Mol Biol Rep (2010) 37:2183–2188 DOI 10.1007/s11033-009-9700-6
Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples Xihong Zhao Æ Yanmei Li Æ Li Wang Æ Lijun You Æ Zhenbo Xu Æ Lin Li Æ Xiaowei He Æ Yao Liu Æ Jihua Wang Æ Liansheng Yang
Received: 23 June 2009 / Accepted: 29 July 2009 / Published online: 15 August 2009 Ó Springer Science+Business Media B.V. 2009
Abstract We developed and evaluated the specificity and sensitivity of a loop-mediated isothermal amplification (LAMP) method for rapid detection of the food-borne Escherichia coli O157 strains. Six primers, including outer primers, inner primers and loop primers, were specially designed for recognizing eight distinct sequences on three targets, which were rfbE, stx1 and stx2. The detection limits were found to be 100, 100 and 10 fg DNA/tube for rfbE, stx1 and stx2, respectively. Application of LAMP assays were performed on 417 food-borne E. coli strains, the sensitivity of LAMP assays for the rfbE, stx1 and stx2 was 100, 95.3 and 96.3%, and the negative predictive value X. Zhao L. You Z. Xu (&) L. Li X. He (&) L. Yang College of Light Industry and Food Sciences, South China University of Technology, 510640 Guangzhou, China e-mail:
[email protected] X. He e-mail:
[email protected] Y. Li Guangzhou Medical College, Guangzhou, China L. Wang Food Safety Key Laboratory of Guangdong Province, College of Food Science, South China Agricultural University, Guangzhou, China Z. Xu Department of Microbial Pathogenesis, Dental School, University of Maryland-Baltimore, Baltimore, MD 21201, USA Y. Liu Zhongshan Supervision Testing Institute of Quality & Metrology, Zhongshan, China J. Wang Guangzhou Wondfo Biotechnology Company, Guangzhou, China
was 100, 96.7 and 97.1%, respectively; with a 100% specificity and positive predictive value for all three targets. Keywords Loop-mediated isothermal amplification (LAMP) Escherichia coli O157 Rapid detection
Introduction Food safety remained one of the most important global health issues and food-borne diseases caused by microbes were widespread public health problem. It had been reported that approximately 1.8 million people died from diarrheal diseases in 2005, while the estimated global incidence of food-borne disease still remained unknown [13]. Shiga-toxin producing Escherichia coli (STEC) is an important human pathogen, with E. coli O157: H7 being the best known and most studied serotype, which is responsible for the majority of cases of diarrhea prevalent all over the world [11]. It usually take a week to recover from E. coli O157: H7 caused diarrhea, however, some people exposed to E. coli O157: H7 strains could even develop Hemolytic Uremic Syndrome (HUS), which possibly lead to serious kidney damage and even death [1, 14]. Shiga-toxins, including Shiga-toxin 1 (Stx1) and Shiga-toxin 2 (Stx2), are the main toxins produced by E. coli O157: H7. Stx2, with several reported variants, differs from Stx1 in its physico-chemical, immunological and molecular genetic properties. Early detection of E. coli O157: H7 and its Shigatoxins are important in saving time and cost; therefore, development of sensitive and rapid detection methods is necessarily required. The present culture methods, known as gold standard, would take more than 3 days. As a rapid detection method, enzyme immunoassay shows a high
123
2184
Mol Biol Rep (2010) 37:2183–2188
including 154 O157 strains and 263 non-O157 strains. These strains were isolated from various food samples during 2003–2007, and had been preliminarily identified in the Lab of Clinical Microbiology of Zhongshan Supervision Testing Institute of Quality & Metrology.
