RESEARCH LETTER
Development and application of a loop-mediated isothermal amplification assay for rapid detection of Pythium helicoides Reiko Takahashi1, Shiro Fukuta1, Satoru Kuroyanagi1, Noriyuki Miyake1, Hirofumi Nagai1, Koji Kageyama2 & Yasushi Ishiguro2 1
Agri-environmental Division, Aichi Agricultural Research Center, Nagakute, Aichi, Japan; and 2River Basin Research Center, Gifu University, Gifu, Japan
Correspondence: Reiko Takahashi, Agri-environmental Division, Aichi Agricultural Research Center, 1-1 Sagamine, Yazako, Nagakute, Aichi, 488-1193, Japan. Tel.:+81 561 62 0085; fax: +81 561 63 0815; e-mail:
[email protected] Received 13 January 2014; revised 11 March 2014; accepted 29 April 2014. Final version published online 22 May 2014. DOI: 10.1111/1574-6968.12453
MICROBIOLOGY LETTERS
Editor: David Studholme Keywords Pythium helicoides; hydroponic culture; loopmediated isothermal amplification.
Abstract Root rot of poinsettia, caused by Pythium helicoides at high temperatures in hydroponic cultures, has become a serious problem in many parts of the world. We have developed a species-specific, loop-mediated isothermal amplification (LAMP) assay for the rapid diagnosis of this pathogen. The primers were designed using the ribosomal DNA internal transcribed spacer sequence. Primer specificity was established using 40 Pythium species including P. helicoides, 11 Phytophthora species, and eight other soil-borne pathogens. A sensitivity test was carried out using genomic DNA extracted from P. helicoides, and the detection limit was c. 100 fg which is comparable to that of the polymerase chain reaction (PCR). In addition, we tested the ease of pathogen detection in poinsettia roots. The LAMP results were consistent with those from the conventional plating method and showed more sensitivity than the PCR results. Consequently, the LAMP method developed in this study is effective for the rapid and easy detection of P. helicoides.
Introduction Root rot associated with high-temperature-growing Pythium species occurs in hydroponic cultures of vegetables and flowers. These Pythium species are known to be able to grow at temperature in excess of 40 °C and show significantly higher rates of proliferation and infection at high temperatures than other Pythium species. In addition, these pathogens can spread rapidly in hydroponic growth facilities via the nutrient solutions. Therefore, delays in disease detection lead to serious damage. Pythium helicoides is one of the high-temperaturegrowing Pythium species and was first isolated from Phaseolus vulgaris and described in 1930 (van der PlaatsNiterink, 1981). In Japan, the first report of P. helicoides was made in 1996, when it was found to cause root rot of miniature roses (Kageyama et al., 2002, 2003). Since then, diseases caused by this oomycete have been reported in many other crops (Suzuki et al., 2005; Watanabe et al., 2005, 2007; Miyake et al., 2012). ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
The conventional method for the identification of Pythium species is based on micromorphology and growth characteristics on specific media. However, this method is time-consuming and requires special skills (Pettitt et al., 2002). In recent years, molecular detection systems using species-specific primers and the polymerase chain reaction (PCR) have been developed. These approaches typically involve the amplification of the ribosomal DNA internal transcribed spacer (rDNA ITS) region or the mitochondrial cytochrome oxidase II gene (Kageyama et al., 1997; Wang et al., 2003; Ling et al., 2007). Elaborations of the PCR-based method include the use of species-specific SCAR markers (Ahonsi et al., 2010), PCR-restriction fragment length polymorphisms (PCR-RFLP) (G omez-Alpızar et al., 2011), real-time PCR (Schroeder et al., 2006), and multiplex PCR (Asano et al., 2010; Ishiguro et al., 2013). These PCR methods are faster and more sensitive than the traditional plating system. However, PCR requires special equipment, an experienced technician and several hours for each assay. Thus, it is FEMS Microbiol Lett 355 (2014) 28–35
LAMP assay for rapid detection of Pythium helicoides
