Asia AsPacPacific J. Mol. Journal Biol. Biotechnol., of MolecularVol. Biology 15 (3), and2007 Biotechnology, 2007 Vol. 15 (3) : 121-131
Development of simple sequence repeat (SSR) markers for oil palm
121
Development of simple sequence repeat (SSR) markers for oil palm and their application in genetic mapping and fingerprinting of tissue culture clones Rajinder Singh1*, Jayanthi Nagappan1, Soon-Guan Tan2, Jothi Malar Panandam3 and Suan-Choo Cheah1,4 Advanced Biotechnology and Breeding Centre, Malaysian Palm Oil Board (MPOB), P.O. Box 10620, 50720 Kuala Lumpur 2 Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang 3 Department of Animal Sciences, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang 4 Present address: Asiatic Centre for Genome Technology, Lot L3-I-1, Enterprise 4, Technology Park Malaysia, 57000 Kuala Lumpur 1
Received 13 April 2007 / Accepted 30 September 2007
Abstract. This study describes the application of a simple and effective method to isolate SSR markers from oil palm genomic sequences. A total of 12 informative SSR markers are described. The SSR markers were found suitable for genome analysis and DNA fingerprinting of oil palm tissue culture clones. Eleven of the 12 SSR markers exhibited expected Mendelian segregation ratios when tested on a mapping population, indicating their suitability for genetic mapping studies. The markers identified in the species Elaeis oleifera also showed applicability in a second species, that is Elaeis guineensis. Apart from genetic mapping, the SSR markers also showed promise as molecular probes for DNA fingerprinting of oil palm tissue culture clones. The SSR markers can be used for clonal identification, monitoring line uniformity between and within clones and detecting culture mix-up.
Keywords. DNA fingerprinting, oil palm, SSR Introduction Oil palm is one of the most productive oil bearing crops, being by far the highest oil yielder per unit area. The past 30 years have seen a rapid increase in the production of palm oil, a greater than 9-fold increase from about 3 million tones in 1970 to over 30 million tones in 2005. Despite the progress, additional gains in agricultural productivity are needed at an ever-faster pace due to competition from other vegetable oils and fats. Although traditional breeding continues to play an important role in yield enhancement, it is, however, impeded by the long selection cycle of 10 to 12 years (Oboh and Fakorede 1989) and the enormous resources (namely, land, labour and field management) required for oil palm breeding programmes. The ability to select early (perhaps at the nursery stage) will have a great impact in reducing the time and resources required for variety improvement in oil palm. This makes marker-assisted selection (MAS) a very attractive proposition, as it has the potential to reduce the time required to bring new and improved varieties into the market.
The basic requirements of MAS are the availability of molecular markers in sufficient amounts and showing reasonable levels of polymorphism to allow the construction of genetic maps. Linkage maps in turn serve many useful purposes, such as for improved selection in breeding programmes (Wu et al., 2000), studying evolutionary relationship in related species (Bennetzen and Freeling 1997) and as starting points for map based cloning (Jander et al., 2002). Among the wide reservoir of molecular markers available, microsatellites or simple sequence repeats (SSR) are preferred for high throughput mapping, genetic analyses and marker assisted plant improvement programmes (McCouch et al., 2002). In fact, it has been demonstrated that among the four marker systems tested: restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA *Author for Correspondence. Mailing address: Advanced Biotechnolog y and Breeding Centre, Malaysian Palm Oil Board (MPOB), P.O. Box 10620, 50720 Kuala Lumpur. Tel: 603-8769 4501; Fax: 603-8925 1996; Email:
[email protected]
122
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
(RAPD), amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR), SSRs had the highest information content (ability to distinguish genotypes) when evaluating soybean germplasm (Powell et al., 1996). The highly polymorphic nature of SSRs is of particular value for oil palm, as the breeding programmes often involve narrowly adapted gene pools. SSR markers, which are PCR-based, have also been described as having the advantage of reliability, reproducibility, discriminative ability and cost-effectiveness when compared to other marker systems (Smith et al., 1997). Their high information content and the ease at which PCR assays can be automated for identifying SSR polymorphisms, make SSRs ideal genetic markers. Furthermore, since primer sequences are easy to share, this marker system is easily transferable from one laboratory to another. In addition, SSR markers have also been shown to have transferability across different species and plants, a fact that increases their value in plant genetic studies (Peakall et al., 1998). As codominant and locus specific markers, SSRs have been widely used as tools in genotype identification and population genetic studies in plants such as potato (Provan et al., 1996), cultivated sunflower (Dehmer and Friedt 1998), wheat (Eujayl et al., 2001) and rice (Cho et al., 2000). They have also been widely used in genetic mapping studies in crops like rice (Chen et al., 1997), Eucalyptus species (Brondani et al., 1998), wheat (Roder et al., 1998), durum wheat (Korzun et al., 1999), barley (Ramsay et al., 2000) and more recently in oil palm (Billotte et al., 2005). These studies have confirmed the importance of SSR as a source of markers for plant genetics. With regards to oil palm, it was demonstrated by Cheah et al., (1995), that simple repetitive DNA was present in abundance in the oil palm. They screened oil palm genomic DNA for di, tri, tetra and penta nucleotide repeats and found them to be widely distributed in the oil palm genome. Initial attempts to construct SSR enriched genomic libraries were not very successful, as less than 1% of the clones appeared to contain SSR motifs (Cheah and Ooi 1999). Later, other researchers (Billotte et al., 2001) reported the successful construction of an oil palm SSR enriched genomic library, with 72% of the clones containing SSR motifs. They went on to demonstrate the applicability of the SSR markers in revealing the genetic relationships of populations of the genus Elaeis, in accordance with their known geographical origins. They also demonstrated that the markers developed for one species, E. guineensis were applicable in a second species, E. oleifera. However, the construction of such large-scale enriched libraries is technically demanding and requires considerable technical skills, time and cost for successful execution. In order to circumvent the technical difficulties, several modifications, especially using the PCR technique with degenerate primer(s) that contain repeat sequences to produce enriched genomic libraries, have been introduced (Fisher et al., 1996). In this study, we exploited the technique using degenerate primers to construct SSR enriched libraries for
Development of simple sequence repeat (SSR) markers for oil palm
oil palm. Apart from increasing the pool of SSRs available for genetic studies in oil palm, the study was also directed at developing SSR markers for genetic mapping and DNA fingerprinting.
