Developmental-Stage-Specific Expression and Regulation of an ...

MOLECULAR AND CELLULAR BIOLOGY, Aug. 1996, p. 4240–4247 0270-7306/96/$04.0010 Copyright q 1996, American Society for Microbiology

Vol. 16, No. 8

Developmental-Stage-Specific Expression and Regulation of an Amphotropic Retroviral Receptor in Hematopoietic Cells CHRISTINE RICHARDSON†

AND

ARTHUR BANK*

Department of Genetics and Development, Department of Medicine, College of Physicians and Surgeons, Columbia University, New York, New York 10032 Received 6 March 1996/Returned for modification 17 April 1996/Accepted 6 May 1996

Expression of the transmembrane receptor protein Ram-1 may be critical to optimizing retroviral gene transfer. Ram-1 acts as both a sodium-dependent phosphate transporter and a receptor for amphotropic retroviruses. We previously reported detectable Ram-1 in murine hematopoietic fetal liver cells (FLC) despite resistance of these cells to amphotropic retroviral transduction (infection). We document here that Ram-1 expression is completely absent in murine yolk sac cells from days 9.5 through 13.5 of ontogeny and first appears at low levels in midgestational FLC between days 13.5 and 14.5. In addition, Ram-1 expression is detected only in more differentiated populations within FLC, day 14.5, and not in those highly enriched for stem cells, indicating developmental regulation of Ram-1 during murine hematopoiesis. Others have reported the in vitro use of phosphate-free medium as a stimulus to increase levels of Ram-1 mRNA in nonhematopoietic cells. We now demonstrate that Ram-1 poly(A)1 mRNA increases significantly following culture of FLC in phosphate-free medium. Further, transduction of FLC in phosphate-free medium with an amphotropic retrovirus containing the multiple drug resistance gene leads to gene transfer not observed previously. These data demonstrate that (i) the normal resistance of FLC to amphotropic transduction is most likely due to an insufficient number of Ram-1 molecules for efficient retroviral recognition and binding, and (ii) Ram-1 can be upregulated by increasing the need for phosphate transport across the cell membrane. development, murine hematopoietic fetal liver cells (FLC) possess the same cell lineages (4) and progenitor populations as adult bone marrow (8). Additionally, FLC can be used to reconstitute the hematopoietic system of lethally irradiated mice in a manner similar to that of adult bone marrow cells, suggesting that these cells of fetal origin are able to respond to signals in the adult hematopoietic microenvironment (12). Despite these similarities, we recently demonstrated that FLC cannot be transduced with amphotropic retroviruses, while their adult bone marrow counterparts can (26). We have now further characterized the expression of Ram-1 in hematopoietic cells during embryonic development. To do this, we used reverse transcriptase PCR (RT-PCR) to detect and quantitate levels of Ram-1 poly(A)1 RNA in hematopoietic populations through ontogeny as well as in populations enriched for HSC. We show that Ram-1 expression is completely absent in murine yolk sac cells from day 9 through 13.5 and appears later in FLC beginning between days 13.5 and 14.5 of ontogeny. From this time onward, Ram-1 poly(A)1 RNA continues to be present in unfractionated FLC, although at lower levels than observed in adult tissues. We also find that Ram-1 mRNA is not detectable in several subpopulations of FLC that are highly enriched for HSC. These results indicate that Ram-1 is developmentally regulated during murine hematopoiesis and is expressed only at later times during development and in more differentiated cell types. Because Ram-1 functions as the amphotropic retroviral receptor, its expression pattern, and that of its human homolog GLVR-2, has implications for predicting the efficiency of gene transfer into specific types of cells. The susceptibility of a number of cell types to amphotropic retroviral transduction suggests that expression of the Ram-1 protein on the surface of these cells is required for recognition by amphotropic viruses. Others have reported that culture of rat fibroblasts in phosphate-free medium increases the amount of intracellular Ram-1 RNA present (13). We used this culture system as a

The transmembrane protein Ram-1 functions both as a sodium-dependent phosphate transporter (13) and as the amphotropic retroviral receptor used for recognition by the retrovirus envelope protein for entry into target cells. Ram-1, the rodent form of this protein, is related in structure to the gibbon ape leukemia virus receptor (designated Glvr-1 in rodents and GLVR-1 in humans), which also acts as a sodium-dependent phosphate transporter (18, 32). Ram-1 shows 92% amino acid similarity with its human homolog GLVR-2 and about 60% amino acid similarity with the related family member Glvr-1. Expression studies of Ram-1 in adult rat tissues have shown a broad distribution of Ram-1 RNA (13). The highest levels of Ram-1 mRNA are in liver, heart, and brain, but Ram-1 is also present at lower levels in thymus, marrow, lung, muscle, and kidney (13). It remains unclear whether the transport of phosphates across the cellular membrane by this protein is linked to the ability of viruses to use it for recognition and entry into cells. Characterization of Ram-1 expression may help optimize retroviral gene transfer into various cell types which appears to require appropriate amphotropic receptor expression on the surface of desired target cells. During murine ontogeny, primordial hematopoietic development occurs in the yolk sac between day 7 and day 12 (17, 20), and then hematopoietic stem cells (HSC) migrate to the developing midgestational fetal liver beginning at about day 11 (11). The fetal liver is the major site of hematopoiesis until, beginning on days 15 and 16, moving to the spleen and bone marrow, respectively, which remain the major sites of hematopoiesis throughout adult life. Despite their earlier stage of * Corresponding author. Mailing address: Columbia University, Department of Genetics and Development, 701 W. 168th St., HHSC Rm. 1602, New York, NY 10032. Phone: (212) 305-4186. Fax: (212) 9232090. † Present address: Memorial Sloan-Kettering Cancer Center, New York, NY 10021. 4240