Primer design Fig. 1 Schematic diagram of LAMP primers
requirement for the population of microbes [2]. While some other methods, such as the immuno-magnetic beads [3, 4, 15, 18] and colloidal gold immunochromatography assay [6], although known for easiness and rapidness, have disadvantage in reproducibility. During the past decade, molecular methods as PCR and real-time PCR assay have been applied to the detection of food-borne pathogens by amplifying some relevant genes. However, the requirement for trained personnel, operating space, equipment and reagents would hamper its application [9]. Recently, a novel nucleic acid amplification method, designated loop-mediated isothermal amplification (LAMP), had been reported. This method relies on an auto-cycling strand displacement DNA synthesis performed by the Bst DNA polymerase large fragment [8, 10, 17], which is different from PCR in that four or six primers perform the amplification of the target gene (Fig. 1). The amplification uses isothermal conditions between 60 and 65°C, and the amplification products are mixtures of many different sizes of stem-loop DNAs with several inverted repeats of the target sequence and cauliflower-like structures with multiple loops [20]. LAMP constituted a potentially valuable tool for rapid diagnosis of food-borne pathogens. This study aimed at developing and evaluating simple and rapid testing methods based on LAMP assays for detection of E. coli O157 and Shiga-toxins, and applying these assays to detection of a large scale of E. coli O157 and non-O157 strains.
Materials and methods Bacterial strains Thirty-four reference strains, including various species of gram-negative and -positive isolates, were included in this study to develop and evaluate the specificity and sensitivity of LAMP assays (Table 1). Application of the LAMP assays were performed on a total of 417 E. coli strains,
123
Three targets were selected to differentiate strains. The protocol was designed to detect the E. coli- specific rfbE gene, virulence genes stx1 (coding for Shiga toxin 1) and stx2 (coding for Shiga toxin 2). For each target gene, a set of inner primers (including forward and backward inner primer), outer primers (including F3 and B3) and loop primers (including LF and LB, to accelerate reaction) was designed for LAMP to target eight distinct regions (Table 2). Forward inner primer (FIP) consisted of the complementary sequence of F1, a T–T–T–T linker and F2; backward inner primer (BIP) consisted of B1C, a T–T–T–T linker and the complementary sequence of B2C. The outer primers F3 and B3 located outside of the F2 and B2 regions, while loop primers LF and LB located between F2 and F1 or B1 and B2, respectively. Establishment of Lamp assays Thirty-four reference strains were used to develop and evaluate the specificity and sensitivity of LAMP assays. Cultural conditions and DNA extraction of gram-negative and gram-positive strains were performed as described previously [16, 21, 23, 24]. To ascertain the detection limits of LAMP and PCR assays, template DNA from WF01201 was diluted for serial tenfold. LAMP assays was carried out in a total of 25 ll reaction mixture containing 1.6 lM (each) of the primers FIP and BIP, 0.2 lM (each) of the primers F3 and B3, 0.8 lM (each) of primers LF and LB, 1.6 mM of deoxynucleoside triphosphates, 6 mM MgSO4, 1 M betain (sigma), 19 thermopol buffer (New England Biolabs), and the specified amounts of target genomic DNA. The reaction was heated at 95°C for 3 min, then chilled on ice, 1 ll (8U) of Bst DNA polymerase (New England Biolabs) was added, after incubation at 65°C for 45 min, the reaction was terminated by heating at 80°C for 2 min. PCR amplification was carried out in a 50 ll reaction volume, using the two outer primers F3 and B3. The thermal profile for PCR was 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s and a final extension cycle at 72°C for 7 min. The amplified products (5 ll/well) were analyzed by gel electrophoresis in 2% agarose gels and stained with ethidium bromide for 10 min.
Mol Biol Rep (2010) 37:2183–2188
2185
Table 1 Reference strains used and the results of LAMP assays Reference strains
No. of strains
LAMP assays rfbE
stx1
stx2
Gram-negative organisms Escherichia coli O157: H7 WF01201 ATCC43889, NCTC12900
3
?
?
?
Escherichia coli O157: H7 WF07803, WF06544, WF05395
3
?
?
-
Escherichia coli O157: H7 WF04402, WF05311, WF06837
3
?
-
?
