World J Microbiol Biotechnol (2011) 27:181–184 DOI 10.1007/s11274-010-0429-0
SHORT COMMUNICATION
Development and application of a loop-mediated isothermal amplification method on rapid detection of Pseudomonas aeruginosa strains Xihong Zhao • Li Wang • Yanmei Li • Zhenbo Xu • Lin Li • Xiaowei He • Yao Liu Jihua Wang • Liansheng Yang
•
Received: 28 December 2009 / Accepted: 26 April 2010 / Published online: 9 May 2010 Ó Springer Science+Business Media B.V. 2010
Abstract We developed and evaluated the specificity and sensitivity of a simple loop-mediated isothermal amplification (LAMP) method for rapid detection of P. aeruginosa strains. The optimal reaction condition was found to be 65°C for 45 min, with the detection limit as 100 fg DNA/ tube and 10 CFU/reaction. Application of LAMP assays were performed 426 clinical samples (including 252 P. aeruginosa and 174 non- P. aeruginosa isolates) using a rapid procedure and easy result confirmation. Sensitivity of
Xihong Zhao and Li Wang contributed equally to this work. X. Zhao Z. Xu (&) L. Li X. He (&) L. Yang College of Light Industry and Food Sciences, South China University of Technology, Guangzhou 510640, China e-mail:
[email protected] X. He e-mail:
[email protected] L. Wang Food Safety Key Laboratory of Guangdong Province, College of Food Science, South China Agricultural University, Guangzhou, China Y. Li Guangzhou Medical College, Guangzhou, China Z. Xu Department of Microbial Pathogenesis, Dental School, University of Maryland-Baltimore, Baltimore, Maryland 21201, USA Y. Liu Zhongshan Supervision Testing Institute of Quality & Metrology, Zhongshan, China J. Wang Guangzhou Wondfo Biotechnology Company, Guangzhou, China
LAMP and PCR assays was found to be 97.6% (246/252) and 90.5% (228/252), respectively; with a 100% specificity for both assays. Keywords Loop-mediated isothermal amplification (LAMP) P. aeruginosa Rapid detection
Introduction Pseudomonas aeruginosa is a rod-shaped gram-negative obligatorily aerobic bacterium belonging to the family of Pseudomonadaceae, remaining one of the most important pathogens in the nosocomial setting, where it is a common causative agent of bacteremia, pneumonia, and urinary tract infections (Jarvis and Martone 1992; Schwartz et al. 2006). As one of the three most abundant bacterial species causing nosocomial infections in intensive care units, P. aeruginosa is capable of growing in a wide variety of niches with a preference for moist environments and a ubiquitous environmental organism and a major opportunistic pathogen causing human infections (Spencer 1996). Nosocomial infections caused by this organism are usually associated with high mortality regardless of appropriate antimicrobial therapy. With increased awareness in public health and as a major concern of nosocomial infection, development of a rapid, sensitive, cost-effective and easy-operating bacteriological P. aeruginosa detection method is of the utmost importance and urgent necessity. PCR and real-time PCRbased assays have been employed and developed for the past decades (Schwartz et al. 2006; Lodeng et al. 2006; Deschaght et al. 2009). However, disadvantages for PCR (time consumption for post determination, risk of contamination and low levels detection limit) and real-time
123
182
World J Microbiol Biotechnol (2011) 27:181–184
PCR (requirement for trained personnel, operating space, expensive equipment and reagents) posed significant obstacles for their broad application. Most recently, a novel nucleic acid amplification method, designated loop-mediated isothermal amplification (LAMP), known as a rapid, low-cost, easy operating, highly sensitive and specific detection method, had been reported and applied in the field of bacteriological detection. This method relies on an auto-cycling strand displacement DNA synthesis performed by the Bst DNA polymerase large fragment, which is different from PCR in that 4 or 6 primers targeting 6 or 8 specific regions of detected gene. The amplification uses isothermal conditions between 60 and 65°C, and the amplicons are mixtures of many different sizes of stemloop DNAs with several inverted repeats of the target sequence and cauliflower-like structures with multiple loops. In the current study, we develop a simple LAMP assay and apply it to detection on a large scale of P. aeruginosa strains from various clinical specimens, in which only visual observation of color changes is employed for the confirmation of results and no more than 60 min is needed for the whole process.