not amenable to the detection of pathogens in agricultural field settings. Loop-mediated isothermal amplification (LAMP) is a novel DNA amplification method developed by Notomi et al. (2000). The LAMP method requires a specially designed primer set that recognizes six independent regions of the target sequence. The use of these primers increases the specificity and speed of the reaction when compared with PCRs. The amplification time can be further reduced using loop primers (Nagamine et al., 2002). The LAMP reaction proceeds at a constant temperature and involves Bst DNA polymerase, which has strand displacement activity. Even with the presence of nontarget DNA, positive and negative results can be visually assessed by the turbidity of magnesium pyrophosphate, which is a byproduct of the reaction (Mori et al., 2001, 2004). Thus, there is no need for special equipment. Because the LAMP method can amplify DNA with high specificity and efficiency without the need for special equipment, it is suitable for the detection and identification of plant pathogens at agriculture sites. LAMP assays
29
have been developed for the detection of plant pathogenic viruses (Fukuta et al., 2003, 2004), viroids (Boubourakas et al., 2009), fungi (Tomlinson et al., 2010), bacteria (Rigano et al., 2010), and oomycete pathogens (Tomlinson et al., 2007; Dai et al., 2012). In hydroponic cultures, aqueous media containing necessary nutrients are supplied to the roots of crops. It is easy to manage the nutrients, to grow the plants quickly, and to produce high-quality crops efficiently. For these reasons, the use of hydroponic cultures is increasing. However, in hydroponic culture, there is also the risk that disease will spread rapidly through the culture medium, resulting in severe damage to the crop in a short time. This problem is most serious in commercial greenhouses. Therefore, it is a necessary to develop rapid diagnostic techniques in order to reduce the risk of crop damage. In this study, we developed a LAMP assay for the detection of P. helicoides using a species-specific target ITS sequence. This assay will be useful for the early diagnosis of this high-temperature-growing Pythium species in hydroponic cultures.
(a)
(b)
Fig. 1. Design of LAMP primers specific for Pythium helicoides based on ITS sequences. (a) Schematic representation of LAMP-amplified regions. (b) Nucleotide sequence alignment of ITS sequences from P. helicoides and three closely related species. In the aligned sequences, an asterisk indicates a match and a dash indicates a gap sequence. DNA sequences used for primer design are indicated by bold lines.
FEMS Microbiol Lett 355 (2014) 28–35
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
30
R. Takahashi et al.
Materials and methods Design of LAMP primers
The LAMP primers (Fig. 1a) were designed using the P. helicoides rDNA ITS sequence (GenBank accession number: AB108023). This sequence and those of related species [P. chamaehyphon (AJ233440), P. oedochilum (AB108020), and P. ostracodes (AB108022)] were retrieved from the GenBank database and aligned to identify highly conserved regions using the DNSIS software (Hitachi Solutions; Fig. 1b). These four species belong to the molecular phylogenic clade K identified by Levesque & de Cock (2004). The LAMP primers were designed using the PRIMER EXPLORER V4 software program (http://primerexplorer. jp) and modified manually. We used P. helicoides speciesspecific regions to design a set of four primers, including two outer primers (forward primer F3 and backward primer B3) and two inner primers [forward inner primer (FIP) and backward inner primer (BIP)], that identified six regions of the target DNA. Additionally, we designed two loop primers (F-Loop and B-Loop), which can accelerate the LAMP reaction. The sequences of the primers are listed in Table 1. Species and strains and DNA extraction
The strains used to evaluate the specificity of the primers are listed in Table 2. We tested a total of 40 Pythium strains including P. helicoides, 11 Phytophthora strains, and eight other soilborne pathogens (Aphanomyces, Fusarium, Plasmodiophora, Pyrenochaeta, Rhizoctonia, Saprolegnia, Verticillium, and Sclerotinia spp.). Genomic DNA was extracted from mycelia using the procedure of Li et al. (2011).