VOL. 16, 1996

EXPRESSION OF AMPHOTROPIC RETROVIRAL RECEPTOR

potential means of upregulating Ram-1 expression in FLC from day 14.5 and to test the ability of Ram-1 detected in these cells to act as an amphotropic retroviral receptor. These studies show that culture of FLC in phosphate-free medium leads to an increase in detectable Ram-1 mRNA. Further, incubation of FLC in phosphate-free medium with amphotropic retrovirus containing the human multiple drug resistance gene (MDR) cDNA leads to a positive MDR-PCR signal, demonstrating gene transfer that is absent under normal conditions. These results suggest that upregulation of Ram-1 expression with phosphate deprivation may be sufficient to reverse the previously observed resistance of FLC to amphotropic retroviral transduction. MATERIALS AND METHODS Harvest of yolk sac populations and analysis. Male and female mice (C57BL/ 6J) were placed together overnight. In the morning, females were checked for the presence of a vaginal plug, indicating insemination. This time was designated day 0.5. Harvest of yolk sac cells was adopted from the method of Wong et al. (35). On days 9.5, 10.5, 11.5, and 13.5, yolk sacs containing embryos were dissected in cold 13 phosphate-buffered saline (PBS) with 3% fetal calf serum (FCS) and maintained on ice. Embryos were dissected away, and yolk sacs were added to 1 ml of freshly prepared 13 PBS supplemented with 0.1% collagenase and 20% FCS. Samples were passed through an 18-gauge needle twice. Mixtures were incubated at 378C for 3 h with occasional mixing. Forty milliliters of a minimal essential medium (aMEM) with 2% FCS was then added, and clumps were allowed to settle for 5 min at room temperature. Supernatant containing the cells of interest was transferred to a new tube, leaving behind 5 ml. Cells were centrifuged for 5 min at 800 3 g. Supernatants were then aspirated away from cell pellets, which were then washed once in aMEM with 2% FCS. Final cell suspensions were used for RNA preparations. Harvest of FLC populations. Day 0.5 postcoitum was defined as indicated in the previous section. On days 13.5, 14.5, and 15.5 postcoitum, livers were dissected out of fetuses. Single cell suspensions were made by forcing FLC through a sterile wire mesh (mesh size, 0.625-mm) and then by sequential pipetting with a 5-ml syringe fixed with a 20-gauge needle. Cell counts were determined with a hemocytometer. Cells were then used for sorting of HSC-enriched populations, for transduction with retroviral supernatants, or in RNA preparations. Sorting of HSC-enriched populations. FLC were incubated with a cocktail of biotinylated LIN antibodies including CD4, CD8, B220, Gr-1, MAC-1, and NK-1 for 20 min on ice. Cells were washed once with 13 PBS–3% FCS–0.2% NaN3, and then incubated with 0.4 mM streptavidin-conjugated magnetic beads (Perseptive BioSystems) and incubated for 20 min on ice. LIN1 cells were extracted. LIN2 cells were incubated with Thy1.2-phycoerythrin (3 mg per 106 cells) alone or with Sca-fluorescein isothiocyanate (2 mg per 106 cells) and Thy1.2-phycoerythrin (3 mg per 106 cells) antibodies for 20 min on ice and washed in 3 ml of 13 PBS–3% FCS–0.2% NaN3. Cells were resuspended in a small volume of the same buffer for sorting by fluorescence-activated cell sorter (FACS). Dead cells were eliminated from analysis by propidium iodide staining. Analysis and sorting were performed on a FACStar Plus (Becton Dickinson) in the Columbia Comprehensive Cancer Center Core Facility. Sorted cells were used for RNA preparation. Preparation of viral producer lines and viral supernatants. (i) Preparation of MDR lines. GP1E86 ecotropic packaging cells (16) or GP1envAm12 amphotropic packaging cells (15) were transfected with the retroviral vector pHaMDR1/A (22) by the calcium phosphate coprecipitation method (34) and selected in medium containing colchicine (60 ng/ml), as described elsewhere (33). Culture supernatants were titered for viral production on uninfected NIH 3T3 cells, as described elsewhere (15, 16). Clones producing the highest titers of MDR retrovirus (5 3 105 for the ecotropic line and 5 3 104 for the amphotropic line) were maintained as viral producer lines. (ii) Preparation of viral supernatants. Viral producer cell cultures (40% confluent) were incubated for 24 h with aMEM containing 15% FCS, 15% WEHI-conditioned medium, and 1% penicillin-streptomycin solution. Supernatants were then passed through a 0.45-mm-pore-size filter. Supernatants were either used directly for transduction or maintained at 2708C until such use at a later time. Analysis of amphotropic receptor expression. (i) Preparation of mRNA. Poly(A)1 RNA was prepared from aliquots of 5 3 106 FLC by using a MicroFastTrack kit (Invitrogen) with an oligo(dT) column to bind poly(A)1 RNA. The column was eluted with a low-salt buffer to remove nonspecific bound nonpolyadenylated RNA; this was followed by elution of poly(A)1 RNA. Final RNA yields were resuspended in 20 ml of diethyl pyrocarbonate (DEPC)-treated Tris-EDTA buffer. (ii) Reverse transcription and PCR. Reverse transcription reactions were performed with various dilutions of the poly(A)1 RNA from FLC, murine adult tissues, and yeast cells by using the StrataScript RT-PCR kit (Stratagene) and the supplied random primers. Essentially, RNA was incubated with random primers

