Editors
Developments in Science and Engineering
St. Kliment Ohridski University Press, Sofia
Developments in Science and Engineering
Recep Efe, Lia Matchavariani Abdulkadir Yaldir, László Lévai
St. Kliment Ohridski University Press, Sofia
Developments in Science and Engineering
Editors Recep Efe Lia Matchavariani Abdulkadir Yaldır László Lévai
ISBN 978-954-07-4137-6
ST. KLIMENT OHRIDSKI UNIVERSITY PRESS SOFIA 2016
Editors Prof. Dr. Recep Efe Balikesir University Faculty of Arts and Sciences Department of Geography Balıkesir, Turkey
Prof. Dr. Lia Matchavariani Ivane Javakhishvili Tbilisi State University, Faculty of Exact & Natural Sciences Tbilisi, Georgia
Assist. Prof. Dr. Abdulkadir Yaldır Pamukkale University Faculty of Economics & Administrative Sciences, Department of Management Information Systems Denizli, Turkey
Prof. Dr. László Lévai University of Debrecen Department of Agricultural Botany and Crop Physiology Debrecen, Hungary
St. Kliment Ohridski University Press Sofia, Bulgaria ISBN 978-954-07-4137-6
The contents of chapters/papers are the sole responsibility of the authors, and publication shall not imply the concurrence of the Editors or Publisher. © 2016 Recep Efe All rights reserved. No part of this book may be reproduced, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without prior permission of the editors and authors Cover design: Murat Poyraz ii
CONTENTS Chapter 1 ............................................................................................................................... 1 Current Challenges and Issues to Agricultural Land-Use Planning in Bulgaria Milena Dimitrova MOTEVA Chapter 2 ............................................................................................................................. 20 The Effects of 1/3 Cluster Tip Reduction and Foliar Fertilizer Applications on Yield and Quality of Alphonse Lavallée (Vitis vinifera L.) Grape Cultivar Aydın AKIN, Tuğrul KARAĞÜL Chapter 3 ............................................................................................................................. 29 Determination of in vitro Plantlet Formation Potential of Some Terrestrial Orchid Species Arzu ÇIĞ, Hüdai YILMAZ Chapter 4 ............................................................................................................................. 40 Evaluation of Association between Morphological Traits and Geographic Characters in Relict Endemic Dorystoechas hastata Ceren SELİM, Songül SEVER MUTLU Chapter 5 ............................................................................................................................. 49 Artificial Neural Network Applications for Biological Systems: The Case Study of Pseudorasbora parva Semra BENZER, Recep BENZER, Ali GÜL Chapter 6 ............................................................................................................................. 59 A Comparative Analysis of Resource-Use Efficiency in Conventional and Organic Raisin Production in Turkey Bülent MİRAN, Ela ATIŞ, Zerrin K. BEKTAŞ, Cihat GÜNDEN, Ece SALALI, Kenan ÇİFTÇİ Chapter 7 ............................................................................................................................. 70 Whole Grain Cereal Technology Emine Nur HERKEN, Aysun YURDUNUSEVEN YILDIZ Chapter 8 ............................................................................................................................. 90 Short-Cut Biological Nitrogen Removal via Nitrite with Simultaneous Anaerobic Ammonium Oxidation and Denitritation Using Mixed Cultures of Activated Sludge Bacteria Dilek ERDIRENÇELEBI, Fulya BIZDEN, Murat KÜÇÜKHEMEK Chapter 9 ........................................................................................................................... 103 Importance of Soil Enzymes Application in Forestry İnci Sevinç KRAVKAZ KUŞÇU, M. Ömer KARAÖZ Chapter 10 ......................................................................................................................... 113 Micromorphological Studies on Plants and Their Importance Nurcan YIGIT Chapter 11 ......................................................................................................................... 125 Environmentally Friendly Alternative Pulp and Paper Technologies Halil Turgut ŞAHİN
iii
Chapter 12 ......................................................................................................................... 146 Short Cut Biological Nitrogen Removal: A Review on Current Applications Dilek ERDIRENÇELEBI Chapter 13 ......................................................................................................................... 160 Place of Tobacco Plant in Biotechnology and its Possible Effects On the Environment Meltem SESLİ, E. Dilşat YEĞENOĞLU Chapter 14 ......................................................................................................................... 172 Bullying in Turkish Forestry Organization from 2010 to 2015 Mahmut Muhammet BAYRAMOĞLU, Devlet TOKSOY Chapter 15 ......................................................................................................................... 181 The Effect of Climate Changes on Agricultural Production E. Dilşat YEĞENOĞLU, Meltem SESLİ Chapter 16 ......................................................................................................................... 189 The Potential Distribution of Darevskia derjugini (Nikolsky, 1898) with New Locality Records from Turkey Muammer KURNAZ, Serkan GÜL, Ufuk BÜLBÜL, Bilal KUTRUP Chapter 17 ......................................................................................................................... 196 Nonlinear Observer Design for Biological Systems: A Case Study for Neuronal Models Meriç ÇETİN, Selami BEYHAN Chapter 18 ......................................................................................................................... 213 Evaluation of A Few Soft Computing Methods on Some Educational and Biomedical Datasets Emre ÇOMAK, Gökhan UÇKAN Chapter 19 ......................................................................................................................... 225 Efforts on Improving the Quality of Gluten-Free Products Emine Nur HERKEN, Aslı YILDIRIM Chapter 20 ......................................................................................................................... 244 Innovative Nitrogen Removal Processes in Water Treatment Yakup CUCİ, Dilek AKMAN, Kevser CIRIK Chapter 21 ......................................................................................................................... 262 Analyzing the Factors That Affect the Synchronous Reluctance Motor Torque (SynRM) Yusuf ÖNER, Metin ERSÖZ, Okan BİNGÖL Chapter 22 ......................................................................................................................... 288 Thermodynamic Analysis of the Power Unit for Ro-Ro Cargo Vessel with Respect to Pitch Angles of Propeller Blades Serdar KARACA, Betül SARAÇ, Erhan AKSU Chapter 23 ......................................................................................................................... 300 Design Criteria of Ground Mounted Photovoltaic Power Plants: A Sample for 441.60 kW Power Plant Engin ÇETİN, Ahmet YILANCI iv
Chapter 24 ......................................................................................................................... 313 The Importance of 5S in Total Productive Maintenance Activities Derya SEVIM KORKUT, Küçük Hüseyin KOÇ Chapter 25 ......................................................................................................................... 327 Researches of Failure Inspection Robots for Energy Transmission Line Atıl Emre COŞGUN, Hasan DEMİR, Filiz SARI, Yunus UZUN Chapter 26 ......................................................................................................................... 337 Biogas Based Fuel Cell Technologies: Prospects and Challenges Ahmet YILANCI, Engin CETIN Chapter 27 ......................................................................................................................... 348 Computer Aided Performance Analyses of a Jeotermal/Solar Hybrid Energy System Gökhan UÇKAN, Emre ÇOMAK Chapter 28 ......................................................................................................................... 359 Digital Age and Business Intelligence Eyüp AKÇETİN, Abdulkadir YALDIR Chapter 29 ......................................................................................................................... 379 A Programming Study on Optimal Finding of Tandem Repeat DNA Sequences Abdulkadir YALDIR, Onur İNAN Chapter 30 ......................................................................................................................... 391 Electric Machinery Design With Finite Elements Method Yusuf ÖNER, Metin ERSÖZ, Oğuzhan KEÇECİ, Veysi ARSLAN Chapter 31 ......................................................................................................................... 411 Characterizations of Matrix Transformations on the Series Spaces Derived by Absolute Factorable Summability Güllü Canan HAZAR, Fadime GÖKÇE Chapter 32 ......................................................................................................................... 427 On Geometry of Quaternions Serpil HALICI, Şule ÇÜRÜK Chapter 33 ......................................................................................................................... 435 Fragmentation in the Macro-Urban Form and Natural Thresholds of a Delta and Riverfront City in Anatolia: Case of Silifke Nilgün Çolpan ERKAN, Cenk HAMAMCIOĞLU Chapter 34 ......................................................................................................................... 455 The “Strange” Earthquakes and Seismic Sources – Possible Explanations Boyko Kirilov RANGUELOV Chapter 35 ......................................................................................................................... 475 The Study of Urban Form in Middle Eastern Cities Mert Nezih RİFAİOĞLU Chapter 36 ......................................................................................................................... 486 Structural Analysis of Kayseri’s Historical Bazaar During the Ottoman Period Suat ÇABUK
v
Chapter 37 ......................................................................................................................... 498 Comparative Bulgaria Houses and Traditional Ottoman Period Houses Within the Context of Common History, Culture and Identity in Bulgaria Aydanur YENEL Chapter 38 ......................................................................................................................... 544 Design With Flexible Functions: A Trial in Kayseri Kemal DEMİR Chapter 39 ......................................................................................................................... 555 Adaptive Building Shells Ahmet Vefa ORHON Chapter 40 ......................................................................................................................... 568 Planning for Livable Cities Ümmügülsüm TER, Sevde DERMAN, Mete ADIGÜZEL Chapter 41 ......................................................................................................................... 582 Buildings After Republic in Balıkesir City Center Timur KAPROL Chapter 42 ......................................................................................................................... 588 Interior Finishing Materials Gülru KOCA Chapter 43 ......................................................................................................................... 601 Green Building Rating Systems in Sustainable Architecture Müjde ALTIN Chapter 44 ......................................................................................................................... 612 The Physical Environment Changing of Kars City After the 93 War Şebnem ERTAŞ Chapter 45 ......................................................................................................................... 625 Implementing Sustainability in Higher Education Via Student Architectural Design Competitions in Turkey Ayça TOKUÇ, Ebru GÜLLER Chapter 46 ......................................................................................................................... 636 Spatial Development Pattern of High-Income Housing Areas in Istanbul Özgül ACAR ÖZLER, Tayfun SALİHOĞLU Chapter 47 ......................................................................................................................... 648 Examples of Vernacular Processing Structures in Anatolia Hacer MUTLU DANACI Chapter 48 ......................................................................................................................... 656 The Physical Analysis and Transformation of Minority Settlements: The Case of Zafer Neighborhood in Burdur Seda ŞİMŞEK TOLACI, Ş. Gülin BEYHAN Chapter 49 ......................................................................................................................... 677 Model As a Means of Expression in Architecture Meltem ÖZÇAKI