10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.8 M betaine (Sigma-Aldrich), 4 mM MgSO4, 1.6 mM dNTPs, 0.2 lM each of the F3 and B3 primers, 1.6 lM each of the FIP and BIP primers, 0.8 lM each of the F-Loop and B-Loop primers, 8 units of Bst DNA polymerase (New England Biolabs Japan, Tokyo, Japan), and 1 lL of genomic DNA as the template. Reactions designed to determine the optimal reaction temperature were incubated for 90 min at 63, 65, or 67.5 °C without the loop primers. Subsequently, reactions including the loop primers were incubated for 90 min at 67.5 °C. Realtime monitoring of P. helicoides genome amplification was performed by recording the turbidity of each reaction every 6 s using an LA200 (Teramecs, Kyoto, Japan) realtime turbidimeter. PCRs
PCRs were performed using the method of Ling et al. (2007) with minor modifications. Each reaction was carried out in a total volume of 25 lL containing 1 lL DNA, 19 PCR buffer (10 mM pH 8.3 Tris-HCl, 50 mM KCl and 1.5 mM MgCl2), 0.2 mM dNTPs, 1 lM each primers (hel-F2: 50 -GCGAGCTATCTGTAAACTTGTC-30 , hel-R4: 50 -ACACCTCACATCTGCCACAA-30 ), 10 ng bovine serum albumin (Sigma-Aldrich, Tokyo, Japan), and 1 unit of Fast Start Taq DNA polymerase (Roche Applied Science, Tokyo, Japan). Samples were incubated in a thermal cycler (Gene Amp PCR system 2700, ABI, Tokyo, Japan) with the following program: 3 min at 94 °C, 40 cycles 1 min at 95 °C, 1 min at 65 °C, and 2 min at 72 °C, and a final extension for 10 min at 72 °C. The amplification products were subjected to 2% agarose gel electrophoresis, stained with ethidium bromide, and visualized under UV light.
LAMP reactions
Each LAMP reaction was performed in a total reaction volume of 25 lL containing 20 mM Tris-HCl pH 8.8, Table 1. Sequences of the LAMP primers used to detect Pythium helicoides
Primer
Sequences (50 ?30 )
Genome position*
F3 B3 FIP
GACGAGTCTGGCGACCTT CCACGCACGAAACAGAACA CATTGTCAAAGCCGCGCGAACATGCTTGGGCACTGTGT TGTGTTTGGGCTGTCGTGCTAACAGACACGCGAAACGC CGCAGCCTAACATACCGCCA TGAACCGGATGGTCGATG
500–508 680–699 567–586 (F1c)-527–544 (F2) 598–617 (B1c)-653–670 (B2) 547–566 625–642
BIP F-Loop B-Loop
*Genome Position refers to the nucleotide sequence of ITS region of P. helicoides (accession number AB10823).
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Detection of P. helicoides in infected plants
To demonstrate the field application of LAMP as a tool for the detection of P. helicoides, the poinsettia roots that showed discoloration and symptomatic of root rot were collected from some greenhouses in Aichi Prefecture, Japan. The roots were examined using the LAMP and PCR methods. For each sample, the roots were cut into 2-cm segments and placed in a 15-mL conical tube with 5-mL distilled water, and the tube was shaken by hand for 1 min. Samples of the resulting suspension (5 lL) were used as templates in LAMP and PCRs. The detection of LAMP amplification products was detected by realtime monitoring and observation of turbidity as white precipitate with the naked eye. In addition, the same roots were removed from the tubes and used to confirm
FEMS Microbiol Lett 355 (2014) 28–35
31
LAMP assay for rapid detection of Pythium helicoides
Table 2. Specificity of the LAMP primer set for Pythium helicoides Species
Clade*
Isolate
Host
LAMP detection
Pythium adhaerens P. aphanidermatum P. monospermum P. arrhenomanes P. graminicola P. myriotylum P. plurisporium P. sulcatum P. torulosum P. aquatile P. dissotocum P. pyrilobum P. acanthicum P. periplocum P. oligandrum P. hypogynum P. rostratum P. middletonii P. parvum P. takayamanum P. intermedium P. irregulareI P. irregulareII P. spinosum P. sylvaticum P. nagaii P. paddicum P. anandrum P.senticosum P. undulatum P. heterothallicum P. splendes P. ultimum P. nunn P. polymastum P. chamaehyphon P. helicoides