Materials and methods The protocol was designed to detect the species specific target oprI to differentiate P. aeruginosa and non- P. aeruginosa strains. A set of 6 primers was designed for LAMP to target 8 distinct regions (Table 1). Twenty-three reference strains, including various species of gram-negative and -positive isolates, were included in this study to develop and evaluate the specificity and sensitivity of LAMP assay (Table 2). Cultural conditions and DNA extraction of gram-negative and gram-positive strains were performed as described previously (Xu et al. 2007, 2008a, b, 2009). The detection limits of LAMP and PCR assays were ascertained by both minimal CFU of bacterial and template DNA amount. In brief, overnight culture and template DNA from ATCC 27853 were diluted with sterile water for serial 10-fold, ranging from 102 to 108 CFU/ml
and 10-14 to 10-7 fg, respectively. A negative control was performed using sterile water instead of DNA template. LAMP and regular PCR assays was carried out as described previously (Zhao et al. 2009). Application of the optimized LAMP and PCR assays was performed on a total of 426 clinical samples, including 252 P. aeruginosa and 174 non- P. aeruginosa isolates. Two hundred and fiftytwo consecutive P. aeruginosa strains were isolated from various clinical specimens, including sputum (46%, 116/ 252), blood (22%, 55/252), urine (14%, 35/252), pus (11%, 27/252) and others (7%, 19/252). Sample collection and processing were performed according standard procedure. Isolates were identified to the species level with a Vitek system (Vitek AMS; bioMerieux Vitek Systems Inc., Hazelwood, MO) and further confirmed by an API 20NE (bioMerieux). All samples had also been preliminarily reidentified in the Lab of Clinical Microbiology of Zhongshan Supervision Testing Institute of Quality & Metrology. Template DNA was prepared through a rapid procedure. In detail, overnight Luria–Bertani (LB) broth cultures was diluted 10-fold in 10 mM Tris–HCl (pH 8.0) containing 1 mM EDTA and the suspension was boiled for 10 min and kept on ice. After centrifugation at 12,000g for 3 min, the resulting supernatant was used as templates for LAMP and PCR assays. Heating and isothermal amplification were performed on water bath and heating block. Amplification products of LAMP assay were dyed with Sybr Green, positive or negative were determined through both visual observation of the color change by naked eye and a fluorescence assay under UV. This experiment was performed twice to ensure reproducibility.
Results and discussion The specific amplification generated many ladder-like pattern bands on agarose gel due to its characteristic structure up to the loading wells, with a 182-bp size amplicon obtained. The optimal reaction condition was determined as 65°C for 45 min. The detection limits of LAMP assay was found to be 100 fg DNA/tube and
Table 1 List of oligonucleotide primer sequences Sequence (50 –30 )
Size
Position
F3
CTGGCTGCTGTTCTGG
16
34–49
B3
CGCTCGTTAGCCTCGT
16
200–215
FIP
CTGCGTCTTCGGTAGCGG-GGTTGCAGCAGCCACT
34
55–70, 95–112
BIP
TCAGGCTCGCGCTGACGA-AGTCTGCTGAGCTTTCTGAG
38
123–140, 176–195
LF
TCTTTGGCTTCGAGCAGACT
20
75–94
LB
GCCTATCGCAAGGCTGACGAA
21
142–162
Target oprI
123
World J Microbiol Biotechnol (2011) 27:181–184
183
Table 2 Reference strains used and the results of LAMP assays Reference strains
No. of strains
Culture
LAMP
PCR
Gram-negative organisms Psuedomonas aeruginosa ATCC 27853
1
?
?
?
Klebsiella pneumoniae ATCC 13883
1
-
-
-
Enterobacter cloacae ATCC 23355
1
-
-
-
Acinetobacter baumannii GH31
1
-
-
-
Vibrio parahaemolyticus O3: K6 WF 01031
1
-
-
-
Vibrio parahaemolyticus O4: K37 WF 01309
1
-
-
-
Vibrio cholerae SK10
1
-
-
-
Vibrio vulnificus ATCC 27562
1
-
-
-
Vibrio mimicus ATCC 33653
1
-
-
-
Escherichia coli O157: H7 ATCC43889, NCTC12900 Escherichia coli C600 ATCC 25922, C600, DH5a
2 3
-
-
-
Salmonella typhimurium ATCC 14028
1
-
-
-
Gram-positive organisms Staphylococcus aureus ATCC 25923
1
-
-
-
Staphylococcus epidermidis ATCC 29887
1
-
-
-
Enterococcus faecalis GH152
1
-
-
-
Enterococcus faecium GH148
1
-
-
-
Stretococcus pyogenes GH126
1
-
-
-
Stretococcus mitis GH185
1
-
-
-
Stretococcus pnuemoniae GH165
1
-
-
-
Stretococcus hemolyticus GH177
1
-
-
-
Total
23
1
2
3
4
5
6
Fig. 1 Sensitivity of LAMP assays for detection of P. aeruginosa strain ATCC 27853: lane 1: 1 ng template DNA; lane 2: 100 pg template DNA; lane 3: 10 pg DNA; lane 4: 1 pg DNA; lane 5: 100 fg DNA; lane 6: 10 fg DNA
10 CFU/reaction (LAMP was positive for sample containing 1 9 104 CFU/ml, with 1 ul was included in the reaction system), and PCR was 10 pg DNA/tube and 103 CFU/reaction, respectively, indicating that LAMP was
100-fold more sensitive than PCR (Fig. 1). Simultaneously, high specificity was acquired when LAMP assay was subjected to 23 reference strains, with no false positive amplification observed (Table 2). This established LAMP assay was compared with PCR by application on detecting 426 clinical specimens, using conventional culturing method as standard. Rapid DNA preparation process as aforementioned was used and results were confirmed by observation directly by naked eye and under UV light (Fig. 2). Of 252 P. aeruginosa strains, 246 and 228 were detected to be positive by LAMP and PCR, respectively, with sensitivity as 97.6% versus 90.5%. All of the 174 nonP. aeruginosa samples were found to be negative, indicating a 100% high specificity obtained by both assays (Table 3).
