Arch Virol (2014) 159:921–926 DOI 10.1007/s00705-013-1906-1
ORIGINAL ARTICLE
Development of a loop-mediated isothermal amplification method for rapid detection of pigeon circovirus Shinn Shyong Tsai • Yeng Ling Chang • Yen Li Huang • Hung Jen Liu • Guan Ming Ke • Chwei Jang Chiou • Yao Ching Hsieh • Tsung Chou Chang Li Ting Cheng • Kuo Pin Chuang
•
Received: 29 July 2013 / Accepted: 24 October 2013 / Published online: 6 November 2013 Ó Springer-Verlag Wien 2013
Abstract There are no effective antiviral treatments for pigeon circovirus (PiCV); thus, rapid diagnosis is critical for effective control of the disease caused by this virus. The recent development of a novel LAMP technique that amplifies nucleic acids rapidly with high specificity and sensitivity under isothermal conditions has overcome some of the deficiencies of nucleic-acid-based diagnostic tests. We established a LAMP method for rapid detection of PiCV using two pairs of primers that were designed from PiCV and compared its sensitivity and specificity with that of PCR. Amplification by LAMP was optimal at 63 °C for 60 min. The detection limit was nearly 0.5 pg of PiCV DNA, making it ten times more sensitive than PCR. There was no cross-reaction with porcine circovirus type 2 (PCV2), pigeon Trichomonas gallinae, or pigeon herpesvirus (PHV) under the same conditions. The assay also successfully detected the pathogen DNA in the tissues of infected pigeons. This is the first report indicating that
S. S. Tsai Y. L. Huang T. C. Chang Department of Veterinary Medicine, National Pingtung University of Science and Technology, Pingtung 912, Taiwan Y. L. Chang G. M. Ke L. T. Cheng K. P. Chuang (&) Graduate Institute of Animal Vaccine Technology, National Pingtung University of Science and Technology, Pingtung 912, Taiwan e-mail:
[email protected] H. J. Liu Institute of Molecular Biology, National Chung Hsing University, Taichung 250, Taiwan C. J. Chiou Y. C. Hsieh Bureau of Animal and Plant Health Inspection and Quarantine, Council of Agriculture, Executive Yuan, Taipei 100, Taiwan
LAMP is a valuable, rapid method of detecting PiCV with high sensitivity and specificity. Abbreviations BIP Backward inner primer FIP Forward inner primer LAMP Loop-mediated isothermal amplification PCR Polymerase chain reaction PiCV Pigeon circovirus PCV2 Porcine circovirus type 2 PHV Pigeon herpesvirus
Introduction Pigeon circovirus (PiCV) is a member of the family Circoviridae. Circoviruses are nonenveloped, spherical viruses that are 17-22 nm in diameter with a circular singlestranded DNA genome. PiCV was first documented in Canada in 1986 [23]. Since then, several outbreaks have been reported in many countries, including Northern Ireland [15, 20], England [8], Germany [10, 13, 17], France [1], Belgium [4], China [24], Hungary [3], and Italy [2, 6]. PiCV causes a multifactorial disease—young pigeon disease syndrome (YPDS)—possibly by inducing immunosuppression in infected birds [13, 14]. YPDS has been a common problem in young racing pigeons for more than two decades, and it is associated with poor racing performance and high morbidity and mortality rates in the 3rd to 20th week of life. The clinical signs of YPDS are nonspecific, including anorexia, depression, ruffled feathers, vomiting, diarrhea, polyuria, and a fluid-filled crop. On necropsy, the only typical gross lesion is atrophy of the bursa of Fabricius,
123
922
S. S. Tsai et al.
which does not necessarily develop in all affected birds. Other gross lesions probably reflect secondary infections [13]. Several methods have been established to detect PiCV infection, including electron microscopy [18], histology, dot blot hybridization (DBH), in situ hybridization and real-time PCR [5, 9, 16, 18, 21]. However, these methods are time-consuming and require expensive instruments. Loop-mediated isothermal amplification (LAMP) is a molecular method that is used to amplify DNA or RNA under isothermal conditions and was developed by Notomi et al. in 2000 [12]. LAMP is a rapid and highly specific assay, and it is regarded as a valuable approach for detecting many types of pathogens [19, 22, 25]. In this study, we established a LAMP assay to detect PiCV, for which we determined its sensitivity and specificity.