Escherichia coli O157: H7 WF04587, WF08385, WF06349
3
?
-
-
Escherichia coli O26: H11 WF054489
1
-
?
?
Escherichia coli O127: H6 WF073522 Escherichia coli O148: H28 WF063224
1 1
-
? -
?
Escherichia coli C600 ATCC 25922, ATCC8739, C600, DH5a
4
-
-
-
Psuedomonas aeruginosa ATCC 27853
1
-
-
-
Salmonella typhimurium ATCC 14028
1
-
-
-
Salmonella choleraesuis ATCC 13312
1
-
-
-
Klebsiella pneumoniae ATCC 13883
1
-
-
-
Vibrio cholerae SK10
1
-
-
-
Vibrio parahaemolyticus ATCC 17802
1
-
-
-
Enterobacter cloacae ATCC 23355
1
-
-
-
Acinetobacter baumannii GH31
1
-
-
-
Staphylococcus aureus ATCC 25923
1
-
-
-
Staphylococcus epidermidis ATCC 29887
1
-
-
-
Enterococcus faecalis GH152
1
-
-
-
Stretococcus pyogenes GH126 Stretococcus mitis GH185
1 1
-
-
-
Stretococcus pnuemoniae GH165
1
-
-
-
1
-
-
-
Gram-positive organisms
Stretococcus hemolyticus GH177 Total
Application of LAMP assays on a large scale of E. coli strains
34
Results Optimization of the conditions of LAMP assays
Four hundred and seventeen strains were subjected to detection by LAMP and PCR assays as described above. Template DNA was prepared as described previously [22]. In detail, overnight Luria-Bertani (LB) broth cultures was diluted tenfold in 10 mM Tris–HCl (pH 8.0) containing 1 mM EDTA and the suspension was boiled for 10 min and kept on ice. After centrifugation at 12,000g for 3 min, the resulting supernatant was used as templates for LAMP and PCR assays. Heating and isothermal amplification were performed on water bath and heating block. Amplification products of LAMP assay were dyed with Sybr Green, positive or negative were determined through both visually observation of the color change by naked eye and of and a fluorescence assay under UV. PCR amplicons were determined as described previously. This experiment was performed twice to ensure reproducibility.
In order to determine the optimal conditions of LAMP, DNA from E. coli strain WF01201 was used as target template. The specific amplification generated many ladderlike pattern bands on agarose gel due to its characteristic structure, sizes ranges from 193 bp for rfbE, 217 bp for stx1 and 214 bp for stx2, respectively, up to the loading wells. LAMP assays were under isothermal condition between 60 and 65°C. No significant difference were observed, however, the LAMP product amplified at 65°C showed slightly larger amount of DNA when compared to other temperatures (data not shown), which was consistent with studies previously [19, 20]. Reaction lengths of LAMP assays were varied in 15, 30, 45, 60, 75, 90, 105 and 120 min, under 65°C, with 10 ng template DNA. Without loop primers, amplification products could not be observed until 90 min.