Materials and methods Plant materials. The mapping population used for genetic linkage map analysis was derived from the selfing of the high iodine value (IV) tenera palm, T128, from Malaysian Palm Oil Board (MPOB) Nigerian germplasm collection (Rajanaidu 1990; Cheah et al., 1999). Controlled self-pollination was used to generate the mapping population. A total of 136 palms were used for the purpose of genetic linkage mapping analysis. The parental palm, T128, and a second palm, UP1026, a Colombian oleifera were used to construct SSR enriched genomic libraries. Plant samples for DNA fingerprinting. To test the applicability of the SSR markers for fingerprinting, palms used as source for regeneration (ortets) and their respective clones (ramets) were tested. Leaf samples from six sets of ortets and their respective ramets were provided by three different tissue culture laboratories in Malaysia. The six selected ortets were tenera palms of different genetic background and listed in Table 1. For one of the ortets (D2282), three proliferating embryoid lines were also sampled. A total of 6-7 samples were collected per line for DNA extraction to monitor uniformity between and within lines. DNA extraction. Unopened fronds were collected from individual palms and spear leaves separated from the unopened frond were immediately frozen under liquid nitrogen. These samples were stored at -80°C until DNA preparation. DNA from the leaf and embryoid lines was extracted and purified using the method described by Doyle and Doyle (1990). The integrity of the extracted DNA was examined by electrophoresing an approximate 5 µg aliquot in 0.9% agarose gel in 1 x TAE buffer (0.04 M Tris base, 20 mM acetic acid, 2 mM EDTA). Isolation of SSRs in oil palm. Degenerate primers, PCT4 (Fisher et al., 1996) and PCT1 (Brachet et al., 1999) were used to isolate clones containing SSR sequences from the oil palm. The primers contain SSR and a degenerate anchor at their 5’ ends. The sequence of the primers is as follows: PCT4: KKVRVRV(CT)6 and PCT1: KKYHYHY (GA)15 (where K= G/T; V= G/C/A; R= G/A; Y=C/T; H=A/ T/C) PCR was performed separately for two DNA samples
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Development of simple sequence repeat (SSR) markers for oil palm
Table 1. Oil palm clones used for DNA fingerprinting analysis. Set 1 Set 2 Set 3 Set 4 Set 5 Set 6
Sample Number Type PX PX1 PX2 PY PY1 PY2 C166 C166/A C166/B C166/C C166/D D2282 D2282/2902 D2282/2903 D2282/2906 D2282/ 2908 D2282/2910 D2282/2915 D1050 D1050/54 D1050/166 D1050/666 D1050/671 D1050/691 D1050/692 C343 C343/26 C343/3 C343/25
Ortet Ramet Ramet Ortet Ramet Ramet Ortet Ramet Ramet Ramet Ramet Ortet Ramet Ramet Ramet Ramet Ramet Ramet Ortet Ramet Ramet Ramet Ramet Ramet Ramet Ortet Ramet Ramet Ramet
from palms T128 (Nigerian guineensis) and UP1026 (Colombian oleifera), using the protocol described by Fisher et al. (1996) as follows: 30 ng of genomic DNA, 0.2 mM each dNTPs, 1.5 mM MgCl2, 10 mM Tris-HCL (pH 8.3), 50 mM KCl, 3 U Taq DNA polymerase (INVITROGEN), 50 pmol degenerate primers (PCT4 or PCT1) and deionized water to 25 µl. Ten microliter of the post PCR samples was analyzed on a 1% agarose gel with 1 x TAE buffer. Cloning and sequencing of PCR products. Three microliter of the post PCR mix was cloned using the TOPO-TA cloning kit (INVITROGEN), essentially as recommended by the manufacturer. Plasmid DNA was prepared using the QIAGEN-tip 20 plasmid prep kit (QIAGEN). Presence of insert was checked with restriction digestion by EcoRI. The clones containing inserts larger than 150 bp were selected for sequencing and bacterial clones of the selected probes were stored as frozen glycerol stocks. Sequencing was carried out on both strands with M13 forward and reverse primers (INVITROGEN) using a ABI 377 sequencer (Applied Biosystems).