Plasmid extraction Following the manufacturer’s instructions, the plasmid was extracted by using a Plasmid Mini Kit (QIAGEN, Hilden, Germany). The purified plasmid was eluted in 60 lL of sterile water and stored at -20 °C until later use. DNA extraction First, 500 lL of tissue sample in an Eppendorf tube that have been frozen and thawed three times was digested with 50 lL of 10 % SDS and 10 lL of proteinase K (20 mg/mL) at 55 °C for 2 h. Then, DNA was extracted with Tris-saturated phenol, chloroform and absolute ethanol according to the instructions. Lastly, DNA was washed with 75 % icecold ethanol. The precipitate of DNA was dissolved in 20 lL of sterile water and stored at -20 °C for later use.
Materials and methods
LAMP primer design
A recombinant plasmid, yT&A-PiCV, containing complete sequence of PiCV was constructed in our laboratory. Porcine circovirus type 2 (PCV2), pigeon Trichomonas gallinae, and pigeon herpesvirus (PHV) samples were identified by PCR and sequencing. A total of 20 clinically suspected YPDS samples from different areas of Taiwan were used for diagnostic purposes. A 10 % suspension of bursa of Fabricius was prepared in PBS (pH 7.2) for DNA isolation. All samples were stored at -80 °C.
A set of four primers was designed based on the conserved region (420-1120) of the published full-length sequence of the circovirus genome (AF252610, AJ298229, AJ298230, DQ915960, DQ915961, DQ915962, DQ915958, DQ915957, DQ915956, DQ90945, DQ90944 and DQ 915956). The primers were designed using Primer Explorer ver. 4 (http://primerexplorer.jp/elamp4.0.0/index.html). A forward primer (F3), a reverse primer (B3), a forward inner primer (FIP; F1c?F2) and a reverse inner primer (BIP;
Table 1 Sequences of LAMP and conventional PCR primers for specific amplification of pathogens Primer
Type
Length
Sequence
Product
Pathogen
Genome location
802
Pigeon circovirus
1166-1985
703
Porcine circovirustype-2
1031-1733
PiCVF
Forward
21
CAGATGAGAAGGCGGAGATTC
PiCVR
Reverse
25
CATCTGCAAAACACTGGTTACAATC
PCV2F
Forward
24
ATGACGTATCCAAGGAGGCGTTAC
PCV2 R
Reverse
28
TGATGATGATGAGGGTTAAGTGGGGGT
TGAPF
Forward
25
GATATCAAGCCACTCCTTTTCATCG
906
Reverse Forward
23 21
GAATTCGATCTTCATTCTCTTCA GGGACGCTCTGATTAAGGAAT
Trichomonas gallinae
33-938
TGAFR PiHV-s
242
107-348
PiHVas
Reverse
22
CTTGGTGATCAGCAGCAGCTTG
Pigeon herpesevirus
LAMPF3
Forward outer
18
GCAGCCACGTGACTTCAA
576-593
LAMPB3
Backward outer
18
ACCTTATGCGGGTACCGG
780-797
LAMPFIP
Forward inner
40
GGTAGTCAGCTGCCCAACGGACGGAAGTCATCGTCATCAC
LAMPBIP
Backward inner
38
GACGGCTACGACCACCAGGAGCAGCAGCTCACAGAAGG
123
Pigeon circovirus
639658?595614 697716?752769
LAMP assay for pigeon circovirus
B1c?B2) were used for the LAMP method. The sequences and binding sites of the primers are shown in Table 1.
923
(a) M
N
1
2
N
1
2
3
4
5
6
LAMP reaction The LAMP assay was performed using a Loopamp DNA Amplification Kit (Eiken Chemical Co. Ltd., Tokyo, Japan). In brief, the assay was performed with the following optimized reaction mixture: 25 ll of a mixture containing 12.5 ll of reaction mix buffer, 1 ll of the template DNA, 40 pmol (each) of primers FIP and BIP, 5 pmol of primers B3 and F3, and 1 ll of Bst DNA polymerase. To determine the optimal conditions for sensitivity and selectivity, the LAMP reactions were performed at a range of temperatures (60-65 °C) for different time periods (30-60 min). After each incubation time and temperature, reactions were stopped by heating at 80 °C for 5 min. LAMP products were detected using 2 % agarose gel electrophoresis with ethidium bromide staining. PCR
(b) M
3
4
To compare the sensitivity and specificity of LAMP and PCR, PCR was carried out in a 25-lL reaction volume containing final concentrations of 0.4 lM each primer, 0.2 mM each deoxynucleoside triphosphate, 1.5 mM MgCl [2].5 lL of LAMP buffer, 1 lL of extracted DNA and 2.5 U of Taq DNA polymerase (Fermentas, CA, USA). The amplification was carried out for 35 cycles at 95 °C for 3 min, 53 °C for 45 s, 72 °C for 2 min, with a final elongation for 10 min at 72 °C. The PCR products were analyzed by 1.5 % agarose gel electrophoresis. Sensitivity and specificity of LAMP The PiCV template was serially diluted tenfold in doubledistilled water (from 0.5 ng to 50 fg) to determine the detection limit. To compare the sensitivity of LAMP with that of PCR, both LAMP and PCR were carried out under optimized conditions. DNA of PCV2, pigeon Trichomonas gallinae, and PHV were examined to assess the specificity of LAMP and conventional PCR. The sequences of the primers are shown in Table 1. Furthermore, 20 clinical samples were tested by LAMP and PCR simultaneously. Sterile water was used as a negative control.