A A A B1 B1 B1 B1 B1 B1 B2 B2 B2 D D D E1 E1 E2 E2 E2 F F F F F G G H H H I I I J J K K K K K K K K K K K K K K K K K 1 2 2 3
CBS520.74 TA114 N02E2 3-4 NBRC 100102 MAFF425415 NBRC100113 CBS100117 NBRC100117 TJu143 NBRC107450 MAFF305576 NBRC107365 MAFF241099 NBRC100114 GFSt2-1 CBS234.94 NBRC100115 CBS528.74 1B4162 NBRC104223 CBS266.38 NBRC100108 CBS263.30 NBRC100116 NBRC100119 CO132 IFO31993 CBS285.31 NBRC104222 NBRC107363 1D2S021 C101 NBRC100122 CBS808.96 CBS811.70 CBS259.30 NBRC100107 B5 ori OM6-1 sh Tsu-C1 RoToori SP-KS04-A2 ERR-1 Nastr1 GiBeg1 TGhel5 sh1 GUPo1 sh RO-Ph1 sz1 Fuk 3-1 YP1 CBS768.73 2D111 GF101 C94 IFO30696 C71
Soil
+ + + + + + + + + + + + +
P. oedochilum P. ostracodes P. vexans Phytophthora nicotiane Ph. citricola Ph. capsici Ph. nemorosa
FEMS Microbiol Lett 355 (2014) 28–35
Zoysia grass Corn Kidney bean Root Carrot Carrot Water
Soil Zoysia grass Soil Soil Zoysia grass Soil Soil Soil Soil Carrot Nicotianatabacum Carrot field soil Carrot field soil Soil Water Rheum rhaponiticum Soil Water Soil Anigozanthus Sugar beet Soil Papaya Rose Rose Rose Chrysanthemum Rose Strawberry Erica spp. Strawberry Begonia Strawberry Poinsettia Rose Soy bean Soil Soil Kalanchoe Eustomagrandiflorum Cucurbita Sarcandraglabra
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
32
R. Takahashi et al.
Table 2. Continued Species
Clade*
Isolate
Host
LAMP detection
Ph. palmivora Ph. heveae Ph. humicola Ph. cambivora Ph. cryptogea Ph. insolita Ph. chrysanthemi Aphanomyce ssp. Fusarium oxysporum Plasmodiophora brassicae Pyrenochaeta lycopercisi Rhizoctonia solani Saprolegnia sp. Verticillium alboatrum Sclerotinia sclerotiorum
4 5 6 7 8 9 10
P0113 P1102 P3826 P6358 CH92-15 P6195 GF749 GFHT6 MAFF72510 HY Type1 S02 IFO32708 Vaal 130308 AiTog
Papaya Avocado Soil, citrus grove Almond Solanummammosum Soil in citrus orchard Chrysanthemum Spinach Strawberry Chinese cabbage Tomato Bacopa Brown trout
Wax gourd
+, detection; , nondetection. *Molecular phylogenetic clades (Levesque & de Cock, 2004; Blair et al., 2008).
P. helicoides infection using the conventional plating method of Kageyama et al. (2003).
Results and discussion Optimization of the LAMP reaction
To determine the optimal temperature for P. helicoides detection, the LAMP reactions were performed at 63, 65, and 67.5 °C, using the four basic LAMP primers (F3, B3, (a)
FIP, and BIP). Pythium helicoides was used as a positive control, and four closely related species from clade K (P. chamaehyphon, P. oedochilum, P. ostracodes, and P. vexans; Levesque & de Cock, 2004) were used as negative controls. The results are shown in Fig. 2a–c. Pythium helicoides was detected after 35 min at 63 °C (Fig. 2a) and after 30 min at 65 °C (Fig. 2b) and 67.5 °C (Fig. 2c). Because higher reaction temperatures decrease nonspecific primer annealing (Sung & Lu, 2009), 67.5 °C was selected for further evaluation. Furthermore, the use of two addi(b)
0.6
0.6 P.chamaehyphon
P.chamaehyphon
0.5
P.helicoides P.oedochilum
0.4
P.ostracodes
Turbidity
Turbidity
Blank
0.2
0
10
20
30
40
50
60
70
80
90
Time (min)
Blank
0.3 0.2
0 –0.1
10
20
30
40
50
60
70
80
90
Time (min)
0.6 P.chamaehyphon P.helicoides P.oedochilum P.ostracodes P.vexans
0.5 0.4
Turbidity
P.ostracodes
0
0
(c)
0.4
0.1
0.1
–0.1
P.helicoides P.oedochilum P.vexans
P.vexans
0.3
0.5
Blank
0.3 0.2 0.1 0 0 –0.1
10
20
30
40
50
60
70
80
90
Time (min)
Fig. 2. Effects of LAMP reaction temperatures on efficiency and specificity of amplification. (a) 63 °C; (b) 65 °C; (c) 67.5 °C.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
FEMS Microbiol Lett 355 (2014) 28–35
33
LAMP assay for rapid detection of Pythium helicoides
tional loop primers can reduce the signal generation time. We found that amplification could be observed in real time with a turbidimeter after only 18 min when the loop primers were used (data not shown). Therefore, we used the loop primers in the following tests.