vi
Chapter 50 ......................................................................................................................... 695 Determining Seasonal Variation Effects on Visitor Preferences “The Case of Royal Botanic Garden Edinburgh” Banu KARAŞAH, Mustafa VAR Chapter 51 ......................................................................................................................... 710 People Oriented Planning: The Walkable City Ümmügülsüm TER, Mete ADIGÜZE, Sevde DERMAN Chapter 52 ......................................................................................................................... 727 Re-Usage in Historical Buildings: The Case of Salt Galata Elif SÖNMEZ Chapter 53 ......................................................................................................................... 744 Design Process and Communication in Interior Architecture Eda BALABAN VAROL Chapter 54 ......................................................................................................................... 757 How Do Residents Evaluate Student Housing? A Home or a Hostel Ebru ÇUBUKÇU, Malike ÖZSOY
vii
Chapter 1 Current Challenges and Issues to Agricultural Land-Use Planning in Bulgaria Milena Dimitrova MOTEVA* 1. INTRODUCTION Land is invaluable wealth of the Planet. Land resources are the eternal natural conditions for life of all beings. For man, they act as a natural life environment, a source for his livelihood but also as the material source for his activities. Since land resources are limited, one of the most important man’s responsibilities is to control the impact of his actions on land, to keep the nature balance in order to provide for the best life quality for the future generations. The idea of land management has occurred still from antiquity under the need of regulation of land relationships among people who cultivated certain areas. Nowadays, in the conditions of a complicated economy branch structure and multi-purpose use of land, a priority motivation for applying land management is to keep the natural features of land and the environment. The idea of sustainable land management is the guiding idea of land-use planning in the contemporary developed world. Land-use planning has been practiced for centuries for social reasons. Nowadays, land-use planning has its social and economic reasons. There are three main reasons for paying special attention to agricultural land-use planning – first, social – ensuring living space for the growing population, second – economic – ensuring the livelihood, and third – environmental – saving nature and the resources of the planet from depletion and degradation. For these reasons arises the need in proper governance of the land resources, in protection of land tenure and preservation of the environment. In many countries are elaborated strict regulations for land management as a comprehensive and optimizing activity for land use organization but it meets a lot of difficulties. The least reason that land management cannot be completed and optimized is the dynamics in the social development. Other reasons are connected with the consumptive attitude of the modern humans to the environment and the surrounding world. As a result, a lot of deficiencies in land management hinder the sustainable use of land resources – difficult control on the urban sprawl, soil contamination by industrial production, exhaustion of soil fertility in the agricultural territories due to applying bad agricultural practices, etc. Overcoming of the deficiencies in the management of the agricultural territories has the following issues like: induction of the whole potential of the agricultural territories, development of a competitive agriculture, guarantee of food security, provision of comparable with other production sectors income and employment – all this subordinate to the issue of preservation of the natural resources. An essential tool for achieving these goals is land-use planning for the agricultural territories. It provides for optimum *
Assoc. Prof. Dr., University of Architecture, Civil Engineering and Geodesy, Faculty of Geodesy, Department of Land Management and Agricultural Development-1046 Sofia, Bulgaria
territorial conditions and for synchronization with the current priorities of the sustainable development. As to Volkov (2001) agricultural land-use planning is a system of technical and economic events that streamlines and optimizes land use according to the factors of the environment and to the industrial, economic and social conditions. He considers it a continuum that follows the development of the socioeconomic processes. The scientific basis of land-use planning from the times of the state planned economy is written down in several monographies (Cheremushin, Udachin, 1950; Valchanov, 1954; Vuchkov, 1985; Michev, 1988). By means of land-use planning, the socialist state “regulated” the imaginary of that time land relationships. Actually, its goal was to keeping the inviolability and the integrity of the state and the municipal land. It was dedicated to creating conditions for intensification of the agricultural and other kinds of production. Land use was treated regionally, without addressing it to the global environmental problems of the planet and without taking into account the real engine of the economic progress - private property and market competition. By following the socio-economic changes in our country, the agricultural production became a part of market economy. This created new conditions and new objectives of land management and land-use planning. The definitions and the conceptions of land management and land-use planning are different from those consistent with the state-planned economy. They have to be adequate to the new criteria and new needs of society. The new society system acted for diversity of land ownership, for free management of own land, for turning land into a commodity and for establishing land market relations. Land-use planning nowadays serves the objectives of protection of the rights on land tenure, regulation of land relationships, soil conservation, environmental protection, economic prosperity of the farms. Land use in Bulgaria today suffers of a lot of problems of design, technological and environmental character. The period of Transition to the normal type of economy could not bring land management to its normal functions. There is lack of an effective field road network and updated modern machinery park; the irrigation infrastructure destroyed; application of protective environmental measures is limited use, etc. What is more – there is lack of appropriate legislation for regulation of these activities addressed to the agricultural territories. The contemporary planning and strategic documents for the development of the Municipalities (LAU) reveal the necessity of agricultural landuse planning. In their chapters on agriculture they refer to "land-regulation projects" or "land-use plans". However, in the contemporary LAU Master Plans and of the municipal centers, there are no suggestions for the structure of the agricultural areas. The only legal text concerning agricultural land-use planning is found in the Law on Spatial Planning (last amended OG, 15/23 Febr. 2016). The agricultural land-use plans refer to Art. 111 as "specialized detailed plans” that solve specific development problems and cover structural parts of the municipality region".The recent National Development Programme: Bulgaria 2020 sets out measures for a complex landmanagement approach. Present Bulgarian agriculture is characteristic for dualistic structure It consists of wholesale and retail farms, both non-viable and inefficient (Kaneva et al., 2016). Further, the development of sustainable forms of land tenure is not guaranteed; there is no binding legal framework to ensure land use in the agricultural territories for agricultural purposes only, to work for attracting investments, and for obtaining civic 2
and public benefits; the detailed plans for the agricultural territories are not a compulsory element of the Master Plans and still are not required and developed; although an overall strategic framework for protection of the national environment already exists, there are no actual strategies and programs for protection of the soils as a natural resource; there is lack of institutional coordination, particular legal measures and clearly defined financial resources for a long-term effective sustainable management of the land resources. In this situation, there is the need in: - firstly, to study and assess the complexity of the social processes in land tenure and farmland preservation; - secondly, to become aware of the need to reconcile the private interests with the criteria of the modern land use and its subordination to the public interest; - thirdly, to update the theory and legislation in the field of land-use planning according to the rules of market economy; - finally, to elaborate a comprehensive approach that is a subject of complex legal, economic, technical and technological approaches to structuring the agricultural areas in order to ensure sustainable land management and production. The ongoing transition process generally includes not only the internal economic transformation but also work on the external adaptability to the world and to the European economic structures (Spasov, 2006). It is important for the agricultural landuse planning in the transforming society is important to observe not only the national targets (as it was in the past) but to become a part of the global technological progress and the global localization of the resources. It is essential to adopt a new theoretical concept of the essence, objectives and pathways of the agricultural land-use planning as part of the deep process of economic change – agricultural land-use planning that sights a new technological profile of production, an increasing productivity and an accretiveincome level. The goal of this chapter is to analyze the new conditions and circumstances for the agricultural land-use planning in the new socio-economic conditions in Bulgaria and to trace some ways and principles of an integrated approach to it, concerning the agricultural territories. 2. MATERIAL AND METHODS 2.1. Study Area and Background The area of the study is the agricultural territory of Bulgaria. Around 70% of the national land area has a potential for agricultural production. The Agricultural Census in 2010 showed that the agricultural area comprises 58.29%, i.e. 6.42 mil ha of the surface area of the country, (MAF, 2012). Presently, the agricultural use of land in Bulgaria is traditional. Field cropping areas have the greatest share in the agricultural territories 50% of it is sawn with cereals and 30% - with industrial crops, only 10% - with fruits and vegetables, regardless of the specific soil and climate conditions that allow this production to be of highly qualitative value. Bulgarian soils are peculiar for medium to high fertility and high resilience to negative impacts (Blum, 2014). The degradation processes are not so widely spread. The sustainability of the agricultural production is prone to climate change. The results from climate scenarios (http://meteo.bg/) provide for future climate warming and drought, hence irrigation practices will be increasingly vital for agriculture. Due to lack of proper agricultural policy, the structure of the 3