123
Primer design. Specific primers were designed for the flanking regions of the SSRs using the PRIMER 3 software (Rozen and Skaletsky 2000). For each primer pair, the annealing temperature was initially set at 40°C and subsequently increased by 2°C, until a single or low copy (< 4) bands was observed on an agarose gel. Labeling of SSR primers and analysis on acrylamide gel. One primer for each primer pair was 5’ end labeled at 37°C for 1 hour using T4 polynucleotide kinase (INVITROGEN). The labeling reactions contained 50 pmoles of primer, 3 µl of γ-33p dATP (GE Healthcare Biosciences, UK, 3000 Ci/mmol), 1 U of T4 polynucleotide kinase in a total volume of 25 µl. Subsequently the PCR reaction was carried out in a 25 µl reaction containing 1 U of Taq DNA Polymerase (INVITROGEN), 50 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.2 µM of each primer, 0.2 mM dNTPs (INVITROGEN) and 50 ng of template DNA. The PCR was performed in a Perkin Elmer 9600 thermocycler essentially as described by Billotte et al. (2001). The PCR reaction was stopped by the addition of 25 µl of formamide buffer (0.3% bromophenol blue; 0.3% xylene cyanol; 10 mM EDTA pH 8.0; 97.5% deionized formamide). Each of the PCR reaction was subjected to electrophoresis on a 6% denaturing acrylamide gel containing 7 M urea using 1 x TBE buffer at constant power of 40 W for 3 hours. The gels were then dried and exposed to X-ray film (Kodak) for 3-4 days at -80°C. Sizing of each allele was done using AFLP molecular weight ladder (INVITROGEN). The nomenclature used to describe the SSR primers was as follows: PxNy; where x refers to ‘1’or ‘4’ if degenerate primer PCT1or PCT4 was used, respectively, to isolate the SSR loci. N is ‘T’ if palm T128 (E. guineensis) was used as the DNA source and ‘O’ if the palm UP1026 (E. oleifera) was used and y refers to the clone number. Cloning and sequencing of selected SSR locus. Selected locus amplified by primer pairs was excised from the acrylamide gel as described by Matthes et al. (2001). The excised fragments were cloned into PCR 2.1-TOPO vector (TOPO-TA cloning kit, INVITROGEN). The preparation of plasmids and sequencing was carried out as described previously. Data analysis. The SSR data for tissue culture clones was analysed using the computer programme POPGENE version 1.32 (Yeh and Boyle, 1999). The genetic distances between the clones were calculated according to Nei (1972). These values were then used to generate a dendrogram using the unweighted pair-group with arithmetic average (UPGMA) cluster analysis as described by Sneath and Sokal (1973). The other parameter estimated was genetic differentiation (FST).
124
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Development of simple sequence repeat (SSR) markers for oil palm
Table 2. SSR isolated with the 5’ anchor PCR method. N is the number of clones sequenced for each anchor primer. Anchor Sequence Parental N 5’ primer palms terminal name repeat PCT1 KKYHYHY (GA)15 T128 15 (GA)15 (GA)16 (GA)15 (GA)17 (GA)18
Repeats between terminal repeats
3’ terminal repeats
- - - - -
(CT)21 (CT)16 -
UP1026 15
(GA)15 (GA)15 (GA)16 (GA)17 (GA)18
- - - - -
(CT)15 (CT)14 -
PCT4 KKVRVRV(CT)6 T128 20
(CT)6 (CT)7 (CT)7 (CT)6(CA)8 (CT)8 (CT)10 (CT)11(CA)11 (CT)6 (CT)6
- - - (CT)9 - - - - (CT)4
(GA)9 (GA)6 (GA)7 (GA)9 (GA)6
UP1026 15
(CT)6 (CT)10 (CT)9 (CT)6 (CT)6
- (CT)10 - - -
(GA)11 (GA)6 (GA)8 (GA)6
RESULTS AND DISCUSSION Amplification of SSR markers using degenerate primers. Genomic DNA from the E. guineensis parental palm of the mapping population (palm T128) and the E. oleifera species (palm UP1026, a oleifera from MPOB’s Colombian germplasm collection) were amplified using primers PCT4 and PCT1. Several PCR products were observed in each of the profiles, indicating that both palm species are rich in GA/CT repeats. The profiles for both E. guineensis and E. oleifera for each of the primer were very similar, indicating common binding sites in both species of oil palm. Generally, a larger number of recombinant colonies were produced by primer PCT4 compared to PCT1. This could be due to the fact that shorter repeats using PCT4 were cloned more efficiently compared to the longer repeats produced by PCT1. For each degenerate anchor primer, 15-20 clones per parental palm were randomly selected for plasmid DNA purification. The selected recombinant clones were found to carry insert DNA, ranging in size from 200 to 800 kb. Sequence analysis of these clones (totaling 65) revealed that 49 (about 75%) of them were unique and carried the expected SSR patterns (Table 2). However, the main drawback was
the fact that the SSR motifs were located close to the 3’ or 5’ end of the amplicons generated, making primer design difficult or not possible in some cases. Fisher et al. (1996) recommended that only one primer needs to be designed at the 3’ end and this could be used in combination with the original degenerate primer in order to generate fingerprints. In our experience, the use of the original degenerate primer in combination with a second primer failed to produce a clear and concise fingerprint (data not shown). The synthesis of a primer pair encompassing the SSR motif was required to reveal functional SSR loci. Of the 49 SSR loci identified, primers could not be designed for 12 of the clones. The reasons for primer design failure for some of the clones was due to long stretches of purines or pyrimidines in the primer (due to the primer having to be designed into the SSR motif), high GC content (more than 70%) in the primer(s) and high likelihood of primer dimers forming. Primers were successfully designed for 37 of the clones. The primers were initially tested to determine if they could amplify oil palm genomic DNA. Thirty-three of the primer pairs tested amplified clear single/low copy fragments of the expected size.