4241

at 658C for 5 min to allow annealing. Buffer, RNase inhibitor, deoxynucleoside triphosphates, and RT were added and the reaction mixture was incubated at 378C for 1 h. Reactions were completed by sitting in a 908C bath for 5 min, and the resultant cDNA was placed on ice. Using recently published sequences for the amphotropic Moloney receptor gene (18), we designed appropriate primers for RT-PCR analysis. Ram-1 cDNA specific sequences were amplified by using the sense-strand primer, TGAGACAGGCATGCATTCTG (residues 401 to 420), and the antisense-strand primer, ACTCTCCTTCTCTAACCTGC (residues 1001 to 1020), which yielded a 619-bp product. Murine b-actin cDNA was amplified by using the sense-strand primer, GTGGGCCGCTCTAGGCACC AA, and the anti-sense strand primer, CTCTTTGATCACGCAGATTTC (Clontech), to yield a 500-bp product. For amplification of the cDNA sequences, 35 cycles of 60 s of denaturation at 948C, 60 s of annealing at 608C, and 120 s of extension at 728C were used. Control samples included RNA supplied with the Stratascript kit, including appropriate primers for PCR, and murine adult kidney and spleen RNA (Clontech). Ten microliters of the PCR product was examined on a 4% agarose-NuSieve gel for the presence of the expected bands. (iii) Southern blotting of RT-PCR products. Twenty-five microliters of the PCR product was run on a 1% agarose-NuSieve gel. The gel was washed for 30 min in 1 M NaOH for denaturation and for 1 h in Tris-HCl, pH 7.0, for neutralization. Blotting was performed by using 103 SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodium citrate) buffer and a positively charged nitrocellulose membrane. Following overnight transfer, the blot was washed for several minutes in 23 SSC, dried, and then baked in a vacuum oven for 30 min. The blot was prehybridized in a heat-sealed plastic bag at 688C with 33 SSC-0.5% sodium dodecyl sulfate (SDS)-53 Denhart’s solution with 100 mg of denatured salmon sperm DNA per ml for 4 h. Prehybridization solution was discarded and replaced with fresh solution containing denatured salmon sperm DNA and heat-denatured 32P-labelled probe specific for Ram-1 or b-actin. Probes were previously labelled by using random priming with the Prime-It kit (Stratagene) and 32Plabelled adATP (NEN). Hybridization at 688C was performed overnight. The blot was then washed for 1 h on a shaker at room temperature in BFP solution containing 0.5 g of bovine serum albumin, 0.5 g of Ficoll, and 0.5 g of polyvinylpyrrolidone-40 in 500 ml of 23 SSC. The blots were washed twice in 0.1% SDS–0.13 SSC solution prewarmed to 558C, rinsed in 23 SSC, dried, and exposed to Kodak film overnight and developed. Relative band intensities were determined with a PhosphorImager in the Columbia University Comprehensive Cancer Core Facility. (iv) Quantitation of Ram-1 expression levels. RT-PCR was performed on total FLC, day 14.5, as described above by using b-actin specific primers. PCRs were terminated after 5, 10, 15, 20, 25, and 30 cycles. Samples were run on a 4% agarose-NuSieve gel containing ethidium bromide; no bands were visible to the naked eye. Southern blotting was performed as described above, and amplified band intensities were determined with the PhosphorImager. The number of cycles that still resulted in linear amplification of the b-actin signals was determined. Twenty cycles fell within the linear phase and were then used in subsequent quantitative RT-PCR studies with the Ram-1 and b-actin primers. FLC Ram-1 expression and retroviral transduction in phosphate-free medium. (i) Normal phosphate (P1) conditions. Cell aliquots (2 3 107) were prestimulated to divide in T175 flasks (Nunc) containing 50 ml of aMEM supplemented with 15% FCS, 1% penicillin-streptomycin solution (GIBCO), interleukin 6 (IL-6) (200 U/ml), and rat recombinant stem cell factor (SCF) (100 ng/ml; Amgen). Cells were incubated for 12 to 24 h at 378C for stimulation of cells into cell cycle. Some cells were then analyzed by RT-PCR for Ram-1 expression. Cultures were then exposed to MDR viral particles containing supernatants and Polybrene (8 mg/ml) for 24 to 48 h at 378C. Cells scrapers were used to remove adherent cells from the flasks, and cells were concentrated by centrifugation at 800 3 g for 10 min. Supernatants were aspirated away from cell pellets. Cells were then resuspended in a small volume of aMEM. (ii) Phosphate-depleted (P2) conditions. Cell aliquots (2 3 107) were prestimulated to divide in T175 flasks (Nunc) containing 50 ml of phosphatedeficient aMEM supplemented with 15% FCS previously dialyzed to remove phosphate ions, 1% penicillin-streptomycin solution (GIBCO), IL-6 (200 U/ml), and rat recombinant SCF (100 ng/ml; Amgen). Cells were incubated for 12 to 24 h at 378C to stimulate cell division required for retroviral integration. Some cells were then analyzed by RT-PCR for Ram-1 expression. Cultures were then exposed to supernatants containing MDR viral particles prepared with the same phosphate-deficient medium and Polybrene (8 mg/ml) for 24 to 48 h at 378C. Cells scrapers were used to remove adherent cells from the flasks, and cells were concentrated by centrifugation at 800 3 g for 10 min. Supernatants were aspirated from cell pellets. Cells were then resuspended in 13 PBS. Analysis of transduced cells. Transduced FLC DNA was prepared for PCR by the following procedure. Aliquots of 2 3 106 cells were washed once with 13 PBS. Cells were incubated in lysis buffer containing proteinase K (0.6 mg/ml) at 558C overnight. Two volumes of phenol were added to the suspension and the mixture was spun in an Eppendorf microcentrifuge at maximum speed (13,000 rpm) for 10 min. The upper aqueous layer was saved and phenol extraction was repeated at least twice more. Equal volumes of phenol and chloroform-isoamyl alcohol (24:1) were added to the final aqueous material and the mixture was spun in the microcentrifuge at maximum speed for 10 min. The upper aqueous layer obtained was saved, and 1/10 volume of 3 M sodium acetate was added. Two volumes of ethanol were added, and samples were placed in a dry ice-ethanol

4242

RICHARDSON AND BANK

FIG. 1. RT-PCR Ram-1 analysis of poly(A)1 RNA of FLC and yolk sac (YS) throughout ontogeny. (Top) The arrow at the left indicates the expected band of 619 bp for the Ram-1 signal. Lanes 1 through 12 used Ram-1 specific primers. Lane 1, YS day 9.5; lane 2, YS day 10.5; lane 3, YS day 11.5; lane 4, YS day 13.5; lane 5, FLC day 13.5; lane 6, FLC day 14.5; lane 7, FLC day 14.5 (no reverse transcriptase); lane 8, FLC day 15.5; lane 9, FLC day 15.5 (no reverse transcriptase); lane 10, adult spleen; lane 11, adult spleen (no reverse transcriptase); lane 12, H2O; lane 13, Phi X HaeIII marker. (Bottom) The arrow at the left indicates the expected band of approximately 500 bp for the b-actin signal. Lanes 1 through 12 used b-actin specific primers. Lane 1, YS day 9.5; lane 2, YS day 10.5; lane 3, YS day 11.5; lane 4, YS day 13.5; lane 5, FLC day 13.5; lane 6, FLC day 14.5; lane 7, FLC day 14.5 (no reverse transcriptase); lane 8, FLC day 15.5; lane 9, FLC day 15.5 (no reverse transcriptase); lane 10, adult spleen; lane 11, adult spleen (no reverse transcriptase); lane 12, H2O; lane 13, Phi X HaeIII marker.

MOL. CELL. BIOL.

(Fig. 1). When no RT was present in the reaction, no signal was seen, confirming that the Ram-1 signal is specific for the presence of RNA and not contaminating DNA (Fig. 1). All samples were also amplified with RT-PCR specific control b-actin primers, and showed the expected 500-bp signal (Fig. 1). The strong b-actin signal in the yolk sac samples indicates that the lack of detectable Ram-1 is not due to inadequate amounts of RNA present. Increasing RT-PCRs to 65 cycles produced the same results (data not shown). Despite the sensitivity of PCR, low levels of Ram-1 mRNA could result in amplification of an RT-PCR product that might be undetectable by ethidium bromide staining of an agarose gel but could be detectable after hybridization to a labelled probe. The existence of such low levels of mRNA would not be surprising if increased expression of this gene occurs very gradually during hematopoietic development. However, Southern blotting does not reveal any expression of Ram-1 in populations that was not apparent on an agarose gel (Fig. 2). Again, no detectable level of Ram-1 mRNA was observed in day 13.5 FLC or at any time within the yolk sac (Fig. 2). All samples were positive for the expected 500-bp band when amplified with RT-PCR specific primers for b-actin as a control for the presence of adequate amounts of RNA (Fig. 2). To control for quantitation of Ram-1 expression in these experiments, some PCRs were terminated after 20 cycles,

bath for 10 min. Samples were then spun in the microcentrifuge at maximum speed for 10 min, the supernatants were aspirated, and the final pellets were resuspended in Tris-EDTA buffer (pH 7.0). PCR was carried out using 1 mg of DNA with 1 U of AmpliTaq polymerase and the appropriate reaction mix (Perkin-Elmer Cetus) in a final volume of 50 ml. For amplification of MDR sequences, initial primer annealing was at 948C for 4 min; this was followed by 35 cycles of 30 s of denaturation at 948C, 30 s of annealing at 558C, and 60 s of extension at 728C, and further extension with an additional 7 min at 728C. MDR specific sequences were amplified with the sense-strand primer, CCCATCATT GCAATAGCAGC (residues 2596 to 2615), and the antisense-strand primer, GTTCAAACTTCTGCTCCTGA (residues 2733–2752), which yielded a 167-bp product (21). Ten microliters of the PCR product was examined on a 4% agarose-NuSieve gel for the presence of the expected band.