agricultural production is unfavorable for the economy and the share of agriculture in GDP is around 5.1% (for 2015) (Tsoneva, 2001; NSI, 2015) For the entire period of socio-economic transformation, agriculture in Bulgaria has been developing spontaneously, without clear and reasonable state strategy for it (Popov, Ivanov, 2012). As to the investigators, the Agrarian Reform was performed in an adverse, spontaneous and incompetent way and rather by political considerations than by economic ones (Hristov, 2015). Therefore land property nowadays is fragmented and small-scaled, a great part of the field infrastructure – irrigation and drainage network and field road network - is destroyed and looted, vineyards, orchards and vegetable gardens are destroyed too. Currently, there is a collapse in the production of all agricultural products, especially the animal products, fruits, vegetables and grapes. From an exporting of these agricultural goods country, Bulgaria turned into an importing one. Till 2014 the state hardly supported the small and medium-sized farms for their development. Just on the opposite - large tenant farms, which produce only cereals and sunflower and don’t care of the traditions in intensive crop growing and livestock, developed. A significant part of the agricultural land is unused - around 12% of the arable land is abandoned. Abandonment of agricultural areas, mainly in the hilly and mountainous regions, causes losses in biodiversity. The concentration of the support to the large farms has adverse environmental and social impacts: environmental, because it violates the natural structure of agricultural production and therefore the integrity of the ecosystems. Plowing the pastures contributes to carbon emissions in the atmosphere; social, because the concentration of the economic power in few entities leads to increasing inequality of the incomes and to reduction of the rural employment. The employment and the income in the deserted mountainous and hilly areas are very low, almost catastrophic. Therefore the migration to the cities and abroad is increased, villages remain empty and hopeless. The country is a member of the EU but with low production and economic returns, low reference values for the arable land, without a clear vision for the development of agriculture, without possibility for defending the local priorities and parameters of production (Popov, Ivanov, 2012; Boyadzhiev, 2014). In the released in 2013 National Strategy for Sustainable Development of Agriculture in 2014-2020 is written that "given all the natural resources for efficient agriculture, it is not acceptable for Bulgaria to continue losing grounds to the European and world markets and as a result its economy to stay in an unenviable position." The priority issues of the new CAP 20142020 are for development of the promising economic forms in agriculture – the middlesized and the small family farms. Recently, the trends in our country are contradictory. The cultivated area has increased but the number of farms and the employment in the sector have significantly decreased. The number of the medium and the small farms reduces, while the number of large farms goes up. The price on land and the rentals increases too. The National Agricultural Census from 2010 reveals that the management model of the agricultural production is dualistic. The greatest number of holdings - 67% - wields UAA (utilized agricultural area) of 0-1 ha size, but it is only 10% of the total UAA of the country. While only 2% of the holdings wield UAA of greater than 50 ha size, but it is the greatest share of the total UAA – 84%. Logically, the balance between the economic size of the holdings (Figures 1 and 2) is the same – 68.9% of the holdings have economic size less than 2 th EUR and generate only 9% of the standard output of agriculture, while the economic size of 0.4% of the holdings is greater than 250 th EUR 4
and generate 42% of the output. In the upcoming period of CAP 20142020 Bulgaria relies on impro-ving of the opportunities for the development of the farms through redistribution of the subsidies to the smaller farms and linking the payments to the production results. There is a need, however, in other incentives to overcome the Figure 1. Distribution of the holdings by UAA and monoculture crop proDistribution of the UAA by size of UAA (Source: MAF, duction that dominates at 2012) present. One of the tools is spatial planning in the agricultural territories. Rented land covers large areas, so that the EU subsidies are used just for payment of the rents and the income remains low. Only the net income of the large farms covers and exceeds the costs. The net income plus subsidies of the farms growing perennials and Figure 2. Holdings by economic size and Standard output vegetables is lower than distribution by economic size of the holdings (Source: MAF, the costs. The credits of 2012) our farms are higher than the EU average. The farms are technically ineffective and unsustainable. In general, the efficiency decreases. The sustainability of the farms that manage more than four-fifths of the arable land decreases. The pace of change is different for the different regions of the country. In the economically under-developed regions, sustainability increases because of more efficient or less use of fertilizers and chemicals that damage the environment, while in the developed areas, sustainability decreases because of lower efficiency of the environmental factors. Bulgaria has the problem that the only output of Bulgarian agriculture that is quoted and is competitive on world markets is the primary production of grains and oilseeds. At regional, European and international exhibitions, Bulgaria is one of the weakest performers. It exports mainly primary production, which means it exports a surplus value (Boyadzhiev, 2014). The contemporary Bulgarian legislative environment on land-use planning consists of a set of laws and regulations mainly governing ownership, environmental protection, 5
and sustainable management of the resources. It is to greatest extent harmonized with European legislation but still there are gaps that cause misunderstandings and discrepancies in land relationships and land use. The basic spatial, legal and financial problems of the contemporary land-use development in Bulgaria can be defined as the following: • There are large abandoned arable areas, meadows and pastures, on which bushes and weeds grow. • There are conditions for land degradation due to human activity, erosion caused by improper land use and lack of protection from erosion. • Fragmentation of land ownership hinders the use of the economic potential of land as an object of investments. • The disposal of farms is inefficient and the land owners - ineffective. • There is lack of regulation and funding of land-use planning • Declining use and quality of reclaimed land. In the recent decades, the role of the agricultural land-use planning in Bulgaria has been ignored. There is no necessary legal, scientific and methodological basis for its implementation such as Law on Agricultural Land Management and bylaws to bring the agricultural land-use planning at the required level, technological instructions or technical requirements. There is no enough consideration of its role for regulation of land relationships and the sustainability of farms and land use. The new conditions in our country - market economy and globalization of the economic and the social processes bring the necessity for a profound rethinking and development of actual theory and methods for the agricultural land-use planning as an integrated approach to rational use and protection of land and stabilizing the new land relationships. The existence of a land market puts significant requirements to the agricultural land-use planning from the point of view of adaptability to the agro-ecological peculiarities of the territory, to the market situation, to the production potential and prospects of the development of the economy in order to produce real cost-effective, productionbalanced and environmentally sound programs for agribusiness. Land Management in market economy is the lever for implementation of the state policy on agricultural land. As a consequence of proper land management, land administration allows creating information systems on land administration, keeping land cadaster monitoring of land to prevent illegal land transactions, implement the expertise and control over land use, settlement of land disputes, organization and implementation of land-regulation running on a single technical and methodological basis. The state character of the agricultural land-use planning in conditions of market economy is increasingly important and it consists of a number of controlling activities for provision of public benefits. This can be achieved by adopting a law on land-use planning, training of specialists in land development, respecting the technical conditions in the implementation of land planning activities, providing a single information area on the basis of automated information systems, providing an inventory of agricultural land, provision and control over the arrangements for ensuring ecological balance in these areas, creating a land bank for the purpose of consolidation and other benefits in the 6
process of land use. Due to the need for regulation of land relationships and to avoid different shortcomings of land use, changes in land tenure should be carried out under mandatory implementation of agricultural land-use planning, to be financed by the state and does not depend on volition of the individual landowners and landholders. 2.2. Methods The paper is documented on the literature in the field and the approach of the topic is made in a critical manner belonging to the author. The main motivation points for practicing agricultural land-use planning with some issues are defined, i.e. agricultural land-use planning in support of: - improvement of the territorial conditions for land use (land consolidation issues); - sustainable land use in the agricultural territory (environmental issues); - regional policy for the rural areas (i.e. rural development issues). 3. RESULTS AND DISCUSSIONS 3.1. Land Management for territorial improving of agricultural land use (land consolidation) Theoretical considerations One of the methods for improvement of land property’s functionality is land consolidation. This method can be considered a specialized land-use planning with an issue for tenure reform for (Volkov, 2001; Stoeva, 2015): • overcoming the fragmentation • development and preservation of the rural infrastructure, • improving land use Production efficiency is primarily related to the impact of farm size. A bigger farm size allows applying modern farming practices. The larger farms benefit from the large scale of production and, consequently, from the higher return on the investments (Ivanov et al., 2009; Koteva et al., 2014). Land consolidation aims at decreasing the number of unviable farms. By consolidation of land tenure, the low farm income is expected increase and the funds for its maintenance decrease. Through enlarging the land-use area, land consolidation enables implementing the technological progress. Nowadays, agricultural machinery evolves towards increasing of the working capacity and efficiency proceeding from combining the operations, increasing the operating speed of a tractor, and increasing the working width (Kostadinov, 2011). By using the contemporary potential of the agricultural mechanization, conditions for applying better farming techniques and agricultural practices and also proper use of the nature properties of the localization and the soils are created. Land consolidation provides for (Boyadzhiev, 2014): • development of competitive agriculture • improvement of the rural livelihood Land consolidation is a method also for adaptation of land use to the changing structure of the resources under the impact of their so far exploitation for the purpose of economic growth (Volkov, 2001). The territorial restructuring is the firsthand factor among the complex of the changing conditions that evokes applying land consolidation. The tasks of land consolidation relating to the territorial structuring are the following: • reuniting of scattered land plots of an owner or user in an array 7
• removal of the functional shortcomings of the land plots - minimum area, wedging, disproportions in the linear measures (width to length), etc. • increase of the cultivated area The structural changes in land tenure are a complex, difficult, and lengthy process which takes long time. The difficulties stem from the following issues (Volkov, 2001; Madzharova et al., 2014): • the modification of the boundaries of a private property is difficult • the released agricultural labor potential is unsuitable for employment in the other sectors of the economy and requires retraining. • the landowners, especially the elderly, are less mobile due to the lack of alternative employment. Hence the small farms prefer to deal with low income agriculture. For the reasons described above, the restructuring of the production area units may last 10-20 and many more years until the establishment of a perfect model of production structure. As public benefit land consolidation contributes to (Stanimirova, 2009; Madzharova, 2014): • improvement of the rural space. • preservation of the environment The interpretation of Volkov (2001) of the concept of land consolidation is that it is a process of territorial land structuring that considers the technical, legal and socioeconomic aspects of land tenure and land use. This can be considered the new look at land consolidation in the newly established conditions of market economy in the countries of Central and Eastern Europe. The new challenges can be seen as: • effective land ownership • market land relationships • turning land into commodity • need in state regulation of land market • firsthand ecological problems • technological progress and computerization • globalization and localization of the economy • diverse rural area development Aiming at rational use and protection of land, land consolidation today incorporates the processes of renting and expropriation of land, establishing and changing the boundaries and the plot area and laying them on the terrain (Current Issues, 2007). Bulgarian historical data reveal that the trend of farm structure has been mostly of reducing of the average size of the holdings and increasing their number. It was 5.7 ha in 1926 and was reduced to 4.9 ha in 1934. In 1946, before collectivization, it dropped to 4.5 ha. The average number of plots of a farm in 1926 was 15, and in 1934 - 13 plots. In recent times, the main reasons for the presence of small sized land ownership is, firstly, the legally uncontrolled fragmentation by inheritance and, secondly, the small size of the legally indivisible property (Law of Succession, OG 1949). When the Land Reform started, the average farm area requested for property rights restoration accounted for 3.27 ha but because of the great number of inheritors, the hidden average size of each inherited property was around 1.0-1.2 ha (Koteva, 2014; Hristov, 2015). This was and still is serious grounds to pay attention to land consolidation as urgent 8