rDNA ITS region, which has species-specific sequences (Fig. 1). Previous studies have also shown that the ITS region is useful for the detection and identification of Pythium species (Kageyama et al., 2003). Sensitivity test
Specificity of the LAMP assay
The specificity of the LAMP assay was tested using 57 strains representing 40 Pythium species, 11 Phytophthora species, and eight other soilborne pathogens (Aphanomyces, Fusarium, Plasmodiophora, Pyrenochaeta, Rhizoctonia, Saprolegnia, Verticillium, and Sclerotinia). Thirteen P. helicoides strains were included in the test, and these strains were detected by increased turbidity within 30 min. No other strains showed increased turbidity in the LAMP reactions (Table 2). This assay was carried out in triplicate for each template DNA. Therefore, we confirmed that the LAMP assay was specific for P. helicoides. The LAMP primer set described in this study was designed using the
Direct detection of P. helicoides in infected plants
0.9 1 ng
0.8
100 pg
0.7
10 pg
Turbidity
The LAMP assay was used to detect P. helicoides in roots collected from plants showing root rot in greenhouses in
1 pg
0.6
100 fg
0.5
10 fg
0.4
1 fg
(a) 0.9 No. 1
0.3
0.8
0.2
0.7
0.1
0.6
No. 4
0.5
No. 5
0.4
Blank
0 20
40
50
60
70
80
90
100 pg
No. 2 No. 3
0.3 0.2 0.1
1 ng
1 pg
10 pg
100 fg
Time (min)
M
(b)
30
1 fg
10
10 fg
–0.1
0
Turbidity y
(a)
To determine the sensitivity of the LAMP assay, reactions were performed using 10-fold serial dilutions of genomic DNA from P. helicoides strain GUPO1. As shown in Fig. 3a, the minimum quantity of DNA required for LAMP detection was 100 fg. PCRs were performed using the same DNA samples. Amplification products of 320 bp were observed in samples ranging from 100 fg to 1 ng (Fig. 3b). This assay was carried out in triplicate for each template DNA. Previous studies suggest that the LAMP assay has the same or higher sensitivity than the PCR assay (Fukuta et al., 2013). In this study, the sensitivity of the LAMP assay was equivalent to that of conventional PCR (Ishiguro et al., 2013).
0 -0.1 0
10 1
20
30
40
50
60 0
70
80
90
Tim me (min) (b)
500 bp P
320 bp 100 bp
Fig. 3. Comparison of the sensitivities of the LAMP and PCRs in the detection of Pythium helicoides. Pythium helicoides genomic DNA was serially diluted from 1 ng to 1 fg. (a) LAMP reaction results indicated by turbidity of the reaction mixtures. (b) Agarose gel electrophoresis of the PCR reaction products. M: 100 bp DNA ladder.