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Development of simple sequence repeat (SSR) markers for oil palm
125
Table 3. SSR loci, primer sequences and optimum annealing temperatures. Locus Repeat name Motif
Primer sequences No. of F: 5’-3’ alleles R: 5’-3’
P1T6 (CT)8… (CT)5
F: GGAGGCCGCCTAATGAAAGAAATC 11 112 R: AGAGAGAGAAGGGGAGGGAAGGAG
50°C
P1T14 (GA)8
F: TTGAGAGAGAGAGAGAGAGAGA R: TTACCTGGAGCTTCCGACTC
10
240, 230
50°C
P1A0 (GA)6
F: TGAGAGAGAGAGAGAGAGAGAG R: AGCGAGGTTGTTGCTCCTAAA
6
315
52°C
P1O14 (GA)6
F: TTTTCGAGAGAGGAGAGAGAGAGA R: CAAGGATTTAATAGCCACCCATAG
7
212
50°C
P4T8 (CT)5
F: GTAGGGGCTCTCTCTCTCTCTAT R: CATGCCCTGAGGAAATTCAG
4
242, 231
52°C
P4T10 (CT)9
F: ACACGCACACAGAGAGATAGAGAG R: CTCGATTCGAATAGGTAGTCACTG
6
118, 115
52°C
P4T12a (GA)8
F: GTTATTTGAGAGAGAGAGAGAG R: TGCCACTACGTGAAGAAGATAAAG
9
195
52°C
P4T12b (GA)8
F: GTTATTTGAGAGAGAGAGAGAG R: ATAAATCTACAGGTATGCCACTCG
11
135
50°C
P4T20b (CT)4
F: TGAAAGACTCTCTCTCTCT R: TCAGCTTTGAATTATCCCATCC
5
172
50°C
P4O17b (AT)4
F: GCTCTCTCTCTCTAGGGCTCGTA R: GTAAAGGCTCTCTCTCTCTC
17
>330a
50°C
P4O18a (CT)4
F: GTGAAGGCTCTCTCTCTCT R: ATCGGAGTCTTGTCTCTAGTCTGG
12
260, 255
50°C
P201b (GA)4CA (GA)4
F: CCCACGAAAACCCTAGAAAAA 7 185, 168 R: GTGTGCGTGTAGTTCATTGTTTTG
54°C
Analyses of the mapping population. Twenty-five of the 33 primer pairs were randomly chosen to amplify DNA from a small subset (nine individual palms plus the parental palm) of the mapping population, a selfed cross (T128 selfed). Each primer pair produced a unique banding pattern, recognition of which was important in determining the genotypes of the individuals. Of the 25 primer pairs tested, 12 (48%) showed segregation in the mapping population (Table 3). Five of the SSR loci (P1T14, P2O1b, P4T8, P4T10 and P4O18a) showed clear co-dominant segregation profiles, while two (P1A0 and P1T6) showed dominant segregation profiles. The other five loci (P4T12a, P4T12b, P4T20b, P1O14 and P4O17b) showed complex multilocus amplification patterns, probably due to the high proportion of repetitive DNA that is characteristic of a large eukaryote genome like oil palm. These profiles were easier to score as dominant. The 12 informative SSR primer pairs were used to screen the entire mapping population (136 palms) to test for Mendelian transmission. Since the oil palm is an out breeding species and a high degree of heterozygosity is expected in its
Size of polymorphic allele (bp)
Annealing temperature
genome, thus the SSR markers showing co-dominant profile are expected to segregate in 1:2:1 ratio in this selfed cross, while SSR scored as dominant markers are expected to show 3:1 segregation ratio (Cheah et al. 1999). Eleven of the 12 primer pairs showed expected Mendelian ratios indicating their suitability for genetic mapping studies (Table 4). The results also clearly indicated that the SSR locus identified in the E. oleifera could also show clear polymorphism in E. guineensis, as demonstrated by the primer pairs P2O1b, P4O18a, P4O17b and P1O14. This augurs well for the cross species utilization of the SSR markers. Cloning of SSR locus. Selected SSR loci, which were scored in the mapping population, were cloned to confirm the presence of tandemly repeated core nucleotide units. The results showed that the originally intended repeat motifs were the locus being scored in the progeny of the mapping population (Figure 1). This confirmed that primer pairs amplified the desired region in the oil palm genome. It is thus very likely that polymorphism shown by the SSR primers particularly
126
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Development of simple sequence repeat (SSR) markers for oil palm
Table 4. Summary of SSR analyses of the 136 progeny of the mapping population.
