Probes). Finally, 5 lL of DNase-treated RNA were used as template for RT–qPCR amplification as described above. Four replicates of each dilution were analyzed in two independent assays.

Results and discussion In the present study, a RT–qPCR was settled up in order to attempt detection of viable enterotoxigenic B. cereus group strains. It is based on the previously described qPCR that proved specific for the detection of these organisms and their spores [6, 7]. Initially, extraction of mRNA was optimized by comparing the performance of three columnbased purification procedures. Aliquots of B. cereus CECT 148T suspensions were treated with the RNeasy Mini kit (Qiagen), the Total Quick RNA cells and tissues kit (Talent) and the UltraClean Microbial RNA kit (MoBio). Of them, the Total Quick RNA cells and tissues kit rendered the highest recovery of mRNA and the lowest content of DNA. The presence of residual DNA was also evaluated by PCR, and we found that the RNeasy Mini kit showed the highest amplification of DNA (data not shown). The Mobio kit was only effective when using high cell concentrations (data not shown). Therefore, the Total Quick RNA cells and tissues kit (Talent) was selected for the final procedure. RNA preparations almost always contain contaminating DNA independent of the RNA purification procedure used. Residual DNA from RNA suspensions was eliminated by a DNase treatment. Attempts were made to improve the DNAse treatment by increasing the DNase concentration and extending the incubation time. PCR and qPCR were used to quantify the effects of the various treatments. Treatment of 0.5 lg of RNA with 0.5 U of DNase at 37 °C

953

for 30 min gave amplification by qPCR. In contrast, incubation with 0.5 U of DNase at 37 °C for 60 min or 1 or 2 U of DNase at 37 °C for 30 min were sufficient to destroy all contaminating DNA (data not shown). Incubation with 0.5 U of DNase at 37 °C for 60 min followed by heat denaturation of the enzyme for 5 min at 80 °C was selected for the final procedure. The primers and probe used in this study had previously proved specific for the detection of B. cereus group strains6. Initially, SYBR Green RT–qPCR was evaluated using the PCR conditions previously described6 adding 6 U of MultiScribeÒ reverse transcriptase; however, the melting curve analysis gave an unspecific peak (Tm = 82.0 °C) together with the expected one (Tm = 79.8 °C). To overcome this problem, various concentrations of MgCl2 were assayed. Improved specificity of the SYBR Green RT–qPCR was obtained by using 2.5 mM of MgCl2, nevertheless traces of the unspecific peak were still detected (data not shown). Therefore, the Taqman RT–qPCR assay was evaluated. Of the different concentrations of the MGB TaqMan probe (BCER-MGB) initially tested6, improved specificity and efficiency of the TaqMan RT–qPCR was obtained by using 50 nM of the probe and 300 nM of primers. Performance of the assay was evaluated by generating the standard curve of DNase-treated RNA extracted from strain B. cereus CECT 148T (Table 1). The correlation coefficient (R2) of the linear regression analysis corresponding to the RT–qPCR assay was 0.99, with an assay efficiency of 0.88 for extracted RNA. The detection limit, estimated as the highest dilution from which amplification was obtained, was established in 30 CFU per reaction or 3.9 pg of RNA. The TaqMan RT–qPCR assay was selected because of its higher sensitivity for further evaluation in artificially inoculated liquid egg. RT–qPCR results of different B. cereus concentrations are shown in Table 2. The correlation coefficient was 0.98; however, the detection limit was 847 CFU per reaction which corresponded to 1.1 9 104 CFU per mL of food sample. The accuracy of the assay was assessed by comparing the values of the number of inoculated cells with the extrapolated values using the standard curve generated with RNA. No significant bias was found between the reference and the measured values at the highest concentration, while a higher discrepancy, where relative accuracy values ranged between 10.12 and 5.29%, was observed at lower concentrations (Table 2). The detection limit of the RT–qPCR determined in liquid egg is 100-fold higher than the previously established for the standard qPCR [6], which is not entirely surprising since RT–qPCR comprises some difficulties inherent to this technology. Among them, template preparation, DNase treatment, and the RT step are critical for sensitive and accurate quantification [18]. Previously