RESULTS Expression pattern of Ram-1 in hematopoiesis through murine ontogeny. Primers for the Ram-1 cDNA sequence (18) were used in RT-PCR, as previously described, to detect a signal specific for the Ram-1 mRNA and not the genomic DNA sequences (26). To determine the time of onset of Ram-1 expression during development, poly(A)1 RNA was isolated from visceral yolk sac cells from days 9.5 through 13.5 and from FLC from days 13.5 to 15.5. The methods used to purify yolk sac cells and FLC resulted in a majority of cells that were hematopoietic with little, if any, hepatocyte contamination (26, 35). Following reverse transcription, the cDNA was amplified with the Ram-1 cDNA specific primers. In all yolk sac populations examined from days 9.5 to 13.5, no Ram-1 signal was detected (Fig. 1). Although a Ram-1 signal was not detected in day 13.5 FLC, it was observed in FLC samples from days 14.5 and 15.5

FIG. 2. Blot of RT-PCR Ram-1 analysis of poly(A)1 RNA of FLC and yolk sac (YS) throughout ontogeny. (Top) Following RT-PCR, samples were probed with a Ram-1 mRNA specific oligonucleotide purified from adult spleen cDNA. The arrow at the left indicates the expected band of 619 bp for the Ram-1 signal. Lanes 1 through 10 used Ram-1 specific primers. Lane 1, adult spleen; lane 2, adult spleen (no reverse transcriptase); lane 3, FLC day 15.5; lane 4, FLC day 15.5 (no reverse transcriptase); lane 5, FLC day 14.5; lane 6, FLC day 14.5 (no reverse transcriptase); lane 7, FLC day 13.5; lane 8, YS day 13.5; lane 9, YS day 11.5; lane 10, YS day 10.5. (Bottom) Following RT-PCR, samples were probed with a b-actin mRNA specific oligonucleotide purified from adult spleen cDNA. The arrow at the left indicates the expected band of approximately 500 bp for the b-actin signal. Lanes 1 through 10 used b-actin specific primers. Lane 1, adult spleen; lane 2, adult spleen (no reverse transcriptase); lane 3, FLC day 15.5; lane 4, FLC day 15.5 (no reverse transcriptase); lane 5, FLC day 14.5; lane 6, FLC day 14.5 (no reverse transcriptase); lane 7, FLC day 13.5; lane 8, YS day 13.5; lane 9, YS day 11.5; lane 10, YS day 10.5.

VOL. 16, 1996


TABLE 1. Developmental expression of Ram-1 in hematopoietic cells Signal intensitya Tissue

Adult spleen Fetal liver Day 15.5 Day 14.5 Day 13.5 Yolk sac Day 13.5 Day 11.5 Day 10.5 Day 9.5

% Adult expression

b-Actin

Ram-1

Ram-1 corrected

224

88

39

100

225 133 79

23 29 ,1

10 22 ,1

26 55 ,3

90 188 189 121

,1 ,1 ,1 ,1

,1 ,1 ,1 ,1

,3 ,3 ,3 ,3

a b-Actin signal intensities were normalized to arbitrary units. Ram-1 signals were normalized for b-actin (Ram-1 corrected). Signals below 3 were determined to be not above background.

which was reproducibly found by PhosphorImager analysis to be during the linear phase of RT-PCR signal generation for b-actin, the internal control (see Materials and Methods). After normalization of b-actin signal intensities to arbitrary units, signals for Ram-1 were normalized to equivalent units (Table 1). FLC on days 14.5 and 15.5 have 26 to 55% as much Ram-1 mRNA present as an adult hematopoietic tissue (Table 1). FLC at day 13.5 and all yolk sac populations analyzed have undetectable signals (Table 1). These results indicate that Ram-1 is completely absent in murine yolk sac cells and that its expression begins later within the midgestational fetal liver, i.e., sometime between days 13.5 and 14.5 of ontogeny, although at lower levels than detected in adult tissue. Expression pattern of Ram-1 in HSC-enriched populations. In addition to migration, development, and expansion of hematopoietic cells through the progression of ontogeny, the midgestational fetal liver, as any hematopoietic organ, contains a constant mix of cells at various stages of differentiation and maturation at any single time. Expansion of the primitive HSCcontaining population gives rise to a series of more differentiated progenitor populations that can be identified by their expression of specific cell surface antigens, as described previously (12, 14, 25, 27–30). We postulated that Ram-1 is differentially expressed at various stages during hematopoietic cell differentiation. To test this, we examined the level of Ram-1 expression in several populations enriched for early progenitor HSC activity. Using antibody staining and sorting of subpopulations enriched for HSC activity, from LIN2, the least HSCenriched, to LIN2 Thy1.22, LIN2 Thy1.2lo, LIN2 Thy1.2lo Sca2, and LIN2 Thy1.2lo Sca1 cells (each progressively more HSC-enriched), cells were identified from total day 14.5 FLC and collected by FACS sorting. Resultant poly(A)1 RNA from each of these subpopulations was reverse transcribed and used for RT-PCR with the designed Ram-1 primers. As expected from Fig. 1, a positive Ram-1 RT-PCR signal is seen in unfractionated FLC, while the appropriate controls, including yeast mRNA, are negative (Fig. 3). In addition, the 619-bp Ram-1 signal is observed in the LIN2 fraction but not in any of the more HSC-enriched fractions (Fig. 3). Increasing RTPCRs to 65 cycles produces the same results (data not shown). All samples are also positive for the expected 500-bp band when amplified with RT-PCR specific primers for b-actin as a control for the presence of adequate amounts of RNA (Fig. 3). Again, very low levels of Ram-1 mRNA production could result in amplification of an RT-PCR product that is undetect-