Number of primer pairs evaluated Number of polymorphic loci identified* Number of markers showing 1:2:1 segregation Number of markers showing 3:1 segregation Number of markers meeting goodness of fit to 1:2:1 ratio or 3:1 ratio (P=0.05)
12 14 5 9 13
* For two of the primer pairs, P4T20b and P4O17b, two loci were scored for each as dominant markers.
the co-dominant loci, was due to the length variation of the SSR. However, as pointed out by Billotte et al. (2001), the occurrence of length polymorphism in the SSR analysis due to short insertion-deletion events outside or within the SSR cannot be discounted. Application of SSR markers in DNA fingerprinting of tissue culture clones. Vegetative propagation of the oil palm by tissue culture was first described in the seventies (Jones 1974). Since then, the commercial advantage of tissue culture clones over conventional seedlings has been well established. The initial problems or setbacks associated with oil palm tissue culture (e.g. flowering abnormalities) have also been minimized by adopting low hormone media and high culling rates. This has led to the calls for in vitro production of oil palm clones on a large scale. The move towards commercial production entails scaling up plantlet production. In such a situation, culture inspection by visual means alone becomes impractical. In addition, the handling of large numbers of cultures could lead to higher probability of culture mix-up. A procedure for quality control is thus necessary. The availability of simple, highly robust and low cost quality control markers for fingerprinting ortets to verify identity, monitor line uniformity and culture mix-ups will greatly enhance confidence in large scale commercial production. The importance of using molecular markers to assess the genetic fidelity of tissue culture derived plants has been reported for other crops such as Populus (Rahman and Rajora, 2001) and Pinus (Goto et al. 1998). As such, the application of the SSR markers as DNA probes for use as quality control tool in the oil palm tissue culture process was evaluated. The SSR markers were evaluated for their ability to: i) identify clones, ii) detect culture mix-up, iii) monitor line uniformity and iv) confirm ramet identity for recloning. Identifying clones. In the attempt to show that monitoring of clonal fidelity during the tissue culture process is possible, the SSR profile of the ramets was compared to that of the ortet. The results shown in Figure 2, demonstrate that there was no difference in the SSR profile of the ramets compared to their ortets and also between ramets of the same clone in
P4T10 GCCCTTACACGCACACAGAGAGATAGAGAGAGTATTTGCTTGTTTATACCGTGA CTCTCTCTCTCTCTCTCTCTCAGAGATAGAGTATTTGCTCGTTTATACAGTGAC TACCTATTCGAATCGAGAAGGGC P4T8 GCCCTTGTAGGGGCTCTCTCTCTCTCTATCTCTCTCTCTCATCTCTCTGGAAAA GTTACTTGTCTCTTCCTTTTCTCCTTTTCAGCAGCCAGGGTAGCTTCATGCTGG AGCCTTCAATGCTTCTTTTCCTCGTCCCTTGTAGTTGAAATCCATTAGCAATGG ATTGCAGTTCCTTAATCGTCATCTTTCCTCAAAGTTGTTCCAAGACAAAGAAAG CATGTATCCACTGCTGAATTTCCTCAGGGCATGAAGGGC P4O17b GCCCTTGCTCTCTCTCTCTAGGGCTCGTAGATAGTGGGCCACGGAACACGCAGC AGCCTTCCTCATATATATGCCAAACTGTAACCTCTCAAACCCTGGTGAAAGTAG ATCTCAATTCACTTAGTATAACTACCAAAAACTAGATTCAATCGGCAAGCTCAC ACCTCATCTTCACCTCGGTACAACTAAACTCCTGTTTGCTAATGAAGATGACGT GCTTCTACCGCAGGAAAGGAGGAA P4T12b GCCCTTGTTATTTGAGAGAGAGAGAGAGAGAGAGCTCACAACCATAGCGCGAAA TCTACCTAGGTTGAATTCAAGCCCATAGCTTTCTTGTGTGATCGTCCCTCCATC TTCTTCAGCGAGTGGCATACCTGTAGATTTATAACATGATTTATTCAAGTCCAT AGCATTTGTGCGATCGGCTCTTTATCTTCTTCACGTAGTGGCAAAGGGC
Figure 1. Sequence of the SSR amplicons in the mapping population. The expected repeat fragments were obtained, indicating that the primer pairs amplified the expected genomic regions. Nucleotides in bold indicate the expected repeat motifs.
all the six tissue culture clones examined. From the results, it is also clear that the SSR fingerprints can distinguish the different ortets (and their respective ramets). This augurs well for the ability of the SSR primers to distinguish the different genotypes. Detection of culture mix-up. Operator error causing cultures to be mixed up is sometimes unavoidable given the large number of cultures that are handled daily in the laboratory. These mistakes, however, need to be rectified in order to produce an acceptable product. The use of the SSR primer pairs for this purpose was tested. The SSR primers used were able to distinguish between the true ramets and the “rogues” when their SSR profiles were compared with the ortet (Figure 3). This demonstrates that the SSR markers can be used for quality control purposes in large-scale commercial production. Although the somaclonal variation phenomenon that gives rise to abnormal palms is a common occurrence in oil palm (Matthes et al. 2001), records indicate that the “rogue” palm in this case was producing normal inflorescences and fruit bunch. As such, the most likely cause of the ramet having a different fingerprint profile is that it was not derived from the ortet concerned. Furthermore, since leaf samples were used for tissue culture, the most likely cause of the fingerprint differences was due to culture mix-up in the laboratory. Previously when root tissues were used for tissue culture, incorrect palm sampling (mis-sampling of root tissues from adjacent palms) was the most likely cause of the fingerprint anomalies (Mayes et al. 1996).