approach to establishing territorial conditions for rational land relationships and modern and efficient farming in our country. Land consolidation includes the following design activities, when transactions (buying and selling of real estate, bequests, donations, pledges, etc.) are processed: • estimation of the number of properties and the area each property • design of a new property with new spatial characteristics • demarcation of the plan on the terrain • acquisition of land plots to their owners, etc. Usually, these activities are carried out at the expense of landowners and land users, but it is necessary that the state intervenes them as a regulator of land relations. Issues of agricultural land-use planning in relation to land consolidation: 1) Overcoming the fragmentation of land ownership. It is a serious obstacle to modernization and long-term investments in agriculture, to cultivation of land and to the efficient use of agricultural machinery. Implementation of land consolidation should help for overcoming the small-scale land use, to increase the market price of the land, to attract working age employees in agriculture, to enhance the possibilities for subsidizing by the Rural Development Programme and other European funds, for the implementation of modern agricultural equipment and modern production technologies, for low cost of production and a higher return of the investment. 2) To solve the territorial conflicts, especially where the interests of agriculture and forestry are in conflict with the requirements for nature conservation, renovation of villages and infrastructure. 3) To put limits to the transmission of agricultural land for non-agricultural use. 4) To create proper territorial basis for the development of agribusiness. Land consolidation should contribute for overcoming the monopolies on the market of agricultural products, for increasing the agricultural products value, for completing the production cycle, and for export of processed and enriched products. 5) To encourage investments in infrastructure and additional resources for the rural economy, for production of new assortment; to contribute to establishing new markets; to contribute to specialization of farms, to implementing new inventions and alternative energy sources, to applying high technologies; to boost the credit policy, to expand the work employment of the population. 6) To establish territorial conditions for development of competitive agriculture. Land consolidation measures should reduce the production costs and the living labor, should provide for stabilization of the income form agriculture. 7) To improving food security. Land consolidation should contribute to increasing farmland, reducing the area of the abandoned land, utilization of the uncultivated and bushed lands for agricultural purposes, prevention of land abandonment, efficient use of water resources and limiting their exhaustion, mitigation of climate change by limiting carbon dioxide emissions and soil compaction through minimizing the movement of the agricultural machinery, optimizing the stay of the animals on the pastures, construction of forest belts, facilitating the integrated water, soil, biodiversity, etc. management. 8) To follow the priorities for environmentally friendly land use, for preservation and cultivation of landscape, for conservation of nature and biodiversity, 9) To stimulate agricultural land use in an extensive way and the utilization of the non-cultivated area for non-productive purposes. These priorities of land consolidation 9
are in line with the dynamics of agricultural and environmental conditions. 10) To reduce the energy consumption through optimization of the linear measures of the land parcels, the length of the running machines will be minimized and the energy resources will be economically used. 11) To be adaptive to the socio-economic conditions and environmental conditions. The method of consolidation should be adequate to the requirements. In each case should be chosen the method which will solve the problems as quickly as simply and cheaply. 12) To stimulate voluntary land consolidation. 13) To stimulate its balanced financing. Land consolidation financing should be balanced between the public and private interests. A contribution of the side participants with specific interests in the consolidated lands should also be inspired. 3.2. Land Management for sustainable land use in the agricultural territories Theoretical considerations Since ancient times man has had the desire to control nature, to harness the natural land potential to his advantage. By knowledge and technique, he has tried to master the laws of nature and to use them for both - for improving the quality of his life and to develop his intellectual potential. In this vicious circle changes on the principle of the boomerang occurred – slowly but surely rose a threat to Planet’s life. Human activity has generally been at the expense of the environment. As a consequence, drying up of springs and seas, reduced amounts of atmospheric and groundwater, reduced air humidity, increased erosion, climate change, extinction of plants and animals, etc. became reality (Zaharinov, Naydenov, 2015). Land is one of the major natural resources that were affected. The nature specificity of land and the human impact on it for the purpose of involving it in the circulation of substances make all land components like warmness, humidity, wind, soil and underground water, plant and animal world suffer the impact of the technological progress. By satisfying needs outside of his ecological niche man causes hazards to nature, acts for changing of the factors of its natural balance. Currently, science supports the idea of consciously adjusting the ratio of the different aspects of human activity for the purpose of maintaining sustainability of the natural systems as a source of goods for people. In the recent decades, as a methodological basis for balancing of the traditional public interests and the new geoecological challenges on a global and regional scale, it has been developed the concept of sustainable development. The sustainable management of soil resources, for example, is motivated by the irreversible losses due to soil sealing, erosion, continuing contamination from local and diffuse sources (incl. oxidation), salinization and compaction. Due to soil’s immovability, it easily becomes a receiver of harmful substances that are released into the environment (Bliznakov et al., 2012). Unlike air and water, soil can be privately owned that puts obstacles to its protection and makes it dependent on the willingness of the owners and managers. The scientific and current management communities are aware of the role of the human activities for the degradation of different soil functions, especially as a result of the accelerated economic development of the early 20th century. The cost of rebalancing in a world scale is very high and is called “the price humanity pays” for interference with the environment (Cioloç. D 2010). Moreover, these expenses in all countries annually increase. Managing efforts like ameliorations for various impacts of man on the 10
composition, structure and properties especially of the soils are being developed for preservation and ensuring of their ecological function. These methods, including analysis of the turnover of the harmful and beneficial ecosystem substances, purification of the technogenic contaminated soils, etc., allow the soil composition and properties change in the right way in order to model agricultural arrays with tailored properties. Agricultural land-use planning has a fundamental contribution to prevention the technogenic impact and deepening of the negative ecological processes through assessment of the need and framework planning of activities against these phenomena. Agricultural land-use planning contributes to development of sustainable agricultural systems that are ecologically compatible. It caters for the use of the natural resources according to their potential for recovery. Agricultural land-use planning is the tool for avoiding agricultural activities such as plowing along the slope, removal of the arable soil layer, abandonment of the terraces, growing of excessive number of livestock and overgrazing, mismanagement of crops and trampling of the heavy machinery intensify, i.e. for avoiding the erosion and secondary soil compaction processes. Land Management, especially agricultural land use planning, as a regulator of the impact of the agricultural activity on soil and environment, is consistent with creation of a basis for implementing the general principles of the right policy for environmental protection – the personal responsibility, the role of the government, the multilateral resource use, monitoring and forecasting the exhaustion of the land resources, the mutually intertwined resource relations. It regulates the compliance of the priorities – the subordination of the economic issues to the environmental ones (Volkov, 2001). Contemporary agriculture is featured by a high degree of intensification, which is the basis for high productivity, but also causes more lasting and deeply damaging effect on the environment (Popov et al., 2012). Land Management provides for highly productive, cost-effective and stimulating social values for farmers but for nature preserving agricultural land-use systems. The basic principles developed by the International Commission on Environment and Development (WCED Report, 1987) for sustainable agriculture, are the following: - to satisfy the needs of the society without compromises with the development opportunities of the future generations; - to use natural resources sparingly and to recover and preserve the ecological balance; - to assess the economic impact of each activity, taking into account the cost of restoration of the damages which are inflicted on the environment; - to distribute fairly the costs of the environmental protection between the present and the future generations based on a broad international cooperation. Recently, a process of orientation of business to market economy in our country takes place, which in our conditions consists of changes in the production technologies. The so-far exploitation of nature resources by the current technologies brought us to depletion of the non-renewable resources, which evoked: a raw-material and energy crisis; irrational use of the natural resources, resulting in naturally disposed huge amounts of wastes that pollute and harm the environment; disruption of the ecological balance, which interferes with the normal development of ecosystems and worsens the living conditions. The new thinking in our governing bodies concerns harmonizing of the agricultural land-use activities with the environmental issues. It acts for (Ilieva, 11