123

954


Table 1 Standard curve from RNA of B. cereus CECT 148T strain using the TaqMan RT–qPCR assay Total RNA (pg/reaction)a

Cell numbersb

3.9 9 104

3 9 105

3

3.9 9 10

3 9 104

3.9 9 102 1

Ratioc

CdT

Confidence interval limit Lower

Upper

4/4

297,012

299,146

19.89 ± 0.19

4/4

29,470

30,147

24.01 ± 0.36

3 9 103

4/4

2,875

3,088

28.13 ± 0.37

3.9 9 10

3 9 10

2

4/4

265

332

31.11 ± 0.43

3.9

3 9 101

4/4

20

41

34.63 ± 0.57

a

Estimated RNA concentration using the RiboGreenÒ RNA quantitation Kit

b

Estimated number of inoculated cells (CFU/reaction) of B. cereus CECT 148T from plate counts

c

Number of positive results out of 4 reactions

d

Cycle number at which fluorescence intensity equals a fixed threshold. Mean values ± standard deviation for 4 replicates are shown

Table 2 Viable B. cereus quantification by TaqMan RT–qPCR in artificially contaminated liquid egg Cell numbersa

Determined cell numbersb

RA (%)c

Ratiod

CeT

8.5 9 104

8.3 9 104

98.09

4/4

22.26 ± 0.13

3

8.5 9 10

8.6 9 102

10.12

4/4

29.53 ± 0.17

8.5 9 102

4.5 9 101

5.29

4/4

34.25 ± 0.35

–

0/4

8.5 9 101

–

References

–

a

Approximate number of inoculated cells (CFU/reaction) of B. cereus CECT 148T

b

Estimated number cells (CFU/reaction) using the standard curve from RNA of B. cereus CECT 148T strain c

Relative accuracy calculated according to ISO 16140:2003 [21]

d

Number of positive results out of 4 reactions

e

Cycle number at which fluorescence intensity equals a fixed threshold. Mean values ± standard deviation are shown

published RT–qPCR assays for other foodborne pathogens usually include a pre-enrichment step and, therefore, the detection limits reported cannot be compared with the results obtained in this study. For instance, 1 CFU of Escherichia coli O157:H7 was detected per gram of fecal samples following 5 h culture [19]; similarly, 2 CFU per 25 g was reported for Salmonella detection by RT–qPCR after enrichment [20]. The enrichment step allow viable cells to grow increasing their numbers and, therefore, improving the PCR detection level. However, these procedures, despite being more sensitive in detection of viable cells, are not suitable for quantification, as the procedure outlined here. Despite the low detection limit achieved, to the best of our knowledge this is the first assay developed for the direct detection and quantification of viable forms within the B. cereus group. The developed RT–qPCR method can be complementary to qPCR assays in food samples that tested positive, in order to assess viability of the B. cereus group strains detected.

123

Acknowledgments This work was supported by ‘‘Comisioń Interministerial de Ciencia y Tecnologıá’’ (CICYT) grant AGL2000-1462 and the CECT. J. F. Martıńez was the recipient of a Ph. D. fellowship UA-BPD2002, and G. Sańchez is the recipient of a JAE doctor grant both from the ‘‘Consejo Superior de Investigaciones Cientı´ficas’’ (CSIC).