123
2186
Mol Biol Rep (2010) 37:2183–2188
Table 2 List of oligonucleotide primer sequences Target
Sequence (50 –30 )
Size
Position
rfbE F3
AACAGTCTTGTACAAGTCCA
20
903–922
B3
GGTGCTTTTGATATTTTTCCG
21
1,075–1,095
FIP
CTCTCTTTCCTCTGCGGTCC-GATGTTTTTCACACTTATTGGAT
43
936–958, 976–995
BIP
TAAGGAATCACCTTGCAGATAAACT-AGTACATTGGCATCGTGT
43
1,000–1,024, 1,057–1,074
LF
CCAGAGTTAAGATTGAT
17
959–975
LB
CGAAACAAGGCCAGTTTTTTACC
23
1,028–1,050
F3
TGTTGGAAGAATTTCTTTTGGA
22
726–747
B3
GCTAATAGCCCTGCGTATC
19
924–942
FIP BIP
CGCGATGCATGATGATGACAAT-AGTGTTAATGCAATTCTGGGT GAGCTTCCTTCTATGTGCCCG-CAGAGTGGATGAGTCCCA
43 39
748–768, 788–809 832–852, 895–912
LF
TCGCACCGTAATTATGACT
19
769–787
LB
AGATGGAAGAGTGCGTGGG
19
855–873
F3
TCGGTGTCTGTTATTAACCA
20
175–194
B3
TGGAAACCGTTGTCACAC
18
371–388
FIP
AGACGAAGATGGTCAAAACGC-GCAGTTATTTTGCTGTGGA
40
206–224, 252–272
BIP
CCGGGTTCGTTAATACGGCA-CGGGCACTGATATATGTGT
39
302–321, 352–370
LF
TGATAGACATCAAGCCCTCGT
21
228–248
LB
CAAATACTTTCTACCGTTTT
20
323–342
stx1
stx2
While with loop primers, the amplification was initially detected at 30 min, and reached maximal at 45 min. LAMP assays were performed with omission of one or two of the primers, under 65°C for 45 min. However, no amplification could be observed in the absence of FIP, BIP, F3 or B3 primer. For each of the primers plays an indispensable role in auto-cycling strand placement and forming the loop out structure. The LAMP was only performed in the existence of both inner primers and outer primers. Sensitivity and specificity of LAMP assays The detection limits of LAMP and PCR assays were found to be 100 fg DNA/tube and 10 pg DNA/tube for rfbE, 100 fg DNA/tube and 10 pg DNA/tube for stx1, 100 fg DNA/tube and 100 pg DNA/tube for stx2, respectively, indicating that LAMP was at least tenfold more sensitive than PCR (Fig. 2). To determine specificity of the primers, LAMP assays were also subjected to 27 gram-negative and 7 gram-positive isolates. No false positive amplification was observed, indicating high specificity of the established LAMP assays.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16 17 18
Fig. 2 Sensitivity of LAMP assays for detection of E. coli strain WF21201: lane 1–6, 7–12, 13–18 referring to LAMP assays of rfbE, stx1 and stx2, respectively. Lane 1, 7, 13: 1 ng template DNA; lane 2, 8, 14: 100 pg template DNA; lane 3, 9, 15: 10 pg DNA; lane 4, 10, 16: 1 pg DNA; lane 5, 11, 17: 100 fg DNA; lane 6, 12, 18: 10 fg DNA
Application of LAMP assays on E. coli isolates The established LAMP assays were applied to detect 417 E. coli strains using simple equipment and observed
123
Fig. 3 Amplification products of LAMP assays were detected by both visually observation at the color change by naked eye and by a fluorescence assay under UV
Mol Biol Rep (2010) 37:2183–2188
2187
Table 3 Results of LAMP assays on E. coli strains isolated from food samples Clinical E. coli isolatesa
LAMP vs PCR assays (in percentage)
O157
Non-O157
Sensitivity
Specificity
PPV
NPV
No. of isolates
154
263
rfbE
154/154/146
0/0/0
100/94.8
100/100
100/100
100/98.1
stx1
124/118/106
172/164/152
95.3/87.2
100/100
100/100
96.7/90.9
stx2
138/132/122
186/180/169
96.3/89.8
100/100
100/100
97.1/92.1
a
The three number referring to preliminary identified data using standard culturing method, results detected by LAMP assays and PCR assays, respectively
directly by naked eye and under UV light (Fig. 3). Of 154 O157 strains, 154, 118 and 132 strains were detected to be positive for rfbE, stx1 and stx2 by LAMP respectively, while just 146, 106 and 122 were detected by PCR. None of the other 263 non-O157 strains carried rfbE by LAMP and PCR, however, 164 and 180 strains were detected as stx1 and stx2 positive by LAMP with 152 and 169 strains positive by PCR, respectively. The sensitivity of LAMP assays for the rfbE, stx1 and stx2 was 100, 95.3 and 96.3%, and the negative predictive value (NPV) was 100 96.7 and 97.1%, respectively; with a 100% specificity and positive predictive value (PPV) for all three targets. Comparing with PCR method, LAMP was advantageous on sensitivity and NPV, while high specificity and PPV were obtained by both assays (Table 3).