2008): • prevention of the natural resources depletion • suspension of the environmental pollution and damages • preservation of the ecological balance. The new policy of the EU CAP is oriented to new technologies and solutions that enable prevention of nature vs. society conflicts and optimize their relationship. This policy, being policy of the industrial society, of science and technology, prepares the transition to a higher form of production - ecological - on the principle of selfrestoration of the natural resources, of maintaining of a techno-biosphere self-regulating system. It relies on modern equipment, technologies and training of the labor resources to achieve greening of the production and economic transformation of the ecological potential, which is far more difficult to turn the economic potential into adequate ecological one, .i.e. to restore the natural conditions at the expense of other investments. (Risina, Yovchevska, 2009; CAP 2014-2020) Land-use planning contributes to reasonably and rationally spending of the ecological potential, the latter being much more sensitive and harder reproducible than the economic one. Contemporary land management follows the goal of the modern environmentally sustainable agriculture to obtain the potentially possible yields of high biological value in a given agro-ecological area. Proper farming and a balanced land-use are responsible for the best economic performance in market conditions together with maintaining and improving soil fertility and preservation of the environment. Such a sustainable system stems from proper disposal of the production processes according to the natural potential of the area concerned. Another factor for sustainability is farm size. The smaller farms and family-type economic entities are preferable from a social point of view and this theory has many followers in Europe and in the USA (Kaneva et al., 2016). All this means that land management, including agricultural land-use planning, should be part of a strong and sustainable, well supported and credible multifunctional policy for provision of solutions for territorial structure planning. Issues of agricultural land-use planning in support of sustainable land use and sustainable development of agriculture: 1) To create a basis for "smart growth" of society through intelligent treatment of the spatial structure of the territories and to ensure optimal spatial conditions for the development of agriculture and the its related activities. 2) To establish territorial conditions for reaching the potentially possible for a given agro-ecological area yields of high biological value through proper agricultural practices; to ensure the best economic performance on the market. 3) To maintain monitoring of the agricultural land that reflects the results of the environmental monitoring for the purpose of a territory protection from negative nature impacts. 4) To accomplish complex regulation of land use on the basis of an ecological monitoring about the intensity and the scale of exogenous geological processes natural, anthropogenic and technogenic in order to ensure the ecological functions of the lithosphere 5) To ensure a balance between the interests of all land users on a regional level for the purpose of a balanced use of the soils and the co-existence and stability of the soil functions. 6) To differentiate and isolate the technogenically contaminated areas with 12
provision of technical land reclamation (in 2013 the reclaimed area in Bulgaria amounted to 36 ha, while the designated area for reclamation was 117 ha). 7) To match the agricultural land use planning activities with regulation of the technogenic impact on the geological environment and its components - soil, rocks, groundwater, topography, etc. based on threshold values for the technogenic impact 8) To ensure the protection of agricultural lands and soils against the potential sources of pollution - municipal waste, energetics and transport in urban areas, tourism, etc. through engineering solutions for isolation and protection and coherent mutually acceptable territorial deployment. 9) To provide for the most important soil functions – to be habitat for a variety of organisms; to retain water and nutrients necessary for the growth and development of plants; to filter the water in the soil profile; to absorb, accumulate and reflect the solar energy through proper disposal of the crops. 10) To provide for protection of the agricultural areas from wind and water erosion. 11) To comply with the requirements for the preservation of the biodiversity by maintaining the field borders and the wetlands. 12) To avoid erosion increasing caused by the agricultural activities - plowing along the slopes, removal of arable soil layer, abandonment of terraces, growing number of excessive livestock, mismanagement of crops and trampling of the heavy machinery. 13) To regulate the operation of the pastures in terms of reducing its intensity, i.e. to avoid erosion and increase of soil losses 14) To create conditions for intensive land use but without contradiction with the natural reproduction of soil and soil fertility. 15) To give priority to the environmental effects of land use to the economic effect of the agricultural production due to its direct relation to the physical survival of mankind and its social and economic reproduction and development 16) To consider the land-use purpose and the functionis of the other types of territories and all activities related to land without compromises with the agricultural land-use of the agricultural territories and the environmental principles. 17) To contribute for preservation and improvement of the landscapes and fit the agro-landscape typical appearance up to the natural landscape 18) To harmonize the agricultural land use to the use of the other natural resources - water, meso-climat, solar energy, etc. 19) To promote the role of the agricultural land-use planning in the other scientific fields - agronomy, geology, hydrology, ecology, economics, biosystem engineering, etc., that are relied with the use of land; to rehabilitate the role of the agricultural land design engineer as an important consultant on the issues of land use, particularly in the agricultural areas. 20) To ensure rational use of energy, water, soils, forests and other natural resources 21) To contribute for the working durability of the agricultural machines, for reducing of the wearing of their working organs through optimizing of the operating conditions 22) To contribute for reducing of carbon dioxide emissions by creating conditions for minimum working length of the machines; to facilitate the transition to a low carbon 13
and sustainable to climate change economy. 23) To establish areas for development of a sustainable organic farming with reproduction of the environment and by providing the biological cycle in the system of agriculture, enhancing soil fertility and taking into account the local conditions when zoning of production, 24) To avoid pollution of the environment through proper mutual disposal of lands of different land use 25) To cater for ecological expertise of the agricultural land-use projects 26) To develop land management that respects the environmental factors of the terrestrial environment (climate, weather, soil, topography) according to their physiological active steps - abiotic, biotic and anthropogenic as to their variability and ecological optimum 27) To consider an offset of the adverse environmental impacts by stipulating measures to reduce the impact of the high summer temperatures and dry winds such as forest belts, shelters from natural vegetation, etc. 28) To consider the climate resources and the zoning of the agricultural production and animal husbandry 29) To take into account the potential impact of the wind for pollination 30) To consider the hydrographic and irrigation network - the irrigation facilities and designed areas - to provide conditions for increasing the efficiency of the irrigation systems and for preservation of the groundwater resources both in quantitative and qualitative terms 31) To create conditions for limiting the adverse environmental impacts, taking into account environmental law of the non-linearity in the dependence “adverse impact – consequence”, i.e. relatively weak impacts cause huge-scale local and regional disasters (. 32) To create conditions for solving global environmental problems 3.3. Land Management in support of the regional policy for the rural areas Theoretical considerations Rural areas in Bulgaria are a compact part of the national territory. Rural area is a municipality, on which territory there is no a city with a population beyond 30,000 citizens and the population density is less than 150 inhabitants/km2 (National Plan for Agriculture and Rural Development (2000-2006). According to this definition which is still in use the rural areas account for 81% of the territory and 42% of its population (Madzharova et al., 2013). The economic functions of the rural areas in Bulgaria are related mainly to their agricultural activities. Important activities to a lesser extent are also forestry and fisheries, crafts, small and medium enterprises of light manufacturing, food industry; rural and ecological tourism.. The main problems of the rural areas today can be designated as depopulation, low income, less employment, low agricultural production and low market participation of pretty many of them, destroyed infrastructure and public services, need in diversification of the rural economy, need in protection of nature and the cultural landscapes. At present, the development of these regions is lagging behind from the urban development. But rural areas in Bulgaria have significant natural, economic and cultural potential. If their potential is fully and appropriately used, it can have a significant contribution to their development (Madzharova et al., 2013). The solvation 14
of the problems of the rural areas is subjected to their local resources and specific conditions of each region. Very important factor is the territorial disposition of the functions through spatial planning, including the agricultural land-use planning. Presently, the structure of the agricultural production is the main reason for the territorial structure and the demographic problems of the rural areas. The monoculture cultivation on large areas nowadays is a factor for depopulation of the rural areas since it releases labor resources. Manpower leaves its homelands in search of work and livelihood. In the absence of labor resources, these areas become unattractive to foreign investments, their infrastructure is being destroyed, and the agricultural activities of the rest of the population, which is usually in retirement and over the working age don’t have market orientation. This leads to a decrease in the sustainability of these areas. One of the important goals of agricultural land-use planning is to contribute to sustainable long-term development without an external intervention. What is needed is the state control through specific and clearly regulated rules, measures and forms, which will implement the state policy. Particularly, the most important focus is on land consolidation on different grounds – land property, production purposes, cultivation, melioration, etc. The size of farms is the crucial conditions to benefit their owners of the funding opportunities under the EU Rural Development Programme, and for application of modern farming practices and modern production technologies. The environment of our rural areas is one of their most attractive features and an important resource for diversification of the local economy. Over 75% of Bulgarian undisturbed natural landscapes are located in the rural areas (Todorov, Velchev, 2011; Todorov, 2014). They are rich in flora and fauna, have diversity of interesting landforms, alpine lakes, endemic and relict plant and animal species. Bulgaria is one of the richest countries in biodiversity and undisturbed natural landscapes in Europe. They are a resource of national and European importance, hence a network of protected areas (National Parks and Nature Reserves, Maintained Nature Reserves, Natural Show Places, Protected Areas, etc.) was legalized (Law on Spatial Planning, 2001; Law on Protected Areas, 1998). The Rural Development Programme 2014-2020 provides for measures for landscape protection - afforestation and erosion control, maintaining fallow-lands, protection of the field borders, etc. (Rural Development Programme 20142020). Agricultural land-use planning is an activity that incorporates the requirements of the protected areas in the planned agricultural activities in the agrolandscapes. Agricultural land-use planning provides for compliance of the natural and agrolanscapes peculiarities with the goal of preserving the natural resources. Another important focus of agricultural land-use planning is on the abandoned arable lands in the rural areas. The highly fertile agricultural land is part of our national wealth. Therefore the process of losing it for non-agricultural use has to be stopped. Land Management can contribute to proper disposal of the different land functions on lands of proper quality so that to limit the transition of highly valuable arable lands to non-arable use. It is closely related to the main objectives of the EU policy. Ussies of land-use planning for the development of the economic potential of rural areas 1) To create a basis for "inclusive growth" of the less favored areas (in the mountainous and hilly areas) by the spatial structure of their agricultural areas that allows a high-tech mountain farming and animal husbandry. 2) To respect the principle of integration with the overall spatial planning, 15