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Development of simple sequence repeat (SSR) markers for oil palm
Figure 2. DNA fingerprinting of tissue culture clones using SSR analysis (P2O1b).
Clone D1050
127
Figure 4. SSR Fingerprint indicating uniformity among the different lines. The DNA profile remains unchanged within and between lines.
Clone D1050
Figure 3. Detecting Culture Mix-up (symbol * denotes ramet D1050/691 that did not originate from ortet D1050).
Figure 5. ramets.
Monitoring line uniformity. In order to be applicable as a means of quality control, it is also essential to demonstrate that the SSR primer pairs can be used to monitor line uniformity between and within lines of a clone. A single oil palm clone with three embryoid lines was selected to demonstrate this, as shown in Figure 4. This helps to confirm that the various lines are indeed from the selected clone. This can also help clear up any mix-up that may occur early in the tissue culture process (at the embryoid stage). Furthermore, monitoring the DNA profile via SSR analysis can help ensure that there are no major genomic rearrangements induced by the tissue culture process in a particular line, which can give rise to abnormal looking cultures later in the tissue culture process. Abnormal looking cultures are usually culled by the tissue culturist.
Cluster analysis of tissue culture clones. The effectiveness of SSRs for fingerprinting tissue culture clones was also demonstrated by the results of the UPGMA analysis. Five of the SSR primer pairs showing co-dominant profile were used to screen the six sets of samples (each set consisting of the ortets and their respective ramets). The dendrogram constructed based on the five polymorphic SSR loci (Figure 6) showed that the ortet and ramets of one set were clearly separated from the other sets. The SSR primers tested could clearly distinguish the different sets of genotypes. These points to an important application, especially when a large number of ortets have been sampled by a laboratory and there is a need to verify the “lineage” of the corresponding ramets (which can number more than 100 per ortet). It will not be possible to confirm the “lineage” of the large number of ramets by visual observation of the DNA profile on agarose gels or autoradiographs. Cluster analysis further demonstrated that the tissue culture clones were very uniform. The SSR analysis showed that the ramets were true-to-type when compared to the ortets, as the genetic distance between the ortets and ramets of a particular set was negligible. Furthermore, the dendrogram indicated that some genotypes showed close genetic relatedness, for example set PY and the set C166. This information can assist breeders in selecting the appropriate tissue culture clones to be planted at a particular location or site in order to maintain genetic variability. The existence of some level of genetic divergence among
Confirming ramet identity for recloning. In order to recreate clones which are promising, several laboratories have resorted to resampling the ortet or recloning the ramets. Recloning the ramet offers the advantage that the number of plants available for sampling is multiplied. Moreover, it is not uncommon that the original ortet may no longer be available. In the sampling of ramets for recloning, it is imperative that the palm selected is authentically from the clone of choice. Thus, DNA fingerprinting was used for verification, where the palms generated from cloning of the ramets demonstrated identical fingerprints compared to the original ortet and the ramet (Figure 5).
SSR profile of ortet, ramets and reclone of the
128
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
.40
.36
.32
.28
Development of simple sequence repeat (SSR) markers for oil palm
.24
.20
.16
.12
.08
.04
.00 PX PX1 PX2 PY PY1 PY2 C166 C166/A C166/B C166/C C166/D D1050 D1050/54 D1050/166 D1050/666 D1050/671 D1050/692 C343 C343/26 C343/3 C343/25 D2282 D2282/2902 D2282/2903 D2282/2906 D2282/2908 D2282/2910 D2282/2915
.40
.36
.32
.28
.24
.20
.16
.12
.08
.04
.00
Figure 6. A dendrogram based on the UPGMA clustering of the tissue culture clones using the genetic distance of Nei (1972).
tissue culture clones of the different genotypes tested in this study is also clearly demonstrated in Table 5, where the overall degree of genetic differentiation was estimated to be 0.3250. The FST values calculated for the five primer pairs used ranged from 0.000 (P4T8) to 0.6101 (P4T10). The high FST value for the primer pairs P201b (0.5413), P4T10 (0.6101), and P1T14 (0.3824), is a further indication of the ability of these primer pairs to distinguish tissue culture clones of different genotypes. The genetic fidelity between mother trees and its tissue culture plantlets has also been reported for neem plants
(Singh et al. 2002). The authors reported the use of dendrogram based on UPGMA analysis to confirm the true to type nature of tissue culture progenies. However, for the tree plant Robinia pseudoacacia, the cluster analysis generated using random amplified polymorphic DNA (RAPD) markers, revealed genetic variation among the 18 micropropagated plants derived from a single mother plant (Bindiya et al. 2003). The authors concluded that polymorphisms observed were due to somaclonal variation resulting in either point mutations (which changed the sequence of the primer binding) or insertions, deletion or inversions (which can change the size of
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Development of simple sequence repeat (SSR) markers for oil palm
129
Table 5. FST at 5 primer pairs for all the tissue culture clones tested in this study.
REFERENCES
Bennetzen, J.L. and Freeling, M. 1997. The unified grass genome: Synergy in synteny. Genome Research 7: 301-306.