4243

able with ethidium bromide staining of an agarose gel. Thus, reactions were hybridized to a labelled probe to increase the sensitivity of Ram-1 detection. As initially observed, a Ram-1 fragment of expected size is observed in unfractionated and LIN-FLC populations (Fig. 4) but not in any of the highly enriched HSC subpopulations, i.e., LIN2 Thy1.2lo, LIN2 Thy1.2lo Sca2, and LIN2 Thy1.2lo Sca1 (Fig. 4). In addition, a slightly smaller uncharacterized band of approximately 500 to 550 bp is also observed hybridizing to the Ram-1 cDNA probe in the unfractionated FLC, LIN2, and LIN2 Thy1.22 populations (Fig. 4). Analysis of the Ram-1 cDNA sequence indicates that the 39 primer (RA1020) used for RT-PCR is 45% homologous to a Ram-1 cDNA internal sequence, TCTCCTTCGG CGTTGCCCTGC. RA1020 and this internal sequence have 100% homology of five bases at their 39 ends. The use of this internal site during the PCR would result in a 542-bp product, approximately the observed band size. Additional GenBank and EMBL database searches do not identify any other known murine sequences to which the designed Ram-1 primers would anneal. Although Ram-1 is a member of the phosphate transporter protein family, the RA1020 primer was specifically designed from a region of divergence between Ram-1 and other known family members. Because Ram-1 has only recently been cloned and the characterized sequence is derived from adult tissue, this smaller RT-PCR product could potentially reflect an alternatively spliced Ram-1 mRNA that is expressed earlier in development. To quantitate Ram-1 expression observed in the HSC-en-

FIG. 3. RT-PCR Ram-1 analysis of poly(A)1 RNA of HSC-enriched FLC subpopulations from FLC day 14.5. Cells were harvested, HSC-enriched subpopulations were sorted by staining with a panel of specific monoclonal antibodies and FACS sorting, and RT-PCR was performed. (Top) The top arrow at the left indicates the expected 1.2-kb band for control RNA amplified with primers provided with the Stratagene RT-PCR kit. The bottom arrow at the left indicates the expected band of 619 bp for the Ram-1 signal. Lanes 1 through 9 used Ram-1 specific primers. Lane 1, adult spleen; lane 2, total FLC; lane 3, LIN2 FLC; lane 4, LIN2 Thy1.22 FLC; lane 5, LIN2 Thy1.2lo FLC; lane 6, LIN2 Thy1.2lo Sca2 FLC; lane 7, LIN2 Thy1.2lo Sca1 FLC; lane 8, H2O; lane 9, 13 PCR buffer; lane 10, control RNA with control primers; lane 11, Phi X HaeIII marker. (Bottom) The top arrow at the left indicates the expected 1.2-kb band for control RNA amplified with primers provided with the Stratagene RT-PCR kit. The bottom arrow at the left indicates the expected band of approximately 500 bp for the b-actin signal. Lane 1, adult spleen; lane 2, total FLC; lane 3, LIN2 FLC; lane 4, LIN2 Thy1.22 FLC; lane 5, LIN2 Thy1.2lo FLC; lane 6, LIN2 Thy1.2lo Sca2 FLC; lane 7, LIN2 Thy1.2lo Sca1 FLC; lane 8, H2O; lane 9, b-actin cDNA; lane 10, control RNA with control primers; lane 11, Lambda HindIII marker.

4244

RICHARDSON AND BANK

FIG. 4. Ram-1 analysis of poly(A)1 RNA of HSC-enriched FLC subpopulations from day 14.5 FLC. Cells were harvested and HSC-enriched subpopulations were sorted by staining with a panel of specific monoclonal antibodies and FACS sorting. RT-PCR products were probed with a Ram-1 mRNA specific oligonucleotide purified from adult spleen cDNA. (Top) The upper arrow at the left indicates the expected band of 619 bp for the Ram-1 signal. The lower arrow at the right indicates the second uncharacterized band. Lane 1, total FLC; lane 2, LIN2 FLC; lane 3, LIN2 Thy1.22 FLC; lane 4, LIN2 Thy1.2lo FLC; lane 5, LIN2 Thy1.2lo Sca2 FLC; lane 6, LIN2 Thy1.2lo Sca1 FLC; lane 7, negative yeast control. (Bottom) Following PCR with b-actin specific primers, reactions were run on an agarose gel, transferred to a nylon filter, baked, and hybridized to a b-actin RT specific probe purified from adult spleen cDNA. The arrow at the left indicates the expected band of approximately 500 bp for the b-actin signal. Lane 1, total FLC; lane 2, LIN2 FLC; lane 3, LIN2 Thy1.22 FLC; lane 4, LIN2 Thy1.2lo FLC; lane 5, LIN2 Thy1.2lo Sca2 FLC; lane 6, LIN2 Thy1.2lo Sca1 FLC; lane 7, positive b-actin control.

riched hematopoietic populations, some PCRs were terminated after 20 cycles during the linear phase of amplification of the internal control b-actin, as described above. The resultant reactions were probed for Ram-1 or b-actin. Signal intensities were measured by PhosphorImager analysis. After normalization of b-actin signal intensities to arbitrary units, signals for Ram-1 were normalized to equivalent units (Table 2). The LIN2 population contains 4% the amount of Ram-1 mRNA as the unfractionated total; the LIN2 Thy1.22 population contains a detectable amount of Ram-1 that is less than 1% the amount of Ram-1 mRNA present in the unfractionated total. We conclude that Ram-1 is expressed in the greatest amounts in cells present within the unfractionated FLC population, and, to some extent, the LIN2 and LIN2 Thy1.22 subpopulations but not in any of the subsets highly enriched for HSC activity. The populations in which Ram-1 is detected are known to contain more differentiated cell types with a limited capacity for further expansion. By contrast, such cells are absent in the highly enriched fractions. Thus, RT-PCR data from both ontogenic development and hematopoietic differentiation indicate that expression of the Ram-1 phosphate transporter and amphotropic receptor is one of a larger repertoire of

MOL. CELL. BIOL.

proteins that are expressed only late in murine hematopoietic development and only in more differentiated hematopoietic cells in mouse fetal liver. Expression of Ram-1 in response to phosphate depletion. We were interested in the functionality of the Ram-1 mRNA detected in these studies. Others have reported that culture of rat fibroblasts in phosphate-free medium increases the amount of intracellular Ram-1 present (13). We measured the effect of phosphate deprivation on Ram-1 expression in day 14.5 FLC. Following 48 h in vitro in either normal or phosphate-free medium supplemented with IL-6 and SCF, cells were harvested and Ram-1 mRNA was analyzed by quantitative RTPCR, as described above. We have seen that under these conditions, there is no change in cell proliferation kinetics over 48 h in culture. An increased amount of Ram-1 is detected in cells cultured in phosphate-free medium compared with Ram-1 in cells cultured under normal conditions (Fig. 5). As a control, b-actin levels were also measured (Fig. 5). b-Actin levels are not significantly affected by phosphate deprivation, indicating that the increased level of Ram-1 is not part of a global effect on gene expression in cells under these culture conditions (Fig. 5). These results also indicate that the Ram-1 poly(A)1 mRNA observed just following onset of detectable expression in the developing fetal liver can be translated into protein capable of phosphate transport and is regulated by the levels of extracellular phosphates. Ability of Ram-1 to function as an amphotropic retroviral receptor during development. Despite detectable levels of Ram-1 poly(A)1 RNA in unfractionated day 14.5 FLC (Fig. 1 to 4) (26), these cells remain resistant to infection (transduction) by engineered amphotropic retroviruses (26). This resistance is specific to amphotropic retrovirus, since these cells are efficiently transduced by ecotropic retrovirus that utilizes a different surface receptor for entry into cells but otherwise follows the same pathway for complete infection. However, these previous findings could not distinguish among (i) a lack of sufficient but otherwise functional amount of Ram-1 protein present for viral recognition, (ii) expression at this early time of an alternative form of Ram-1 not capable of acting as a viral receptor, or (iii) some other block to amphotropic viral transduction, as observed by others with Chinese hamster ovary (CHO) cells (18). In order to determine the ability of Ram-1 to act as a functional amphotropic retroviral receptor, we examined the effect of phosphate deprivation and the observed upregulation of Ram-1 mRNA (Fig. 5) on amphotropic retroviral transduction of these cells. Day 14.5 FLC were incubated in vitro with IL-6 and SCF to stimulate cells into the cycle necessary for retroviral integration. The cells were then exposed to amphotropic