economic planning, regional planning and management, landscape planning and protection, planning of environmental and agricultural activities and engineering projects for specific technical amelioration. 3) To contribute for the development of the potential of the rural economy hence acting as a locational factor and assist in the building of field infrastructure for the purpose of increasing the efficiency of agricultural production, for the. 4) To create conditions for increasing the investments in infrastructure and development projects, this is the trend of the EU. 5) to contribute for improving the qualifications of the people who are employed in the agricultural production and the rural population as a whole through creating a conditions for applying high technologies in the agricultural production thus overcoming the negative natural population growth, and subsequently for developing the other types of infrastructure - housing, technical and social, for raising the quality of the habitat of the rural communities and overcoming the crisis of the rural areas. 6) To be the basis for diversification of the rural economy - to contribute for the landscapes conservation and development of rural, farming, eco and cultural tourism, hunting, special interest, etc., tourism; to contribute for the optimal location of alternative activities - mechanized services, processing of products, crafts, marketing, utilities, renewable energy, etc., to natural resources thereby contributing to the growing non-agricultural income and diversification of agricultural economics 7) To contribute to conservation of the local natural resources that will be a good basis for the development of the social functions, finally with effect on the economic development of the region 8) To contribute for the development of agribusiness on the basis rational spatial planning in rural areas that serves the agrarian sector and transportation and the distribution of agricultural production according to the specialization of the area. 9) To contribute to the development of the country border areas that are usually rural through proper and rational territorial structure of their agricultural areas and implementation of their environmental potential for productive use of land. 10) To contribute to a more productive use of resources - natural, financial, human and management as a basis for a long-term economic growth 11) To follow the policy of integrated rural development since spatial planning is the basis for spatial location and communication between sectors, particularly the agricultural sector to the others. The proper placement of the roads and the agricultural production areas contributes to the overall development of the rural economy with concern for infrastructure and the environment to sustainable rural development 12) To consider the local needs and the local development potential and thus to contribute to the policy of integrated development of the rural areas 13) To contribute to capacity building among the citizens and the local government 14) To adhere to the principles of the FAO Land Tenure 15) To recognize and respect the territorial approach for management of the rural areas, i.e. to differentiate its approaches according to the particularities of the regions and their economic development, such as rarely or very sparsely populated areas; mountainous areas; peripheral regions; disadvantaged areas; etc.; to take into account the conditions in these areas - natural and socio-economic and to have differentiated approach including specific structural solutions that fully contribute to the desired growth. 16
CONCLUSSIONS Agricultural land-use planning is an important land management tool. It follows to a great extent the socio-economic development and defends the official policy for land ownership, land use and agriculture. Agricultural land-use planning in the democratic system subordinates to the complexity of socio-economic conditions - the existence of effective private property on land, land market, market relationships, and economic growth issue and also suffers the impact of the world processes - globalization and localization of economy, technological progress and computerization, firsthand ecological problems and diverse rural area development. An essential challenge to agricultural land-use planning is to maintain the balance between the private and the public interests in land use, considering all dynamic factors of the economic development, on behalf of the sustainable development. This involves the state through its control functions to be a regulator of the processes. Nowadays, Bulgarian land legislation consists of a set of laws and regulations mainly governing land ownership, land-use and environmental protection. It is to greatest extent harmonized with the European legislation but still there are gaps that cause misunderstandings and discrepancies in land relationships and land use. A great gap is the lack of legislation on agricultural land-use planning, including land consolidation. The main issues of the contemporary land-use planning in Bulgaria can be viewed from the perspective of land consolidation, sustainability and development of the rural areas. In general, agricultural land-use planning in the contemporary dynamic conditions has the responsibility to overcome the fragmentation of land ownership. Agricultural land-use planning has to consider the land-use purpose and the functions of all types of territories and to contribute to solvation of any territorial conflicts. It has to ensure a balance between the interests of all land users on a regional level. It has to integrate with spatial planning, economic planning, regional planning, landscape planning, planning of environmental and agricultural activities; technical planning of amelioration. Agricultural land-use planning has to create a basis for "smart growth" of the society In this aspect it has to be adaptive to the socio-economic conditions and environmental conditions; to accomplish a complex regulation of land use - to give priority to the environmental effects of land use to the economic effect of the agricultural production; to contribute for more productive use of the resources - natural, financial, human and management Agricultural land-use planning should follow the priorities of environmentally friendly land use and to create conditions for solving the global environmental problems. It has to contribute for preservation and improvement of the natural landscapes and for conservation of nature and biodiversity by maintaining the field borders and the wetlands. It has to harmonize the agricultural land use with the use of the other natural resources - water, meso-climat, solar energy, etc., to contribute for reducing of carbon dioxide emissions, to stimulate the extensive way of the agricultural land use; to create conditions for limiting the adverse environmental impacts; to create conditions for intensive land use but without contradiction with the natural reproduction of soil and soil fertility; to provide protection of the agricultural areas from wind and water erosion and from erosion caused by the agricultural activities; to regulate the 17
operation of the pastures. Agricultural land-use planning should maintain monitoring of the agricultural land to avoid the use of agricultural land for non-agricultural purposes; to stimulate utilization of the non-cultivated area for non-productive purposes; to ensure protection of the agricultural lands and soils from potential sources of pollution; to control of the technogenic impact on the environment and its component; to consider an offset of the adverse environmental impacts It should cater for ecological expertise of the agricultural land-use projects. By compliance with the technical requirements, agricultural land-use planning should cater for reducing of the energy consumption through optimization of the linear measures of the land parcels; for avoiding pollution of the environment through proper mutual disposal of lands of different land use; to contribute for the working durability of the agricultural machines. Agricultural land-use planning should establish territorial conditions for reaching the potentially possible for a given agro-ecological area yields of high biological value; for developing competitive agriculture and for improvement of food security; for establishing areas for sustainable organic farming; for optimum use of the hydrographic net and the irrigation infrastructure. Without agricultural land-use planning, it wouldn’t be possible to create conditions for increasing the investments in infrastructure in the agricultural territories. Agricultural land-use planning is a tool for developing "inclusive growth" of the less favored and country border areas. It recognizes and respects the territorial approach for management of the rural areas. By solving the territorial problems, and especially, of the agricultural territory, it put grounds for development of the potential of the rural economy. Since Bulgarian economy is still in transition, spatial planning is in the dawn of its implementation, its time to create an adequate managing system for the agricultural territories as an element of land management in order to provide for prospective development of these territories and for integrated development of the national space. REFERENCES Bliznakov, A., Z. Gartarov, N. Marinova (2012). Ecology and Economics, Economics and Ecology, BAS, S., 316 p. Boyadzhiev, V. (2014). The Economy-Geographic priorities of Bulgarian Agriculture. Paradigma, S., 298 p. Blum, W. (2014). Potential and Limits of Sustainable Intensification of Agriculture. Report of Int. Conference “Land as a Resource”, 19.06.2014, EC, Brussels, Belgium https://scic.ec.europa.eu/streaming/index.php?es=2&sessionno=415185ea244ea2b2bede b0449b926802 Cheremushin, S.D., S.A. Udachin (1950) Land-Use Planning of the Cooperative Farms (Kolkhoz). Translation from Russian., Zemizdat, S., 756 p. Cioloç. D. (2010). The CAP after 2013, European Commission - SPEECH/10/400, 22/07/2010 http://europa.eu/rapid/press-release_SPEECH-10-400_en.htm?locale=en Hristov V. (2015). Agric. of Bulgaria - crying for Rescue Policy. Ed. "Slaveykov",S., 284 p. Ilieva, M. (2012). Socio-Economic Transformation in Bulgaria - Characteristics and Territorial Disparities. TerArt – Krastyu Terziev, S., 341 p. Ivanov, B., T. Radev, D. Vachevska, P. Borisov (2009). Sustainability in Agriculture, Ed. Avangard Prima, S., 299 p. 18
Kaneva, K., N. Koteva, H. Bashev, V. Krastev (2016). Opportunities for the Development of Farms in Terms of CAP 2014-2020. Institute of Agricultural Economics, S., 64 p. Koteva, N., M. Mladenova, P. Dzhandarmov (2014). Changes in Farm Structure, IAE-AA, S., 50 p. Kostadinov, G. (2011). Issues and perspective for fieldcrop mechanization in our country. Zemedelie Plus, 8, 43-46. Madzharova, S., M. Peneva, E. Patarchanova (2013). Rural Areas, Publishing complex UNWE, S., 290 p. Michev, M. (1988) Land-Use Planning.???? Popov, T., T. Sedlarski. (2012). Institutional Economics. Opportunities and Untapped Potential. University Publishing House "St. Kliment Ohridski ", S., 231 с. Popov, R., B. Ivanov (2012). Bulgarian Agriculture and anticipated results of the proposed changes to the CAP. Avangardprima, S., 100 p. Risina, M., P. Yovchevska (2009). Land ownership and Land Market in Bulgaria. National Policy and CAP, IAE-AA, S., 54 p. Spasov, T. (2006). Market transformation and competitiveness of economies in transition. University Press "Economy", 302 с. Stanimirova, M. (2009) Land Consolidation in the Agricultural Territories of Bulgaria, Publ. House “Gea-Print”, Varna, 236 p. Stoeva, А. (2015). Consolidation of land properties, Geomedia,5, 30-34 Todorov, N., A. Velchev (2014). Landscapes of Bulgaria - Spatial Structure. IVIS, Veliko Tarnovo, 126 p. Tsoneva, M. (2001). Agricultural Policy. Ed., Trakia-M, S., 240 p. Valchanov, D. (1954). A History of the Land Relationships and Land-Use Planning. Nauka i Izkustvo, S., 172 p. Velchev, A., N. Todorov, R. Penin, M. Konteva (2011). Landscape Gepgraphy of Bulgaria. Bulvest 2000, S., 234 p. Volkov, S.N. (2001). Theoretical Basis of Land-Use Planning. A Textbook, V.7., Kolos, M., 407p Vuchkov, P. (1985). Land-Use Planning. UACEG, S., 264 p. Zaharinov, B., Y. Naydenov (2015). Environmental Monitoring, NBU, S., 296 p. ***CAP 2014-2020 ***National Development Programme: Bulgaria 2020, http://archive.eufunds.bg/bg/page/ 809 ***Law on Spatial Planning, Official Gazette of RBulgaria, 1/2001 ***National Agricultural Census (2012) Ministry of Agriculture and Food, Sofia ***National Plan for Agriculture and Rural Development 2000-2006 ***National Strategy for Sustainable Development of Agriculture in 2014-2020 ***National Statistical Institute (NSI) Internet: www.nsi.bg/bg/content/ ***Current Issues of Land Consolidation in Bulgaria (2007). Ed.: Prof. S. Bachvarova, NCAS, Soil Science Institute “N. Poushkarov”156 p. ***Law of Succession, OG 22/29.01.1949, last amended OG, 47/23.06.2009 ***Law on Spatial Planning, OG 2/1.01. 2001, last amended OG 51/5.07.2016 ***Law on Protected Areas, OG 33/11.11. 1998, last amended OG 61/11.08.2015г ***Report of the World Commission on Environment and Development: Our Common Future (1987) http://www.un-documents.net/our-common-future.pdf *** Rural Development Programme 2014-2020