Conclusions In conclusion, this LAMP assay was demonstrated to be a useful and powerful tool for rapid detection of P. aeruginosa strains. Comparing with previously reported molecular detection methods, the established LAMP assay in the present study offers advantages on easiness in operation and time consumption. The total detection time,
123
184
World J Microbiol Biotechnol (2011) 27:181–184
Fig. 2 Amplification products of LAMP assays were visually detected both by observation at the color change by naked eye and by a fluorescence assay under UV
Table 3 Comparison of LAMP and PCR assays on P. aeruginosa strains isolated from food samples P. aeruginosa
Non-P. aeruginosa
LAMP vs PCR assays (in percentage) Sensitivity
Specificity PPV NPV
No. of isolatesa a
252/246/228
0/0/0
263
263
97.6/90.5
100/100
The three number referring to preliminary identified data using standard conventional culturing method, LAMP and PCR assays, respectively
including DNA preparation, LAMP reaction and results determination, was approximately 60 min, and simple equipment as water bath was required for reaction, with high sensitivity and specificity as 97.6 and 100%, respectively. Undoubtedly, rapidness, easiness and cost-effectiveness of LAMP assay will aid in the broad application of bacteriological detection of P. aeruginosa. Acknowledgments This work was supported by Science Foundation of Ministry of Education of China (706046), National Natural Science Foundation of China (20436020) and State Scholarship Fund of China Scholarship Council (2008615044).
References Deschaght P, de Baere T, van Simaey L, van Daele S, de Baets F, de Vos D, Pirnay JP, Vaneechoutte M (2009) Comparison of the sensitivity of culture, PCR and quantitative real-time PCR for the detection of Pseudomonas aeruginosa in sputum of cystic fibrosis patients. BMC Microbiol 9:244 Jarvis WR, Martone WJ (1992) Predominant pathogens in hospital infections. J Antimicrob Chemother 29(Suppl A):19–24 Lodeng AGG, Ahlen C, Lysvand H, Mandal LH, Iversen OJ (2006) Development and evaluation of a new PCR assay for detection of Pseudomonas aeruginosa D genotype. Clin Microbiol Infect 12:761–768
123
Schwartz T, Volkmann H, Kirchen S, Kohnen W, Schon-Holz K, Jansen B, Obst U (2006) Real-time PCR detection of Pseudomonas aeruginosa in clinical and municipal wastewater and genotyping of the ciprofloxacin-resistant isolates. FEMS Microbiol Ecol 57:158–167 Spencer RC (1996) Predominant pathogens found in the European prevalence of infection in intensive care study. Eur J Clin Microbiol Infect Dis 15:281–285 Xu Z, Shi L, Zhang C, Zhang L, Li X, Cao Y, Li L, Yamasaki S (2007) Nosocomial infection caused by class 1 integron-carrying Staphylococcus aureus in a hospital in South China. Clin Microbiol Infect 13:980–984 Xu Z, Li L, Alam MJ, Zhang L, Yamasaki S, Shi L (2008a) First confirmation of integron-bearing methicillin-resistant Staphylococcus aureus. Curr Microbiol 57:264–268 Xu Z, Shi L, Alam MJ, Li L, Yamasaki S (2008b) Integron-bearing methicillin-resistant coagulase-negative staphylococci in South China, 2001–2004. FEMS Microbiol Lett 278:223–230 Xu Z, Li L, Shirtliff ME, Alam MJ, Yamasaki S, Shi L (2009) Occurrence and characteristics of class 1 and 2 integrons in Pseudomonas aeruginosa isolates from patients in Southern China. J Clin Microbiol 47:230–234 Zhao X, Li Y, Wang L, You L, Xu Z, Li L, He X, Liu Y, Wang J, Yang L (2009) Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples. Mol Biol Rep. doi: 10.1007/s11033-009-9700-6