1. European Food Safety Authority (2007) The community summary report on trends and sources of zoonoses, zoonotic agents, antimicrobial resistance and foodborne outbreaks in the European union in 2006. EFSA J 130:3–352 2. Fricker M, Messelhausser U, Busch U, Scherer S, Ehling-Schulz M (2007) Diagnostic real-time PCR assays for the detection of emetic Bacillus cereus strains in foods and recent food-borne outbreaks. Appl Environ Microbiol 73:1892–1898 3. Dierick K, Van Coillie CE, Swiecicka I, Meyfroidt G, Devlieger H, Meulemans A, Hoedemaekers G, Fourie L, Heyndrickx M, Mahillon J (2005) Fatal family outbreak of Bacillus cereusassociated food poisoning. J Clin Microbiol 43:4277–4279 4. Van Netten P, van de Moosdijk A, van Hoensel P, Mossel DAA, Perales I (1990) Psychrotrophic strains of Bacillus cereus producing enterotoxin. J Appl Bacteriol 69:73–79 5. Berkeley R, Heyndrickx M, Logan N, De Vos P (2002) Bacillus cereus and food poisoning. In: Granum PE (ed) Applications and systematics of Bacillus and relatives. Blackwell Publishing, Oxford, pp 37–46 6. Martıńez-Blanch JF, Sańchez G, Garay E, Aznar R (2009) Development of a real-time PCR Assay for detection and quantification of enterotoxigenic members of Bacillus cereus group in food samples. Int J Food Microbiol 135:15–21 7. Martıńez-Blanch JF, Sańchez G, Garay E, Aznar R (2010) Evaluation of a real-time PCR assay for the detection and quantification of Bacillus cereus group spores in food. J Food Prot 73:1480–1485 8. Herman L (1997) Detection of viable and dead Listeria monocytogenes by PCR. Food Microbiol 14:103–110 9. McIngvale SC, Elhanafi D, Drake MA (2002) Optimization of reverse transcriptase PCR to detect viable Shiga-toxin-producing Escherichia coli. Appl Environ Microbiol 68:799–806 10. Klein PG, Juneja VK (1997) Sensitive detection of viable Listeria monocytogenes by reverse transcription-PCR. Appl Environ Microbiol 63:4441–4448

Eur Food Res Technol (2011) 232:951–955 11. Cook N (2003) The use of NASBA for the detection of microbial pathogens in food and environmental samples. J Microbiol Methods 53:165–174 12. Lee JL, Levin RE (2006) Use of ethidium bromide monoazide for quantification of viable and dead mixed bacterial flora from fish fillets by polymerase chain reaction. J Microbiol Methods 67:456–462 13. Nocker A, Cheung CY, Camper AK (2006) Comparison of propidium monoazide with ethidium monoazide for differentiation of live versus dead bacteria by selective removal of DNA from dead cells. J Microbiol Methods 67:310–320 14. Pan Y, Breidt F (2007) Enumeration of viable Listeria monocytogenes cells by real-time PCR with propidium monoazide and ethidium monoazide in the presence of dead cells. Appl Environ Microbiol 73:8028–8031 15. Rudi K, Moen B, Dromtorp SM, Holck AL (2005) Use of ethidium monoazide and PCR in combination for quantification of viable and dead cells in complex samples. Appl Environ Microbiol 71:1018–1024 16. Wood SL, Waites WM (1988) Factors affecting the occurrence of Bacillus cereus in liquid whole egg. Food Microbiol 5:103–107

955 17. Knutsson R, Lofstrom C, Grage H, Hoorfar J, Radstrom P (2002) Modeling of 50 nuclease real-time responses for optimization of a high-throughput enrichment PCR procedure for Salmonella enterica. J Clin Microbiol 40:52–60 18. Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 29:23–39 19. Sharma VK (2006) Real-time reverse transcription-multiplex PCR for simultaneous and specific detection of rfbE and eae genes of Escherichia coli O157:H7. Mol Cell Probes 20:298–306 20. Gonzalez-Escalona N, Hammack TS, Russell M, Jacobson AP, De Jesus AJ, Brown EW, Lampel KA (2009) Detection of live Salmonella sp. Cells in produce by a TaqMan-based quantitative reverse transcriptase real-time PCR targeting invA mRNA. Appl Environ Microbiol 75:3714–3720 21 Anonymous (2003) Microbiology of food and animal feeding stuffs – Protocol for the validation of alternative methods. ISO 16140:2003

123