Fig. 1 Optimization of LAMP reaction temperature and time for detection of PiCV. Different reaction temperatures (a) and times (b) were tested to determine the optimal LAMP reaction temperature. Lane M, DNA marker; lane N, negative control; lanes 1-6, reaction temperature of 60-65 °C. Lanes 1–4, reaction times of 30-60 min
Results Clinical specimens The optimized LAMP assay During the period 2009-2012, 20 clinical specimens from cases of suspected YPDS were collected from different pigeon farms in southern Taiwan. A 10 % suspension of bursa of Fabricius was prepared in PBS (pH 7.2) for DNA isolation. All samples were stored at -80 °C.
For the LAMP assay, we designed a set of four primers based on a published full-length sequence (AF252610) of PiCV. Using this primer set, we developed a LAMP assay for the rapid detection of PiCV. Plasmid yT&A-PiCV was
123
924
S. S. Tsai et al.
used to optimized the assay reaction temperature and time. The LAMP reaction was carried out for 60 min at 60-65 °C. As shown in Fig. 1, typical ladder-like and smeared LAMP products were generated at 60-65 °C. On the other hand, there was no significant amplification with reaction times of 30-50 min. Incubation for 60 min yielded clear, specific products (Fig. 1b). Thus, 60 min and 63 °C were used as the optimal reaction conditions in subsequent assays. Sensitivity of LAMP and PCR for PiCV The PCR target was the complete PiCV ORF1 sequence. Using serially diluted DNA from recombinant plasmid as template from 0.5 ng to 50 fg, LAMP assay and conventional PCR for PiCV were performed to compare their detection limits. All amplicons were analyzed by agarose gel electrophoresis. The detection limit of LAMP was Fig. 2 Sensitivity of PiCV detection by PCR (a) and LAMP assay (b). A tenfold serial dilution of PiCV DNA was used to determine the sensitivity of the LAMP assay. Lane M, DNA marker; lane N, negative control; lanes 1–5, amplification products obtained with DNA templates of 0.5 ng-50 fg
Fig. 3 Specificity of of PCR (a) and LAMP (b). Lane M, marker; lane N, negative control; lanes 1-4, PiCV, PCV2, Trichomonas gallinae, and PHV
123
0.5 pg/uL of DNA versus 5 pg/uL for conventional PCR (Fig. 2). Thus, the LAMP assay was 10 times more sensitive for PiCV than the conventional PCR used in this work. Specificity of LAMP for PiCV To determine the specificity of the LAMP assay for PiCV, PCV2, PHV and Trichomonas gallinae were tested, the last two being a common virus and a parasite, respectively, that caused pigeon diseases. Moreover, the nucleotide sequence homology in the ORF1 region between PiCV and PCV2 is approximately 23 % [10]. In this assay, PiCV, PCV2, PHV and Trichomonas gallinae genomic DNA were used as template for LAMP and conventional PCR detection. By agarose gel electrophoresis, only PiCV gave a positive reaction—a ladder-like pattern of bands (Fig. 3b). Moreover, PCR was positive with specific primers for PCV2, HPV, and Trichomonas gallinae (Fig. 3a). Thus, the
(a)
(b) M
N
1
2
3
4
5
M
N
1
2
3
4
5
LAMP assay for pigeon circovirus
LAMP assay was specific for PiCV. Four primers were needed to recognize six distinct regions in the LAMP reaction to amplify the target DNA with high specificity. LAMP of clinical samples To confirm its applicability for detecting PiCV in fieldobtained samples, the LAMP assay was used to detect PiCV in 20 bursa samples from suspected pigeons with YPDS. Seventeen (17/20; 85 %) bursa samples were positive by LAMP assay, and three (3/20; 15 %) samples were negative (Fig. 4a). To validate these results, PCR was performed on the same samples (Fig. 4b). Ten (10/20; 50 %) samples were positive by conventional PCR and ten (10/20; 50 %) were negative. These results suggest that the PiCV LAMP assay is more sensitive than PCR in detecting PiCV clinical samples.