TABLE 2. Expression of Ram-1 in HSC-enriched subpopulations of day 14.5 FLC Signal intensitya HSC-enriched subpopulation

Total FLC LIN2 FLC LIN2 Thy1.22 LIN2 Thy1.2lo LIN2 Thy1.2lo Sca2 LIN2 Thy1.2lo Sca1

b-Actin

Ram-1

Ram-1 corrected

73 77 122 13 12 18

29 2 ,1 ,1 ,1 ,1

38 2 ,1 ,1 ,1 ,1

% Total FLC expression

100 4 ,2 ,2 ,2 ,2

a b-Actin signal intensities were normalized to arbitrary units. Ram-1 signals were normalized for b-actin (Ram-1 corrected). Signals below 2 were determined to be not above background.

VOL. 16, 1996


FIG. 5. Effect of phosphate deprivation on Ram-1 expression in day 14.5 FLC. (A) The arrow at the left indicates the expected 619-bp band for the Ram-1 mRNA. P1 indicates Ram-1 in cells incubated under normal conditions. P2 indicates Ram-1 in cells incubated in phosphate-free medium. (B) The arrow at the left indicates the expected 500-bp band for the b-actin message. P1, b-actin in cells incubated under normal conditions; P2, b-actin in cells incubated in phosphate-free medium.

retrovirus containing MDR cDNA (33). Both prestimulation and retroviral transduction were carried out in either normal or phosphate-free medium. Following exposure to retrovirus, DNA was prepared from cells and PCR was performed with primers specific for the MDR cDNA (21) to assess the efficiency of gene transfer and, thus, retroviral transduction, under these conditions. We have previously demonstrated that these primers do not cross-react with any endogenous murine MDRrelated genomic sequences (23, 26). As expected from our previous studies, no signal is seen for MDR following amphotropic transduction under normal conditions (Fig. 6). By contrast, exposure to amphotropic retrovirus in phosphate-free medium results in a positive MDR-PCR signal, indicating successful gene transfer and retroviral transduction (Fig. 6). As a control, cells were also exposed to ecotropic retrovirus containing the MDR cDNA; these cells give a positive MDR signal when transduced both with and without extracellular phosphates present (Fig. 6). These data indicate that at least some of the detected Ram-1 mRNA in FLC at day 14.5 is translated into protein which is capable of acting as an amphotropic retroviral receptor. These data also demonstrate that the normal resistance of these cells to amphotropic transduction is most likely due to an insufficient number of Ram-1 molecules on the cell surface for efficient levels of retroviral recognition and binding and that upregulation of Ram-1 receptors by phosphate deprivation can reverse the effect of this deficiency.

4245

sensitivity of RT-PCR makes it possible that the positive signal observed in total day 14.5 and day 15.5 FLC could be due to a small population of cells, calculated to be as little as 0.5% of cells if all the cells expressing Ram-1 contain an equal level of Ram-1 (26). These cells could be a population of contaminating nonhematopoietic cells in the FLC suspension, i.e. hepatocytes. However, purification of HSC-enriched populations involved FACS sorting, including gating on size and morphology characteristic of hematopoietic cells. Because some detectable level of Ram-1 expression is observed in the manipulated LIN2 progenitor populations, it is unlikely that the positive signal is due to hepatocyte contamination. Analysis of Ram-1 mRNA in the HSC-enriched subpopulations indicates a greatly reduced amount of mRNA in precursor cells and an undetectable level in earlier progenitor cells. From these results, we can infer that Ram-1 activity is a marker both of cells late in hematopoietic development and of more differentiated hematopoietic cells in mouse fetal liver. There are a number of other activities associated with adult hematopoiesis which do not appear until after day 15.5 of development as well. The rearrangement of the immunoglobulin gene segments is not initiated until hematopoietic cells have seeded the fetal liver. In the rearranged immunoglobulins present in fetal liver, a single D gene segment is used in more than 50% of the DJH junctions, indicating that the fetal repertoire is restricted in its antigen binding potential (3). Other studies show a lack of class II major histocompatibility antigens on midgestational macrophages (5, 24). Further, macrophages derived from midgestational liver and placenta display a deficit in their ability to present antigens to T cells, and Chang et al. suggest that this may be due to an alteration in the antigenprocessing pathway at this time during development (2). Experiments in both mouse and human systems have indicated that HSC from fetal sources exhibit greater developmental potential than do those from adult tissues (7, 8). Fetal HSC-

DISCUSSION These studies were designed to examine the expression of Ram-1 in developing hematopoietic populations that may have implications for both retroviral gene transfer into and phosphate regulating mechanisms of developing hematopoietic cells. The data presented here clearly demonstrate that the expression of Ram-1 is developmentally regulated and that Ram-1 is one of a larger repertoire of proteins that are expressed only late in mouse hematopoietic development. Ram-1 expression is completely absent in early hematopoietic yolk sac cells and then appears later in the midgestational fetal liver sometime between days 13.5 and 14.5 of development. The

FIG. 6. Effect of phosphate deprivation on amphotropic retroviral transduction of day 14.5 FLC. The arrow at the left indicates the expected 167-bp band of the MDR cDNA following PCR of DNA from FLC exposed to MDRcontaining retrovirus either with or without phosphates present. 1P, cells transduced under normal conditions; 2P, cells transduced in the phosphate-free medium; Ampho, cells exposed to amphotropic type MDR-containing retrovirus; Eco, cells exposed to ecotropic type MDR-containing retrovirus used as a positive control.