Discussion This study aimed to establish simple and rapid testing methods based on LAMP assays for detection of E. coli O157 and non-O157 strains. Until recently, conventional PCR and real-time PCR approaches had been found to be useful techniques for detection of E. coli strains. However, PCR was technically demanding and requires several hours for a complete diagnosis. It was even known that some inhibitors in samples reduce the sensitivity of PCR when attempting to detect a target gene [5]. Real-time PCR assay had many advantages over conventional PCR, including rapidity, lower contamination rate, higher sensitivity and easy standardization. However, demanding operation and expensive kits and equipment restricted its application to clinical laboratories [12]. Other isothermal amplification techniques, such as nucleic acid sequence-based amplification (NASBA) and the self-sustained sequence reaction (SSR), were reported to be less specific owing to the low stringency (40°C) and, thus, requiring either a precision instrument for amplification or an elaborate method for detection of the amplified products due to the poor specificity of target sequence selection. As a novel nucleic acid amplification method, LAMP was known as a rapid, specific, sensitive,
cost-effective and easy-operating alternative for detection of clinical pathogens. With inner and outer primers recognizing six distinct regions, and with the reaction under isothermal without thermal cycler, LAMP was bestowed by high sensitivity, specificity and amplification efficiency. In this study, detection limits of LAMP assay were 1–10 pg of template DNA, showing 10–100 times more sensitive than PCR assay. The sensitivity of LAMP was less affected by various components of clinical samples [7], so the sensitivity of LAMP was more advantageous when some simple and rapid DNA purification methods were applied. When applied LAMP assays to detect E. coli strains, sensitivities of 100, 95.3, 96.3% for rfbE, stx1 and stx2 respectively were found, with the 100% specificity. Furthermore, LAMP had advantages on easiness and rapidness in operation of reaction and determination of result. In the application of LAMP assays, the total detection time was approximately 60 min, with its simple equipment requirement. In conclusion, LAMP assays were demonstrated to be useful and powerful methods for detection of E. coli O157 strains, which also constituted potentially valuable tools for rapid diagnosis of food-borne pathogens in both commercial and clinical fields. Acknowledgments This work was supported by Science Foundation of Ministry of Education of China(706046), National Natural Science Foundation of China (20436020) and State Scholarship Fund of China Scholarship Council (2008615044).
References 1. Baudouin V, Mariani-Kurkdjian P, Macher MA, Ait-Ifrane S, Garnier A, Bingen E, Loirat C, Deschenes G (2008) Treatment of a relapsing HUS secondary to prolonged carriage of E. coli O157: H7. Pediatr Nephrol 23:1599 2. Chapman PA, Ellin M, Ashton R (2001) A comparison of immunomagnetic separation and culture, Reveal(TM) and VIPTM for the detection of E. coli O157 in enrichment cultures of naturally-contaminated raw beef, lamb and mixed meat products. Lett Appl Microbiol 32:171–175 3. Crawford CG, Wijey C, Fratamico P, Tu SI, Brewster J (2000) Immunomagnetic-electrochemiluminescent detection of E. coli O157: H7 in ground beef. J Rapid Methods Autom Microbiol 8: 249–264
123