Discussion PiCV is a significant viral pathogen of pigeons [1, 4–6, 11]. Amplification methods that are based on PCR, such as conventional PCR and real-time PCR, have been used to detect and quantify this virus [4–6], but application of the recently developed LAMP assay for rapid detection of
Fig. 4 Clinical samples tested by LAMP and PCR. Twenty clinical bursa samples were assayed for PiCV by LAMP and PCR. (a) LAMP products. Lane M, DNA marker; lanes 1–20, LAMP products from the 20 clinical samples. (b) PCR products. For the 20 clinical samples,
925
PiCV has not been reported. As described for many viral pathogens [7], the LAMP assay shows good sensitivity in virus detection. The entire duration of the LAMP assay, including DNA extraction, the reaction, and the final visualization of amplification products, is less than 2 h, whereas at least 5 h is needed for a conventional PCR-based method. Thus, LAMP is a more rapid method of detecting PiCV than PCR. In addition, LAMP can be performed with common and inexpensive equipment. The LAMP reaction is executed in a single tube and only requires a water bath to provide a constant temperature; moreover, the amplification products can be detected by the naked eye with EtBr under UV light. Because of these advantages, the LAMP assay is considerably more applicable than PCR, particularly in the field. The optimal conditions for the LAMP reaction in detecting PiCV DNA were 63 °C and 60 min. In this study, the limit of detection of LAMP for PiCV was 0.5 pg of viral DNA, suggesting that the LAMP assay is more sensitive than a PCR-based assay. For detecting PiCV from experimental and clinical samples, the LAMP assay was more sensitive than PCR. Thus, the suitability of the LAMP assay for detecting PiCV DNA in infected samples was confirmed. The specificity of the LAMP reaction was high, since the results indicate that other pathogens,
PCR was carried out to confirm the presence of virus in the bursa. Lane M, DNA marker; lanes 1–20, PCR products from the 20 clinical samples
123
926
S. S. Tsai et al.
including PCV2, PHV, and Trichomonas gallinae, cannot be detected by our LAMP primers. Furthermore, the four primers used in our assay recognize six distinct regions in the target DNA, thus greatly reducing the possibility of nonspecific primer binding. Our LAMP assay detected PiCV not only from template DNA but also in tissues from infected pigeons, indicating the feasibility of rapid diagnosis in the early stages of infection. In summary, we have developed a loop-mediated isothermal amplification method for rapid detection of PiCV in pigeons. The assay is simple and cost-effective, with high sensitivity and specificity. The LAMP assay may be useful for rapid diagnosis in the early stages of PiCV infection in pigeons, accelerating implementation of disease control protocols.
Conclusions
7.
8. 9.
10.
11. 12.
13.
14.
This is the first report indicating that LAMP is a valuable rapid method for detecting PiCV with high sensitivity and specificity.
15.
Acknowledgements These studies were supported by Grants to Kuo Pin Chuang from the National Science Council (NSC) and Council of Agriculture of Taiwan.
17.
Conflict of interest of interest.
The authors declare that they have no conflict
16.
18.
19.
References 1. Abadie J, Nguyen F, Groizeleau C, Amenna N, Fernandez B, Guereaud C, Guigand L, Robart P, Lefebvre B, Wyers M (2001) Pigeon circovirus infection: pathological observations and suggested pathogenesis. Avian Pathol 30:149–158 2. Coletti M, Franciosini MP, Asdrubali G, Passamonti F (2000) Atrophy of the primary lymphoid organs of meat pigeons in Italy associated with circovirus like particles in the bursa of Fabricius. Avian Dis 44:454–459 3. Csagola A, Lorincz M, Tombacz K, Wladar Z, Kovacs E, Tuboly T (2012) Genetic diversity of pigeon circovirus in Hungary. Virus Genes 44:75–79 4. Duchatel JP, Todd D, Smyth JA, Bustin JC, Vindevogel H (2006) Observations on detection, excretion and transmission of pigeon circovirus in adult, young and embryonic pigeons. Avian Pathol 35:30–34 5. Duchatel JP, Todd D, Willeman C, Losson B (2009) Quantification of pigeon circovirus in serum, blood, semen and different tissues of naturally infected pigeons using a real-time polymerase chain reaction. Avian Pathol 38:143–148 6. Franciosini MP, Fringuelli E, Tarhuni O, Guelfi G, Todd D, Casagrande Proietti P, Falocci N, Asdrubali G (2005) Development of a polymerase chain reaction-based in vivo method in the
123
20.