19
Chapter 2 The Effects of 1/3 Cluster Tip Reduction and Foliar Fertilizer Applications on Yield and Quality of Alphonse Lavallée (Vitis vinifera L.) Grape Cultivar Aydın AKIN, Tuğrul KARAĞÜL INTRODUCTION Viticulture is one of the most important branches of agriculture in Turkey. Where the vineyards in the world are located between degrees of latitude the northern hemisphere 20-52., the southern hemisphere 20-40. Viticulture can only be performed in the high plateaus Ecuador closer. The areas that make up the vineyard can be made, especially on the southern slopes of the northern border and in riverside. Turkey is located in favorable climates for viticulture and one of the nearly 6000 years culture of the vineyard with vines as the homeland of both foreign gene has the potential to very rich culture of the country is considered suspended (Ağaoğlu et al., 1997, Çelik et al., 1998). Viticulture has been a source of livelihood and occupation of many societies lived on this land. Grape is considered to be table, dried and wine. As well as grape juice, vinegar, molasses, jams and brine is made from the leaves of the vine. A lot of possibilities with this assessment considered viticulture is considered one of the significant commercial value of agricultural activities. It is producing 67 million tons of grapes from about 7 million hectares in the World (FAO, 2012). Turkey has the 5th with 461.956 hectares of viticulture area, and the 6th with 3.650.000 tons of production in Turkey (TÜİK, 2015). Plants need nutrients from the air for the life of the stem body and take over the environment in which they raised their roots. Plant nutrients are divided into two groups, namely macro and micro elements. In both groups, if they are required the limits and proportions of the elements, the development is decreased, the number of agricultural products decreases (Anonymous, 2016a). Trace elements (micro element), which are necessary for the plants, but, compared with other plant nutrients used a small amount of nutrients. These include iron, zinc, copper, manganese, boron, molybdenum, cobalt, such as selenium counted. This time they have no enough nutrients in the soil, the plants show a yellowing usually called chlorosis. Yellow leaves die in more advanced stages and remain leafless branches ends. Although needed in very small amounts of the trace element is quite common trace element deficiency (Anonymous, 2016b). Reducing the cluster number application in Amasya and Cardinal grape cultivars decreased the amount of titratable acid and fresh grape yield per vine, while it increased the index of maturity value (Dardeniz ve Kısmalı 2002). Leaf collection and
Assoc. Prof. Dr., Selcuk University, Faculty of Agriculture, Department of Horticulture, Konya,Turkey/
[email protected] Selcuk University, Faculty of Agriculture, Department of Horticulture, Konya, Turkey
implementation of cluster thinning in Crimson seedless grape cultivar resulted in the increase of cluster weight, cluster size, berry size, berry color, oBrix and fruit juice values and decreases in accelerating the maturation process and the acidity values (Abd El-Razek ve ark., 2010). TARIŞ-ZF foliar fertilizer was applied on leaves of Horoz Karası (Ermenek) grape cultivar, and fresh grape yield, cluster weight, 100 berry weight, berry stalk connection force, must yield and pruning waste weight values were increased. However, berry width, berry length, berry length/berry width ratio, total sugar, total acid, maturity index and the number of bud burst values were decreased (Akın, 2003). It was carried out in 5 BB rootstock grafted on Horoz Karası and Gök grape varieties (Vitis vinifera L.) during the 2010 growth season. Effects of 1/3 cluster reduction (CR), 1/3 CR+herbagreen (HG) and 1/3 CR+humic acid (HA) applications on grape yield and quality of cultivars were examined. The results showed that 1/3 CR+HA application increased grape yield, berry weight, berry red and blue color intensity values of Horoz Karası grape variety and 1/3 CR application increased grape yield and maturity index values of Gök grape variety (Akın, 2011a). This study was investigated the effects on grape yield and quality of control, 1/3 cluster tip reduction, repetitive applications of herbagreen (HG), humic acid (HA), combined foliar fertilizer (CFF), gibberellic acid (GA), gibberellic acid+combined foliar fertilizer (GA+CFF) and gibberellic acid+herbagreen (GA+HG) performed in the Muskule table grape variety. The longest cluster was obtained in control, the highest 0 Brix and L* color value were obtained in 1/3 cluster tip reduction, the highest grape yield was obtained in 1/3 cluster tip reduction+herbagreen, the highest berry length/berry width, and b* color value in 1/3 cluster tip reduction+humic acid, the highest maturity index were obtained in 1/3 cluster tip reduction+combined foliar fertilizer, the highest must yield and a* color value were obtained in 1/3 cluster tip reduction+gibberellic acid+herbagreen applications (Akın, 2011b). A research was conducted aiming to study the effects of cluster tipping applications on the yield and quality of Uslu (V. vinifera L.) and Cardinal (V. vinifera L.) grape cultivars. When the berries were 5–7 mm, the clusters were tipped at 1/3rd, 1/6th and 1/12th of the cluster length. In Uslu, cluster length (cm), cluster width (cm), cluster compactness (1–9), number of berries/cluster (n), berry weight (g) and titratable acidity (TA) (%) parameters were affected by the applications. In Cardinal, cluster length (cm), cluster compactness (1–9), number of berries/cluster (n), berry weight (g), total soluble solid (TSS) (%), titratable acidity (TA) (%) and maturity index parameters were affected by the applications. Yield was not affected by cluster tipping in Uslu and Cardinal grape cultivars. It was concluded that the cluster tipping applied to Uslu in a proportion of one–third and to the Cardinal in a proportion of one–sixth of the cluster length would be positively sufficient in terms of increasing the grape quality (Dardeniz, 2014). In this study, table grape variety Alphonse Lavallee of the producers was investigated grape yield and quality of Control (C), 1/3 Cluster Tip Reduction (1/3 CTR), Micro-nutrient (MN) and 1/3 CTR+MN applications. MATERIAL AND METHODS This research was carried out in Elmadag district of Ankara in the vineyard of the producer in the vegetation period in 2013. In the study, it has been grafted onto the 21
rootstock 41B Goble trellis system 7-year-old Alphonse Lavallee grape variety. The cultivar is considered as a grape variety, with purplish-black, seedy, table grape. Experimental design; 1) Control (C), 2) 1/3 Cluster Tip Reduction (1/3 CTR), 3) Micro-nutrient (MN), 4) 1/3 CTR+MN. The effects on yield and yield components of this application in Alphonse Lavallee grape variety were determined. 1/3 Cluster tip reduction was applied level fruit set period (06.05.2013). INVESTIGATED PARAMETERS 1/3 Cluster Tip Reduction (1/3 CTR): The 1/3 cluster tip reduction (berry thinning) was applied by cutting the tips of the cluster at the point of one-third of the cluster length, while the 1/3 cluster reduction of all clusters outside the control in the berry set period was conducted. Application in Micro-nutrient (MN): 1.Micro-nutrient application was made of before flowering. 2.Micro-nutrient application was made of fruit set period. After 2. Application has made a total of 6 times at 15-day intervals150 cc/da. Micro-nutrient contains B 1.50%, Cu 1.00%, Fe 5.50%, Mn 4.00%, Mo 0.02%, Zn 6.50%. Foliar applications were made by spraying liquid form. Ripening grapes are collected and made the necessary measurements and analysis operations on 09.08.2013. Fresh Grape Yield (kg/vine): It was calculated by weighing all the yields from the vines in the parcels and dividing it by the number of vines. Cluster Weight (g): It was found by dividing the total grape yield with the number of grape cluster obtained from each parcel. 100 Berry Weight (g): It was calculated of 100 berries weight collected using the method (Amerine and Cruess, 1960). Maturity Index (°Brix /TA): It was determined with the division of °Brix to TA. o Brix (total soluble solid substance) (%) was determined by squeezing the grapes (berries) collected from the vines using the method (Amerine and Cruess, 1960). and keeping the resulting juice at 20 °C in a digital refractometer device (Atago RX 7000 Alpha). TA (titratable acidity) (g/l) was calculated by using the titration method from the juice squeezed from the same grapes. Pipette 5 ml of the grape juice and 50 ml of pure water in the beaker taken to be completed were subjected to titration with 0.1 N NaOH (Nelson, 1985). Must Yield (ml/kg): It was determined as the amount of juice obtained by squeezing the one kilo grape that were picked. Color Density: It was determined using a colorimeter device (CR-400 Minolta Co., Osaka, Japan). Color intensity values were provided as CIEL* (Commision Internationele de I’E Clairage) a* b* coordinates, which defined the color in a threedimensional space. However, L* indicated lightness, while a* and b* were the chromaticity coordinates, green-red and blue-yellow coordinates, respectively. L* is an approximate measurement of luminosity, which is the property according to which each color can be considered as equivalent to a member of the gray scale, between black and white, taking values within the range of 0 to 100. Thus, a* takes positive values for reddish colors and negative values for the greenish ones, whereas b* takes positive values for yellowish colors and negative values for the bluish ones (Minolta, 1994). For the color measurement, 10 grapes per cluster were selected from two opposite sides of 22
the cluster and at five different heights. In this way, the color datum was the mean of 10 grapes for each application. The research was planned in a completely randomized block design as a simple factorial experiment, and variance analyses and multiple comparison tests were done by JMP statistical package program (version 7.0; SAS Institute, Cary, NC, USA). In this study, three vine plots in each replication including 12 in the vine 36 vines were used in total. The research was planned in a completely randomized block design as a simple factorial experiment, and variance analyses and multiple comparison tests were done by JMP statistical package program (version 7.0; SAS Institute, Cary, NC, USA). DISCUSSION AND CONCLUSIONS The highest cluster weight was determined with MN (338.71 g) application and with C (329.24 g) application; the highest 100 berry weight was found with MN (618.37 g) application; grape yield, maturity index, must yield, L*, a* and b* color intensity values was not found statistically significant (Table 1, Table 2). Table 1. Effects on yield and quality of applications in Alphonse Lavallée grape cultivar Fresh Grape 100 berry Maturity index Cluster weight Applications yield weight (0Brix/TA) (g) (kg/vine) (g) C 3.46 329.24 a 500.93 b 19.66 1/3 CTR 3.35 257.35 b 528.35 ab 21.40 MN 4.24 338.71 a 618.37 a 17.51 1/3 CTR+MN 3.43 294.35 ab 541.85 ab 19.85 LSD 5% N.S. 56.11 91.56 N.S. a, b: The mean difference between different small letters in the same column are important (P NH2COOH+NH3 — > CO2+2NH3
(2.1)
It was revealed by the previous studies that urease enzyme activity of soil has important connections with soil characteristics such as organic substance, texture, pH, 106
cation exchange capacity (CEC); and organic wastes that are added to soil increases urease activity (Özdemir, Kızılkaya, R. & Sürücü, 2000). Urea is given to soil while measuring urease activity of soil. This substance is digested by urease enzyme and yields NH3. It transforms into pH= 9.6 and 2.6 dibromquinone-chloride and indophenol substance in color blue. It is measured photometrically via this color. Urease activity value is obtained from the finding. While some of the enzymes in soil conduct synthesis reactions, a great majority conduct the digestion of compounds with big molecules in plantal and animal wastes (Arcak, 1987). Many aerobe and facultative anaerobe organisms possess catalase enzyme. Catalase enzyme resolves hydrogen peroxide (H2O2) with cell toxin, which emerges as a result of metabolism events of living organisms and respiration, into water and oxygen. This reaction can be briefly shown as given below (Çengel, 2004). 2H2O2 → 2H2O+O2
(2.2)