FEMS Microbiol Lett 355 (2014) 28–35
M
1
2
3
4
5
(c)
Fig. 4. Direct detection of Pythium helicoides in infected poinsettia roots using LAMP assays, PCR, and conventional plating. (a) LAMP reaction results indicated by turbidity of the reaction mixtures. (b) Visual inspection of LAMP reaction tubes. (c) Agarose gel electorophosis of PCR products. P: positive control, M: 100 bp DNA ladder.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
34
Aichi Prefecture, Japan. Pythium helicoides was detected in 13 of the 14 samples. All results of the 14 samples were consistent with the detection of P. helicoides using the plating method. The results of five samples of them were shown in Fig. 4a and b. On the other hand, P. helicoides was detected in only one sample using PCR (Fig. 4c). Isolates from the 13 positive samples were identified as P. helicoides. This assay was carried out in triplicate for each sample. The negative result may have been due to a physiological disorder in the symptomatic plant. To use the LAMP method at agricultural sites, the entire diagnostic process, including template preparation, should be simple and cost effective. We used a very simple method to prepare template samples from the roots of infected plants at an agricultural site and were able to detect P. helicoides in these samples using the LAMP assay. Thus, the LAMP method can be used to detect pathogens without extracting the DNA. Moreover, the detection results were consistent with those of plating method and were more sensitive than PCR method using the same sample, although the sensitivity of LAMP was the same as that of PCR using the extracted pure DNA. It has been suggested previously that the LAMP method is less susceptible than PCR to reaction inhibitors that may be present in such field samples (Kaneko et al., 2007; Fukuta et al., 2013). Although the LAMP assay has many advantages over the similar nucleic acid amplification method, there is still a problem to note. Because of the high sensitivity of the LAMP assay, a micro amount of DNA contamination can result in a false positive. Moreover, because of its great amplification efficiency, so the reaction product can form aerosol to contaminate the surroundings when opening the tube. To avoid the contamination in this study, after the addition of the template to the reaction mixture, we never opened the tube again. In this study, we established a method for the detection of P. helicoides using LAMP assays. We designed LAMP primers, determined the optimal reaction conditions, and evaluated the specificity and sensitivity of this assay. In summary, the results reported here show that the LAMP method is very useful for the identification and detection of P. helicoides. This method could be used as a tool for the simple and rapid diagnosis of plants infected with P. helicoides at agricultural sites. This rapid diagnosis tool will enable growers to prevent the spread of infection and thus prevent widespread crop damage.
Acknowledgement This work was supported by Science and technology research promotion program for agriculture, forestry, fisheries, and food industry, Japan. ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Takahashi et al.
References Ahonsi MO, Ling Y & Kageyama K (2010) Development of SCAR markers and PCR assays for single or simultaneous species-specific detection of Phytophthora nicotianae and Pythium helicoides in ebb-and-flow irrigated kalanchoe. J Microbiol Methods 83: 260–265. Asano T, Senda M, Suga H & Kageyama K (2010) Development of multiplex PCR to detect five Pythium species related to turfgrass diseases. J Phytopathol 158: 609– 615. Blair JE, Coffey MD, Park SY, Geiser DM & Kang S (2008) A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol 45: 266–277. Boubourakas IN, Fukuta S & Kyriakopoulou PE (2009) Sensitive and rapid detection of peach latent mosaic viroid by the reverse transcription loop-mediated isothermal amplification. J Virol Methods 160: 63–68. Dai TT, Lu CC, Lu J, Dong S, Ye W, Wang Y & Zheng X (2012) Development of a loop-mediated isothermal amplification assay for detection of Phytophthora sojae. FEMS Microbiol Lett 334: 27–34. Fukuta S, Kato S, Yoshida K, Mizukami Y, Ishida A, Ueda J, Kanbe M & Ishimoto Y (2003) Detection of tomato yellow leaf curl virus by loop-mediated isothermal amplification reaction. J Virol Methods 112: 35–40. Fukuta S, Ohishi K, Yoshida K, Mizukami Y, Ishida A & Kanbe M (2004) Development of immunocapture reverse transcription loop-mediated isothermal amplification for the detection of tomato spotted wilt virus from chrysanthemum. J Virol Methods 121: 49–55. Fukuta S, Tamura M, Maejima H et al. (2013) Differential detection of wheat yellow Mosaic virus, Japanese soil-borne wheat mosaic virus and Chinese wheat mosaic virus by reverse transcription loot-mediated isothermal amplification reaction. J Virol Methods 1089: 348–354. G omez-Alpızar L, Saalau E, Picado I, Tambong JT & Saborıo F (2011) A PCR-RFLP assay for identification and detection of Pythium myriotylum, causal agent of the cocoyam root rot disease. Lett Appl Microbiol 52: 185–192. Ishiguro Y, Asano T, Otsubo K, Suga H & Kageyama K (2013) Simultaneous detection by multiplex PCR of the high-temperature-growing Pythium species: P. aphanidermatum, P. helicoides and P. myriotylum. J Gen Plant Pathol 79: 350–358. Kageyama K, Ohyama A & Hyakumachi M (1997) Detection of Pythium ultimum using polymerase chain reaction with species specific primers. Plant Dis 81: 1150–1160. Kageyama K, Aoyagi T, Sunouchi R & Fukui H (2002) Root rot of miniature roses caused by Pythium helicoides. J Gen Plant Pathol 68: 15–20. Kageyama K, Suzuki M, Priyatmojo A, Oto Y, Ishiguro K, Suga H, Aoyagi T & Fukui H (2003) Characterization and identification of asexual strains of Pythium associated with root rot of rose in Japan. J Phytopathol 151: 485–491.