4246

RICHARDSON AND BANK

enriched populations have the potential to differentiate into fetal gd T cells, while similarly enriched adult bone marrow cells do not, even when placed in the fetal thymic microenvironment (8). CD51 pre-B cells of newborn mice are present in the liver and spleen, but these progenitors are rarely in the bone marrow of adult mice. By contrast, CD51 mature B cells are not observed in the spleen, minimally in lymph nodes, and predominantly in the peritoneal cavity. Thus, CD51 B cells may belong to a separate developmental stage than other B cells (6). Taken together, these data suggest that at least some fetal cells possess a developmental repertoire different from adult cell types. Further, it has been postulated that individual HSC age through development as well as during the lifetime of an animal, losing some of their developmental potential (9). Our data that Ram-1 expression appears only late in hematopoietic development and differentiation may be a reflection of this developmental process. The effects of phosphate deprivation on functional Ram-1 expression as demonstrated here support the previous suggestion that Ram-1 is a contributor to the regulation of cellular phosphate levels (13). There is evidence that low phosphate causes an increase in expression of Ram-1 and the related phosphate transporter Glvr-1 (13). Tissue distribution of each receptor observed in the rat indicates that some tissues may express these two related phosphate transporters in a reciprocal fashion. While Ram-1 appeared to be the major phosphate transporter in heart, little Glvr-1 expression was observed (13). By contrast, high levels of Glvr-1 were seen in marrow and thymus where lower amounts of Ram-1 were seen (13). Data in a second study of mouse tissue distribution of Glvr-1 provided support for the rat data, but indicated that long exposure times allowed detection of Glvr-1 RNA in all tissues examined (10). Analysis of Glvr-1 expression during rat embryogenesis revealed moderate levels of Glvr-1 RNA in day 8 whole embryos and abundant levels in day 10 whole embryos (10). On the basis of these previous findings, it would be of interest to examine the level of Glvr-1 present in FLC at this time. It is somewhat surprising that a depletion of phosphates from the medium should lead to improved amphotropic retroviral transduction. In addition, phosphate depletion does not noticeably affect ecotropic transduction. The absence of phosphate required for DNA synthesis should inhibit the process of stable transduction of target cells which requires cell cycling. In these experiments some phosphate stores may have been within the FLC initially at harvest and thus remained available to the cells despite a lack of extracellular phosphate. Analysis of transduced cells was performed 48 h after the initial harvest, which would only be approximately two cell divisions, i.e., perhaps not enough to deplete phosphate stores within the cell at the initial harvest time. It is also possible that sufficient residual amounts of phosphate remain in the medium following its depletion. One or both of these possibilities is apparently sufficient to support some cell division that results in the retroviral transduction of enough cells to detect by PCR. We have previously demonstrated that hematopoietic FLC from day 14.5 of ontogeny contain some detectable expression of Ram-1 poly(A)1 RNA but remain resistant to amphotropic retroviral transduction in standard culture conditions. By contrast, ecotropic retroviral transduction occurs efficiently under these conditions. Since the intracellular steps are identical for ecotropic and amphotropic viral transduction, the most likely block to amphotropic transduction is at the membrane, the site of retroviral recognition by Ram-1 protein. In addition, because the PCRs were performed directly after exposure to viral supernatants and were negative, it is unlikely that viral particles penetrated the cell membranes to reverse transcribe their

MOL. CELL. BIOL.

RNA. The normal resistance by FLC to amphotropic retroviral transduction is most likely due to an insufficient level of expression of Ram-1 in developmentally early FLC, as opposed to adult bone marrow cells, since upregulation of the receptor is correlated with detectable transduction of these cells. This possibility is also supported by gene transfer studies in other animal models. For example, amphotropic retroviruses transduce primate hematopoietic progenitor populations with low efficiency compared with more differentiated cells (31). Both the upregulation of Ram-1 in response to phosphate depletion and its ability to act as an amphotropic retroviral receptor indicate that the Ram-1 mRNA detected in FLC at day 14.5 is a full-length fully functional protein and not an alternative form, defective in one or both of these activities. Alternatively, it is possible that the resistance to infection of murine FLC at day 14.5 and day 15.5 is due to some blocking mechanism that is also affected by the change in intracellular phosphate levels. CHO cells are also resistant to amphotropic transduction, although a few variants deficient in glycosylation have been isolated that are transducible (18). CHO cells express amphotropic retrovirus receptors, but these receptors are blocked by a second uncharacterized factor secreted by hamster cells. The identity of this factor remains unknown, but it is secreted by a number of hamster cell types and is present in hamster serum (18, 19). Regulation of this factor may also be linked to phosphate levels and would give results similar to those we observed, although such a regulatory pathway would still indirectly link the regulation of Ram-1 to the efficiency of amphotropic transduction. Certain other hematopoietic cell types are also resistant to high levels of infection with amphotropic retroviruses, notably HSC-enriched populations of human bone marrow (31). It is unclear whether this inefficiency is due to the inability of retrovirus to infect nondividing cells or modulation of appropriate Ram-1 expression in these developmentally early cells. Thus, the amount of functional Ram-1 protein, and its human homolog GLVR-2, present on the surface of certain hematopoietic cells has implications for predicting the efficiency of amphotropic retroviral gene transfer into them. Current interest in the use of developmentally early cell populations, such as human CD341 cells, for gene transfer and therapy increases the need for understanding the regulation of expression of amphotropic receptor proteins in different progenitor populations. The data presented here may have important implications for human gene transfer studies which will require the use of HSC-enriched populations, especially because the RTPCR data indicate that Ram-1 is normally expressed only in more differentiated hematopoietic cell types. It is possible that a similar transduction protocol with phosphate-free medium may be used with human CD341 progenitor cells to enhance gene transfer into these cells for use with human gene therapy. ACKNOWLEDGMENTS This work was supported by Public Health Service grants from the National Institutes of Health (DK-25274, HL-28381, and HL-48345). REFERENCES 1. Aihara, M., Y. Aihara, G. Schmidt-Wolf, I. Schmidt-Wolf, B. I. Sikic, K. G. Blume, and N. J. Chao. 1991. A combined approach for purging multidrugresistant leukemic cell lines in bone marrow using a monoclonal antibody and chemotherapy. Blood 77:2079–2084. 2. Chang, M. Y., J. W. Pollard, H. Khalili, S. M. Goyert, and B. Diamond. 1993. Mouse placental macrophages have a decreased ability to present antigen. Proc. Natl. Acad. Sci. USA 90:462–466. 3. Chang, Y., C. J. Paige, and G. E. Wu. 1992. Enumeration and characterization of DJH structures in mouse fetal liver. EMBO J. 11:1891–1899. 4. Forrester, L., A. Berstein, J. Rossant, and A. Nagy. 1991. Long term reconstitution of the mouse hematopoietic system by embryonic stem cell derived