21.
22.
23.
24.
25.
diagnosis of subclinical pigeon circovirus infection. Avian Dis 49:340–343 Fu S, Qu G, Guo S, Ma L, Zhang N, Zhang S, Gao S, Shen Z (2011) Applications of loop-mediated isothermal DNA amplification. Appl Biochem Biotechnol 163:845–850 Gough RE, Drury SE (1996) Circovirus-like particles in the bursae of young racing pigeons. Vet Rec 138:167 Hattermann K, Soike D, Grund C, Mankertz A (2002) A method to diagnose Pigeon circovirus infection in vivo. J Virol Methods 104:55–58 Mankertz A, Hattermann K, Ehlers B, Soike D (2000) Cloning and sequencing of columbid circovirus (coCV), a new circovirus from pigeons. Arch Virol 145:2469–2479 Marlier D, Vindevogel H (2006) Viral infections in pigeons. Vet J 172:40–51 Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28:E63 Raue R, Schmidt V, Freick M, Reinhardt B, Johne R, Kamphausen L, Kaleta EF, Muller H, Krautwald-Junghanns ME (2005) A disease complex associated with pigeon circovirus infection, young pigeon disease syndrome. Avian Pathol 34:418–425 Schmidt V, Schlomer J, Luken C, Johne R, Biere B, Muller H, Krautwald-Junghanns ME (2008) Experimental infection of domestic pigeons with pigeon circovirus. Avian Dis 52:380–386 Smyth JA, Carroll BP (1995) Circovirus infection in European racing pigeons. Vet Rec 136:173–174 Smyth JA, Weston J, Moffett DA, Todd D (2001) Detection of circovirus infection in pigeons by in situ hybridization using cloned DNA probes. J Vet Diagn Invest 13:475–482 Soike D (1997) Circovirus infections in pigeons. Tierarztl Prax 25:52–54 Soike D, Hattermann K, Albrecht K, Segales J, Domingo M, Schmitt C, Mankertz A (2001) A diagnostic study on columbid circovirus infection. Avian Pathol 30:605–611 Song C, Wan H, Yu S, Han X, Qiu X, Hu Q, Tan L, Ding C (2012) Rapid detection of duck hepatitis virus type-1 by reverse transcription loop-mediated isothermal amplification. J Virol Methods 182:76–81 Todd D, Weston JH, Soike D, Smyth JA (2001) Genome sequence determinations and analyses of novel circoviruses from goose and pigeon. Virology 286:354–362 Todd D, Duchatel JP, Weston JH, Ball NW, Borghmans BJ, Moffett DA, Smyth JA (2002) Evaluation of polymerase chain reaction and dot blot hybridisation tests in the diagnosis of pigeon circovirus infections. Vet Microbiol 89:1–16 Wang C, Pang VF, Jeng CR, Lee F, Huang YW, Lin YL, Hsiao SH, Lai SS (2011) Detection of porcine circovirus type 1 in commercial porcine vaccines by loop-mediated isothermal amplification. Folia Microbiol (Praha) 56:483–489 Woods LW, Latimer KS, Niagro FD, Riddell C, Crowley AM, Anderson ML, Daft BM, Moore JD, Campagnoli RP, Nordhausen RW (1994) A retrospective study of circovirus infection in pigeons: nine cases (1986-1993). J Vet Diagn Invest 6:156–164 Yu XP, Zhu C, Zheng XT, Mu AX, Yu HT (2009) Cloning and analysis of the complete genomes of pigeon circovirus from Zhejiang Province. Bing Du Xue Bao 25:355–361 Zhou S, Han S, Shi J, Wu J, Yuan X, Cong X, Xu S, Wu X, Li J, Wang J (2011) Loop-mediated isothermal amplification for detection of porcine circovirus type 2. Virol J 8:497