FEMS Microbiol Lett 355 (2014) 28–35
LAMP assay for rapid detection of Pythium helicoides
Kaneko H, Kawana T, Fukushima E & Suzutani T (2007) Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J Biochem Biophys Methods 70: 499–501. Levesque CA & de Cock AWAM (2004) Molecular phylogeny and taxonomy of the genus Pythium. Mycol Res 108: 1363– 1383. Li M, Asano T, Suga H & Kageyama K (2011) A multiplex PCR for the detection of Phytophthoranicotianae and P. cactorum, and a survey of their occurrence in strawberry production areas of Japan. Plant Dis 95: 1270–1278. Ling Y, Kageyama K, Asano T, Senda M, Watanabe H, Suga H & Fukui H (2007) Detection of Pythium helicoides in flower production area using PCR with species-specific primers. Jpn J Phytopathol 73: 86–93. Miyake N, Nagai H, Fukuta S, Kuroyanagi S, Takahashi R & Kageyama K (2012) Occurrence of Pythium root rot of poinsettia caused by Pythium myriotylum Drechsler and Pythium helicoides Drechsler (abstract), (in Japanese). Jpn J Phytopathol 78: 183. Mori Y, Nagamine K, Tomita N & Notomi T (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 289: 150–154. Mori Y, Kitao M, Tomita N & Notomi T (2004) Real-time turbidimetry of LAMP reaction for quantifying template DNA. J Biochem Biophys Methods 59: 145–157. Nagamine K, Hase T & Notomi T (2002) Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes 16: 223–229. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N & Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28: e63. Pettitt TR, Wakeham AJ, Wainwright MF & White JG (2002) Comparison of serological, culture, and bait methods for detection of Pythium and Phytophthora zoospores in water. Plant Pathol 51: 720–727.
FEMS Microbiol Lett 355 (2014) 28–35
35
Rigano LA, Marano MR, Castagnaro AP, Amaral AMD & Vojnov AA (2010) Rapid and sensitive detection of citrus bacterial canker by loop-mediated isothermal amplification combined with simple visual evaluation methods. BMC Microbiol 10: 176. Schroeder KL, Okubara PA, Tambong JT, Levesque CA & Paulitz TC (2006) Identification and quantification of pathogenic Pythium spp. from soils in eastern Washington using real-time polymerase chain reaction. Phytopathology 96: 637–647. Sung CH & Lu JK (2009) Reverse transcription loop-mediated isothermal amplification for rapid and sensitive detection of nervous necrosis virus in groupers. J Virol Methods 159: 206–210. Suzuki M, Togawa M & Yoneyama C (2005) Occurrence of Pythium root rot of strawberry caused by Pythiumhelicoides (abstract), (in Japanese). Jpn J Phytopathol 71: 209. Tomlinson JA, Barker I & Boonham N (2007) Faster, simpler, more-specific methods for improved molecular detection of Phytophthorara morum in the field. Appl Environ Microbiol 73: 4040–4047. Tomlinson JA, Dickinson MJ & Boonham N (2010) Detection of Botrytis cinerea by loop-mediated isothermal amplification. Lett Appl Microbiol 51: 650–657. van der Plaats-Niterink AJ (1981) Monograph of the genus Pythium. Stud Mycol 21: 1–242. Wang PH, Wang YT & White JG (2003) Species-specific PCR primers for Pythium developed from ribosomal ITS1 region. Lett Appl Microbiol 37: 127–132. Watanabe H, Horinouchi H, Tanahashi I & Kageyama K (2005) Occurrence of Pythium root rot of strawberry caused by Pythium helicoides, an pathogenicity to several crops (abstract), (in Japanese). Jpn J Phytopathol 71: 209–210. Watanabe H, Taguchi Y, Hyakumachi M & Kageyama K (2007) Pythium and Phytophthora species associated with root and stem rots of kalanchoe. J Gen Plant Pathol 73: 81–88.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