VOL. 16, 1996


fetal liver. Proc. Natl. Acad. Sci. USA 88:7514–7517. 5. Head, J., B. Drake, and F. Zukerman. 1987. Major histocompatibility antigens on trophoblast and their regulation: implications in the maternal-fetal relationship. Am. J. Reprod. Immunol. Microbiol. 15:12–20. 6. Herzenberg, L. A., A. M. Stall, P. A. Lalor, C. Sidman, W. A. Moore, D. R. Parks, and L. A. Herzenberg. 1986. The Ly-1 B cell lineage. Immunol. Rev. 93:81–102. 7. Huang, S., and L. W. M. M. Terstappen. 1992. Formation of hematopoietic microenvironment and haematopoietic stem cells from single human bone marrow stem cells. Nature (London) 360:745–749. 8. Ikuta, K., T. Kina, I. MacNeil, N. Uchida, B. Peault, Y. Chien, and I. L. Weissman. 1990. A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells. Cell 62:863–874. 9. Ikuta, K., and Y. Komagata. 1995. Developmental potential of fetal hematopoietic stem cells, p. 69–83. In D. Levitt and R. Mertelsmann (ed.), Hematopoietic stem cells: biology and therapeutic applications. Marcel Dekker, New York. 10. Johann, S. V., J. J. Gibbons, and B. O’Hara. 1992. GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus. J. Virol. 66:1635–1640. 11. Johnson, G., and M. S. Moore. 1975. Role of stem cell migration in initiation of mouse foetal liver haemopoiesis. Nature (London) 258:726–728. 12. Jordan, C. T., J. P. McKearn, and I. R. Lemischka. 1990. Cellular and developmental properties of fetal hematopoietic stem cells. Cell 61:953–963. 13. Kavanaugh, M. P., D. G. Miller, W. Zhang, W. Law, S. L. Kozak, D. Kabat, and A. D. Miller. 1994. Cell-surface receptors for gibbon ape leukemia virus and amphotropic murine retrovirus are inducible sodium-dependent phosphate symporters. Proc. Natl. Acad. Sci. USA 91:7071–7075. 14. Li, C. L., and G. R. Johnson. 1992. Long-term hematopoietic repopulation by the Thy1-lo, Lin2, Ly6A/E1 cells. Exp. Hematol. 20:1309–1315. 15. Markowitz, D., S. Goff, and A. Bank. 1988. Construction and use of a safe and efficient amphotropic packaging cell line. Virology 167:400–405. 16. Markowitz, D., S. Goff, and A. Bank. 1988. A safe packaging line for gene transfer: separating viral genes on two different plasmids. J. Virol. 62:1120– 1125. 17. Metcalf, D., and M. S. Moore. 1971. Embryonic aspects of haemopoiesis, p. 172–271. In D. Metcalf and M. Moore (ed.), Haemopoietic cells. NorthHolland, Amsterdam. 18. Miller, D. G., R. H. Edwards, and A. D. Miller. 1994. Cloning of the cellular receptor for amphotropic murine retroviruses reveals homology to that for gibbon ape leukemia virus. Proc. Natl. Acad. Sci. USA 91:78–82. 19. Miller, D. G., and A. D. Miller. 1993. Inhibitors of retrovirus infection are secreted by several hamster cell lines and are also present in hamster sera. J. Virol. 67:5346–5352. 20. Moore, M. S., and D. Metcalf. 1970. Ontogeny of the haemopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br. J. Haematol. 18:279–296. 21. Noonan, K. E., C. Beck, T. A. Holzmayer, J. E. Chin, J. S. Wunder, I. L.

22.

23.

24. 25. 26. 27. 28. 29. 30.

31.

32.

33. 34. 35.

4247

Andrulis, A. F. Gazdar, C. L. Willman, B. Griffith, D. D. Von Hoff, and I. Roninson. 1990. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87:7160–7164. Pastan, I., M. M. Gottesman, K. Ueda, E. Lovelace, A. Rotherford, and M. Willingham. 1988. A retrovirus carrying an MDR cDNA confers multidrug resistance and polarized expression of P-glycoprotein. Proc. Natl. Acad. Sci. USA 85:4486–4490. Podda, S., M. Ward, A. Himelstein, C. Richardson, E. de la Flor-Weiss, L. Smith, M. Gottesman, I. Pastan, and A. Bank. 1992. Transfer and expression of the human multiple drug resistance gene into live mice. Proc. Natl. Acad. Sci. USA 89:9676–9680. Redline, R., and C. Lu. 1961. Localization of fetal major histocompatibility complex antigens and maternal-fetal immunological relationship. Lab. Invest. 61:27–33. Richardson, C., and A. Bank. 1995. Preselection of transduced murine hematopoietic stem cell populations leads to increased long-term stability and expression of the human multiple drug resistance gene. Blood 86:2579–2589. Richardson, C., M. Ward, S. Podda, and A. Bank. 1994. Mouse fetal liver cells lack functional amphotropic retroviral receptors. Blood 84:433–439. Spangrude, G. J., S. Heimfeld, and I. L. Weissman. 1988. Purification and characterization of mouse hematopoietic stem cells. Science 241:58–62. Spangrude, G. J., and G. R. Johnson. 1990. Resting and activated subsets of mouse multipotent hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 87:7433–7437. Szilvassy, S. J., and S. Cory. 1993. Phenotypic and functional characterization of competitive long-term repopulating hematopoietic stem cells enriched from 5-fluorouracil treated murine marrow. Blood 9:2310–2317. Szilvassy, S. J., P. Lansdorp, K. Humphries, A. Eaves, and C. J. Eaves. 1989. Isolation in a single step of a highly enriched murine hematopoietic stem cell population with competitive long-term repopulating ability. Blood 74:930– 939. Van Beusechem, V., T. Bakx, L. Kaptein, J. Bart-Baumeister, A. Kukler, E. Braakman, and D. Valerio. 1994. Retrovirus-mediated gene transfer into rhesus monkey hematopoietic stem cells: the effect of viral titers on transduction efficiency. Hum. Gene Ther. 4:239–247. Van Zeijl, M., S. V. Johann, E. Closs, J. Cunningham, R. Eddy, T. Shows, and B. O’Hara. 1994. A human amphotropic retrovirus receptor is a second member of the gibbon ape leukemia virus receptor family. Proc. Natl. Acad. Sci. USA 91:1168–1172. Ward, M., C. Richardson, P. Pioli, L. Smith, S. Podda, S. Goff, C. Hesdorffer, and A. Bank. 1994. Transfer and expression of the human multiple drug resistance gene in human CD341 cells. Blood 84:1408–1414. Wigler, M., A. Pellicer, S. Silverstein, R. Axel, G. Urland, and L. Chasin. 1979. DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells. Proc. Natl. Acad. Sci. USA 76:1373–1376. Wong, P. M. C., S. W. Chung, D. H. K. Chui, and C. J. Eaves. 1986. Properties of the earliest clonogenic hemopoietic precursors to appear in the developing murine yolk sac. Proc. Natl. Acad. Sci. USA 83:3851–3854.