Primer Pairs
P2O1b
P4T10
P4T8
P1T14 P4O18a
FST
0.5413
0.6101
0.0000
0.3824
Mean FST
0.1286
0.3250
the target DNA or prevent amplification). More importantly, the results demonstrate the importance of confirming the genetic integrity of micropropagated plants before transferring to the field. Taken together, the data reported here clearly supports the application of the SSR markers in effectively fingerprinting oil palm tissue culture clones. Moreover, due to the ready availability of the SSR primers used, the results can easily be verified and compared in different laboratories.
CONCLUSION This study has demonstrated the applicability of a simple and effective method to isolate SSR markers for oil palm. The SSR markers were found to be suitable for genetic mapping studies, which will assist efforts towards marker assisted selection (MAS) in oil palm. The results from this study also clearly demonstrated the effectiveness of the SSR markers for fingerprinting tissue culture clones as a means of quality control. The added advantage is that the SSR analysis can be implemented at any stage of the tissue culture process. Ideally, fingerprinting should be conducted for ortet palms at the time of sampling. Records will then be available for future reference. Line uniformity can be monitored in polyembryogenic cultures and spot checks made during shoot/root establishment in the test tube or at the polybag stage. In the event that field planted clonal palms are to be re-cloned, fingerprinting could be carried out to ascertain the origin of the palm. The use of the SSR probes for quality control in the tissue culture process can be seen as an initial effort at introducing molecular aided screening to the oil palm industry. This also has important implications when intellectual property rights (IPR) can be provided for oil palm clones.
ACKNOWLEDGEMENTS The authors would like to thank the Director-General of MPOB for permission to publish this manuscript.
Billotte, N., Marseillac, N., Risterucci, A.M., Adon, B., Brotteir, P., Baurens, F.C., Singh, R., Herran, A., Asmady, H., Billot, C., Amblard, P Durrand-Gasselin, T., Courtois, B., Asmono, D., Cheah, S.C., Rohde, W. and Charrier, A. 2005. Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.). Theoretical Applied Genetics 110: 754-765. Billotte, N., Risterucci, A.M., Barcelos, E., Noyer, J.L., Amblard, P. and Baurens, F.C. 2001. Development, characterization and across-taxa utility of oil palm (Elaeis guineensis Jacq.) microsatellite markers. Genome 44: 413-425. Bindiya, K. and Kanwar, K. 2003. Random amplified polymorphic DNA (RAPDs) markers for genetic analysis in micropropagated plants of Robinia pseudoacacia L. Euphytica 132: 41-47. Brachet, S., Jubier, M.F., Richard, M., Jung-Muller, B. and Lacoste, N.F. 1999. Rapid identification of microsatellite loci using 5’ anchored PCR in the common ash Fraxinus excelsior. Molecular Ecology 8: 160-163. Brondani, R.P.V., Brondani, C., Tarchini, R. and Grattapaglia, D. 1998. Development, characterization and mapping of microsatellite markers in Eucalyptus grandis and E. urophylla. Theoretical Applied Genetics 97: 816-827. Cheah, S.C., Ooi, L.C.L. and Rahimah, A.R. 1995. Polymorphic DNA in oil palm amplified by simple sequence repeat (SSR) primed polymerase chain reactions. In The VII National Biotechnology Seminar (Seminar Bioteknologi Kebangsaan ke VII), Langkawi Island, Malaysia, 20-22 November 1995. Cheah, S.C. and Ooi, L.C.L. 1999. Development of genetic markers for the oil palm based on simple sequence repeat (SSR) DNA. In Colloquium on advances in oil palm research under IRPA-funded programmes in the 7th Malaysian Plan, 1-2 November 1999, Palm Oil Research Institute of Malaysia, Bandar Baru Bangi, Selangor, Malaysia. Cheah, S.C., Singh, R. and Maria, M. 1999. Generating molecular tools for oil palm improvement through the genomics approach. In 1999 PORIM International Palm Oil Conference, ed. A. Darus, K.W. Chan and S.R.S.A. Sharifah, pp 297-320. Kuala Lumpur, Malaysia.