2188 4. Gehring AG, Tu SI (2005) Enzyme-linked immunomagnetic electrochemical detection of live Escherichia coli O157: H7 in apple juice. J Food Protect 68:146–149 5. Horisaka T, Fujita K, Iwata T, Nakadai A, Okatani AT, Horikita T, Taniguchi T, Honda E, Yokomizo Y, Hayashidani H (2004) Sensitive and specific detection of Yersinia pseudotuberculosis by loop-mediated isothermal amplification. J Clin Microbiol 42:5349–5352 6. Jung BY, Jung SC, Kweon CH (2005) Development of a rapid immunochromatographic strip for detection of Escherichia coli O157. J Food Protect 68:2140–2143 7. Kaneko H, Kawana T, Fukushima E, Suzutani T (2007) Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J Biochem Biophys Methods 70:499–501 8. Mori Y, Nagamine K, Tomita N, Notomi T (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 289:150–154 9. Mullah B, Livak K, Andrus A, Kenney P (1998) Efficient synthesis of double dye-labeled oligodeoxyribonucleotide probes and their application in a real time PCR assay. Nucleic Acids Res 26: 1026–1031 10. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T (2001) Loop-mediated isothermal amplification reaction using a nondenatured template. Clin Chem 47:1742–1743 11. Organization, World Health (2007) Food safety and foodborne illness. Available via DIALOG. http://www.who.int/mediacentre/ factsheets/fs237/en/print.html 12. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM, Islam MA, Inoue S, Hosaka N, Morita K (2005) Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J Clin Microbiol 43:2895–2903 13. Rasekh J, Thaler AM, Engeljohn DL, Pihkala NH (2005) Food safety and inspection service policy for control of poultry contaminated by digestive tract contents: a review. J Appl Poult Res 14: 603–611
123
Mol Biol Rep (2010) 37:2183–2188 14. Sanchez A, Navarro RB, Marquez RF, Quintana MF, Perez LS, Guilarte OD, Martinez HB, Bello LM (2008) Enterohemorrhagic Escherichia coli O157: H7 isolates from children in Cuba. Pediatr Infect Dis J 27:1122–1123 15. Shelton DR, Karns JS (2001) Quantitative detection of Escherichia coli O157 in surface waters by using immunomagnetic electrochemiluminescence. Appl Environ Microbiol 67:2908–2915 16. Su JY, Shi L, Yang LS, Xiao ZH, Li XH, Yamasaki S (2006) Analysis of integrons in clinical isolates of Escherichia coli in China during the last six years. FEMS Microbiol Lett 254:75–80 17. Tsugunori Notomi HOHM (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28:E63 18. Tu SI, Golden M, Fett WF, Gehring A, Irwin P (2003) Rapid detection of outbreak Escherichia coli O157 and Salmonella on alfalfa sprouts by immunomagnetic capture and time-resolved fluorescence. J Food Saf 23:75–89 19. Wang L, Li L, Alam MJ, Geng YH, Li ZY, Yamasaki SJ, Shi L (2008) Loop-mediated isothermal amplification method for rapid detection of the toxic dinoflagellate Alexandrium, which causes algal blooms and poisoning of shellfish. FEMS Microbiol Lett 282: 15–21 20. Wang L, Shi L, Alam MJ, Geng Y, Li L (2008) Specific and rapid detection of foodborne Salmonella by loop-mediated isothermal amplification method. Food Res Int 41:69–74 21. Xu Z, Shi L, Zhang C, Zhang L, Li X, Cao Y, Li L, Yamasaki S (2007) Nosocomial infection caused by class 1 integron-carrying Staphylococcus aureus in a hospital in South China. Clin Microbiol Infect 13:980–984 22. Xu ZB, Li L, Alam MJ, Zhang LY, Yamasaki S, Shi L (2008) First confirmation of integron-bearing methicillin-resistant Staphylococcus aureus. Current Microbiology 57:264–268 23. Xu ZB, Li L, Shirtliff ME, Alam MJ, Yamasaki S, Shi L (2009) Occurrence and characteristics of class 1 and 2 integrons in Pseudomonas aeruginosa isolates from patients in Southern China. J Clin Microbiol 47:230–234 24. Xu ZB, Shi L, Alam MJ, Li L, Yamasaki S (2008) Integronbearing methicillin-resistant coagulase-negative staphylococci in South China, 2001–2004. FEMS Microbiol Lett 278:223–230