130
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Chen, X., Temnykh, S., Xu, Y., Cho, Y.G. and Mccouch, S.R. 1997. Development of microsatellite framework map providing genome-wide coverage in rice (Oryza sativa L.). Theoretical Applied Genetics 95: 553-567. Cho, Y.G., Ishii, T., Temnykh, S., Chen, X., Lipovich, L., McCouch, S.R., Park, W.D., Ayer, N. and Cartinhour, S. 2000. Diversity of microsatellites derived from genomic libraries and Genbank sequences in rice. Theoretical Applied Genetics 100: 713-722. Dehmer, K.J. and Friedt, W. 1998. Evaluation of different microsatellite motifs for analyzing genetic relationship in cultivated sunflower Helianthus annuus L. Plant Breeding 117: 45-48. Doyle, J.J. and Doyle, J.L. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15. Eujayl, I., Sorrels, M.E., Baum, M., Wolters, P. and Powell, W. 2001. Assessment of genotypic variation among cultivated durum wheat based on EST-SSRs and genomic SSRs. Euphytica 119: 39-43. Fisher, P.J., Gardner, R.C. and Richardson, T.E. 1996. Single locus microsatellites isolated using 5’ anchored PCR. Nucleic Acids Research 24: 4369-4371. Goto, S., Thakur, R. C. and Ishii, K. 1998. Determination of genetic stability in long-term micropropagated shoots of Pinus thunburghii Parl. using RAPD markers. Plant Cell Reports 18: 193-197. Jander, G., Norris, S.R., Rounsley, S.D., Bush, D.F., Levin, I.M. and Last, R.L. 2002. Arabidopsis map-based cloning in the post-genome era. Plant Physiology 129: 440-450. Jones, L.H. 1974. Propagation of clonal palms by tissue culture. Oil Palm News 17: 1-8. Korzun, V., Roder, M.S., Wendekake, K., Pasqualone, A., Lotti, C., Ganal, M.W. and Blanco. 1999. Integration of dinucleotide microsatellites from hexaploid bread wheat into a genetic linkage map of durum wheat. Theoretical Applied Genetics 98: 1202-1207. Matthes, M., Singh, R., Cheah, S.C. and Karp, A. 2001. Variation in oil palm tissue culture-derived regenerants revealed by AFLPs with methylation sensitive enzymes. Theoretical Applied Genetics 102: 971-979. Mayes, S., James, C.M., Horner, P.L., Jack, P.L. and Corley, R.H.V. 1996. The application of restriction fragment length polymorphism for the genetic fingerprinting of oil palm (E. guineensis Jacq.).Molecular Breeding 2: 175-180.
Development of simple sequence repeat (SSR) markers for oil palm
McCouch, S.R., Teytelman, L., Xu, Y., Lobos, K.B., Clare, K., Walton, M., Fu, B., Maghirang, R., Li, Z., Xing, Y., Zhang, Q., Kono, I., Yano, M., Fjellstrom, R., DeClerck, G., Schneider, D., Cartinhour, S., Ware, D. and Stein, L. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Research 9: 257-279. Nei, M.1972. Genetic distance between populations. American Naturalist 106: 283-292. Oboh, B.O. and Fakorede, M.A.B. 1989. Optimum time for yield evaluation and selection in the oil palm (Elaeis guineensis Jacq.). Oleagineux 44: 509-513. Peakall, R., Gilmore, S., Keys, W., Morgante, M., Rafalski, A. 1998. Cross-species amplification of soybean (Glycine Max) simple sequence repeats (SSRs) within the genus and other legume genera: implications for the transferability of SSRs in plants. Molecular Biology and Evolution 15: 1275-1287. Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S. and Rafalski, A. 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2: 225-238. Provan, J., Powell, W. and Waugh, R. 1996. Microsatellite analysis of relationships within cultivated potato (Solanum tubercosum). Theoretical Applied Genetics 92: 1078-1084. Rahman, M. H. and Rajora, O. P. 2001. Microsatellite DNA somaclonal variation in micropropagated trembling aspen (Populus tremuloides). Plant Cell Reports 20:531536. Rajanaidu, N. 1990. Major developments in oil palm (Elaeis guineensis) breeding. In Proceedings of the 12th Plenary Meeting of AETFAT, pp 39-52. Hamburg, Germany. Ramsay, L., Macaulay, M., Ivannissevich, D., Maclean, K., Cardle, L., Fuller, J., Edwards, K. J., Tuvesson, S., Morgante, M., Massari, A., Maestri, E., Marmiroli, N., Sjakste, T., Ganal, M.W, Powell, W. and Waugh, R. 2000. A simple sequence repeat based linkage map of barley. Genetics 156: 1997-2005. Roder, M.S., Korzun, V., Wendehake, K., Plaschke, J., Tixier, M.H., Leroy, P. and Ganal, M.W. 1998. A microsatellite map of wheat. Genetics 149: 2007-2023. Rozen, S. and Skaletsky, H. J. 2000. Primer 3 on the WWW for general users and for biologists programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology, ed. S. Krawetz and S. Misener, pp 365-386. Humana Press, Totowa, NJ.
AsPac J. Mol. Biol. Biotechnol., Vol. 15 (3), 2007
Singh, A., Negi, M. S., Moses, V. K., Venkateswarlu, B., Srivastava, P.S. and Lakshmikumaran, M. 2002. In Vitro Cellular & Developmental Biology-Plant 38: 519-524. Smith, J.S.C., Chin, E. C.L, Shu, H., Smith, O.S., Wall, S.J., Senior, M.L., Mitchell, S.E., Kresovich, S. and Ziegle, J. 1997. An evaluation of the utility of SSR loci as molecular markers in maize (Zea mays. L.), comparison with data from RFLPs and pedigree. Theorectical Applied Genetics 95: 163-173. Sneath, P.H.A. and Sokal, R.R. 1973. Numerical taxonomy. WH Freeman Press, San Francisco. Wu, R.L., Han, Y.F., Hu, J.J., Fong, J.J., Li, L., Li, M.L. and Zeng, Z.B. 2000. An integrated genetic map of Populus deltoids based on amplified fragment length polymorphisms. Theoretical Applied Genetics 100: 1249-1256. Yeh, F.C. and Boyle, T. 1999. POPGENE version 1.32. The user-friendly software for population genetic analysis. University of Alberta and CIFOR, Calgary, Alta.
Development of simple sequence repeat (SSR) markers for oil palm
131