When H2O2 at a rate of 3% is given to soil samples in the presence of this enzyme, water and oxygen emerge as per the equation given above. The amount of oxygen that emerges can be measured volumetrically. In addition, if there are generally oxidized substances inside the soil, the oxygen that emerge chemically should be eliminated. Therefore, catalase enzyme, which is biologically emerged, in certain substances is stopped to detect chemical oxygen outlet, and considered as proof. Based on the difference between the proof and sample, enzyme activity in 5 to 10 g of soil can be detected. Meanwhile, it is possible that the oxygen outlet may be influenced by air pressure and temperature. Thus, catalase enzyme activity can be calculated in ml O2 taking into account these data in the environment where the calculation is made (Çengel, 2004). Soil respiration (CO2 production) and dehydrogenase (DHG) enzyme activity values are widely used to determine biological activity in soil. Dehydrogenase enzyme activity is a respiration enzyme carrying hydrogen and electrons from substrate to appropriate acceptors during oxidization of organic compounds (Chander & Brookes, 1991). The main principle of detecting dehydrogenase activity is based on the reduction of tetrazolium salts in microorganism cells, transforming into solution, changing the color of solution, and measuring this color intensity. It is possible to obtain information in relation to total quantity and bulk of various dehydrogenase enzymes by measuring this enzyme activity. It is an indicator of organisms that can release hydrogen from organic compounds at respiration levels of aerobe and anaerobe living beings. H2 receptor substance under oxygenated conditions in biological metabolisms is O2 whereas it is rather pyruvates under unoxygenated conditions. The energy taking place in biological systems is possible through carrying hydrogen. TTC-solution, which is a colorless reducer, is used for measuring this activity. (TTC=C19H15ClN4). TTC-solution that is given to soil contacts microorganisms in soil, and penetrates into cell. Dehydrogenase enzymes inside the organism carry the hydrogen of easily-digested carbon hydrates over tetrazolium salts, and transform them into red triphenyl formazan (TPF). Formazan reproduces inside the organism, and crystalizes later on. The cells are fragmentized after crystallization. The red formazan inside the cell permeates to the solution. The intensity of this color indicates the intensity of enzyme activity (Çengel, 2004). 107
Prepared gelatin solution is given to soil for protease activity. After the soil is transformed into a suspension, it is filtrated. Ninhydrin is added; and it is heated. Ninhydrin positive samples (amino acids) yield blue color. This color intensity is measured photometrically, and it is calculated as amino-N (Çengel, 2004). Saccarase solution is given to soil samples to measure saccarase enzyme activity saccarase is digested in the soil by means of sucrose enzyme. Decomposition products are differentiated via Fehling solution. Using the difference between reducing and nonreducing Fehling differentiation solution, it is detected titrimetrically. The result is considered as saccarase activity (Çengel, 2004). Extracellular enzymes released by living soil microorganisms to digest organic matters.Extracellular enzymes completely released after the death of microorganisms. These are absorbed by inorganic and organic colloids (e.g. clays and humin) of soil. Absorbed enzymes are more durable against external influences compared to other enzymes. They can keep up with their activities for long periods of time (Haktanır & Arcak, 1996). Hence, with the influence of enzymes, organic wastes in soil, most of which are plantal, are divided into simple compounds with small molecules as a result of a series of enzymatic reactions. For instance, carbohydrase enzymes break cellulose, starch, and similar polysaccharides into disaccharides, and finally monosaccharides. Proteases hydrolyze protein elements into polypeptides, dipeptides, oligopeptides, and finally into amino acids. Pectin digester enzymes resolve pectin elements into simple products as well. The enzymes that are included in esterase group such as phosphatase, lipase, sulfatase, and tannase hydrolyze their nucleic acids, and other phosphate esters into phosphate anions. After many complicated reactions such as oxidization, reduction, hydrogenation, carboxylation, and nitrification, and with the influence of desmolase enzyme groups, these fragmentation products free ions of ammonium nitrate, phosphate, sulfate, calcium, potassium, sodium, and some other trace elements. As a result of these reactions, some of the fragmentation products that are transformed both into small closed molecules and ions fall prey to microorganisms (Arcak, 1987). 4. CONCLUSION and RECOMMENDATIONS Such advancement of the plants market made the researchers to be interested in various issues such as defining the distribution areas of plants (Yiğit, 2012; Atalay et al., 2014; Mutlu, Kutlu, Yanik & Demir, 2014a; Curebal et al., 2015; Šálek & Güney 2014); protection of plants (Canbulat 2015; Guney, Yigit, Seki, Ozturk & Akturk, 2015); cultivation of plants (Kravkaz Kuscu, 2008; Cetin & Sevik, 2016b); resistance of plants to stress factors (Sevik & Cetin, 2015; Yiğit, Sevik, Cetin & Kaya,N 2016); effects of water and water quality (Mutlu, Yanik, Akca, Kutlu & Sonmez, 2015); various areas of use (Yiğit, 2014) genetic variability of plants (Yiğit, Ayan & Sevik, 2010; Sevik & Topacoglu 2015; Sevik, Cetin & Kapucu 2016; Sevik, Yiğit & Topaçoğlu, 2015), their relationship with the environment (Kravkaz Kuscu, 2014; Cetin, 2015c; Cetin 2013; Kravkaz Kuscu & Karaöz 2010; Kravkaz Kuscu & Karaöz, 2015), thus resulting in various studies on these issues. Constituting the source of life in the world, plants are analyzed by many branches of science. There are studies dwelling on multiple aspects of plants. The studies generally focus on protection and diagnosis. However, plants have a mutual relationship with the environment they are in. Plant growth performance is closely associated with genetic structure of the plant as well as 108
climatic and edaphic factors. Therefore, plants are used as raw materials for foods or various branches of industry. In this sense, the studies dwelling on the increase in product quantity obtained from unit area should deal with climatic and edaphic factors in detail. Recent studies have revealed that soil enzymes influence soil fertility and plant growth to a great extent. The findings obtained from soil enzyme measurements are evaluated periodically as an indicator of soil fertility (Kiss et al., 1978). Soil enzyme activities have good potential to determine the health of living elements of soil, and total biological activity of soils. Soil enzyme trials may offer information regarding the soil potential in terms of conducting certain biochemical processes. Soil enzyme activities cover inorganic and organic soil improvements, and make successful differentiation between the soils under controlled conditions and highlydeteriorated areas. The role and the influence of each enzyme in soil is different. For instance, urease enzyme is held by organic and inorganic colloids of soils, and it is an extracellular enzyme catalyzing the carbon dioxide and ammonium hydrolyses of urea (Çengel, 2004). Catalase enzyme emerges as a result of metabolism events of living organisms and respiration. It resolves the hydrogen peroxide (H2O2) with cell toxin into water and oxygen (Çengel, 2004). Enzyme activity of soil is under the influence of many factors such as soil structure, plant variety, water quantity, and climatic conditions (Kuşcu, 2014). However, the relationship between the aforementioned factors and enzyme activity is not revealed thoroughly as the studies regarding soil enzymes are not adequate. Detailed studies in the future should dwell on the relationships between enzyme types and functions, enzymatic activities, and soil fertility as well as basic subjects such as the influence of climatic and edaphic factors on enzyme activity. In addition, the determination of the influence of culture maintenance operations such as fertilization, weeding, and irrigation on enzymatic activities is important for better definitions of soil enzymes, and their use to increase soil fertility. REFERENCES Altunel, T. (2010). Odun dişi orman ürünlerinin Dünya’da ve Türkiye’de sosyoekonomik boyutu. Doktora Tezi, İstanbul Üniversitesi, Fen Bilimleri Ens. İstanbul. Arcak, S. (1987). Toprak Organizmaları ve Enzimlerinin Toprak Verimliliğine Etkiler. Türkiye Tabiabalçıkı Koruma Derneği Toprak Semineri Sempozyumu, 132-194, İstanbul. Atalay, I. & Efe, R. (2010). Structural and Distributional Evaluation of Forest Ecosystems in Turkey. J Environ Biol. 31 (1–2), 61. Atalay, I. & Efe, R. (2012) Ecological Attributes and Distribution of Anatolian Black Pine [Pinus nigra Arnold. subsp. pallasiana Lamb.Holmboe)] in Turkey. J Environ Biol 33 (2), 509. Atalay, I.; Efe, R. & Ozturk, M. (2014). Ecology and Classification of Forests in Turkey. Procedia Social and Behavioral Science (Elsevier) 120, 788. Atalay, I. & Efe, R. (2015). Biogeography of Turkey, Meta Press. İzmir. ISBN 9786058784079. (in Turkish). Caldwell, B.A. (2005). Enzime Activities as a Component of Soil Biodiversity. A reviev. Pedobiologia 49, 637-644. Canbulat, S. (2015). Checklist of Turkish Raphidioptera on the basis of Distribution Pattern and Biogeographical Analysis. Turkish Journal of Zoology. 2015; 39(2): 225-234. Çengel, M. (2004). Toprak Mikrobiyolojisi. Ege Üniversitesi Ziraat Fakültesi Yayınları, 109
558:19-25, İzmir. Cetin, M. (2013). Chapter 27: Landscape Engineering, Protecting Soil, and Runoff Storm Water. Advances in Landscape Architecture. InTech, Ed: Murat Özyavuz, 2013, p. 697723. DOI: 10.5772/55812 Cetin, M. (2015a). Using GIS analysis to assess urban green space in terms of accessibility: case study in Kutahya. International Journal of Sustainable Development & World Ecology 2015; 22 (5): 420-424. DOI: 10.1080/13504509.2015.1061066 Cetin, M. (2015b). Consideration of permeable pavement in landscape architecture. Journal of Environmental Protection and Ecology 16 (1),385–392. Cetin, M. (2015c). Chapter 55: Using Recycling Materials for Sustainable LandscapePlanning. Environment and Ecology at the Beginning of 21st Century. Ed.: Prof. Dr. Recep Efe, Prof. Dr. Carmen Bizzarri, Prof. Dr. İsa Cürebal, Prof. Dr. Gulnara N. Nyusupova, ST. Kliment Ohridski University PRESS, Sofia; 2015. p. 783-788, ISBN: 978-954-07-3999-1. Cetin, M. (2016a). A Change in the Amount of CO2 at the Center of the Examination Halls: Case Study of Turkey. Studies on Ethno-Medicine 10: (2), 146–155. Cetin, M. (2016b). Peyzaj Çalışmalarında Kullanılan Bazı Bitkilerde Klorofil Miktarının Değişimi. Kastamonu Universitesi Orman Fakültesi Dergisi 16: (1), 239–245. Cetin, M. & Sevik, H. (2016a). Evaluating the Recreation Potential of Ilgaz Mountain National Park in Turkey. Environmental Monitoring and Assessment 2016; 188 (1): 52. DOI: 10.1007/s10661-015-5064-7 Cetin, M. & Sevik, H. (2016b). Chapter 5: Assessing Potential Areas of Ecotourism through a Case Study in Ilgaz Mountain National Park, Tourism - From Empirical Research Towards Practical Application. InTech, Eds:Leszek Butowski, pp.190, ISBN:978-95351-2281-4, Chapter pp. 81-110 Cetin, M. & Sevik, H. (2016c). Measuring the Impact of Selected Plants on Indoor CO2 Concentrations. Polish Journal of Environmental Studies 25: (3), 973–979. Chander K. & Brookes P.C. (1991). Is the dehydrogenase assay invalid as amethod to estimate microbial activity in copper contaminated soils,Soil Biol. Biochem. 23, 909-915 Curebal, I.; Efe, R.; Soykan, A. & Sönmez, S. (2015). Impact of Anthropogenic Factors on Land Degradation during Anthropocene in Turkey. J Environ Biol 36 (51–58), (2015). Das, S. K., & Varma, A. (2010). Role of enzymes in maintaining soil health. In Soil enzymology (pp. 25-42). Springer Berlin Heidelberg. Djukanovic, R.; Wargocki, P. & Fanger, P.O. (2002). Cost-benefit analysis of improved air quality in an office building. Proceedings of Indoor Air 2002: (1), 808-813. Efe, R. (2010). Biyocoğrafya. Marmara Kitap Yayınları, Busa, Turkey Ellert B.H.; Clapperton M.J. & Anderson D.W. (1997). An ecosystem perspective of soil quality. In: Gregorich EG, Carter MR (eds) Soil quality for crop production and ecosystem health. Elsevier, Amsterdam, pp 115–141 Guney, K.; Yigit, N.; Seki, N.; Ozturk, A. & Akturk, E.. (2015). Assessment of endemic plant taxa in Kastamonu province and classification by IUCN categories. IOSR Journal of Environmental Science, Toxicology and Food Technology (IOSRJESTFT) e-ISSN: 2319-2402,p- ISSN: 2319-2399.Volume 9, Issue 12 Ver. II (Dec. 2015), PP 00-00 www.iosrjournals.org Haktanır, K. & Arcak S. (1996). Enzimler, Özellikleri ve Topraktaki İşlevleri. A.Ü. Ziraat Fakültesi Yayınları: 79-94, Ankara Kiss, S.; Dragan-Bularda, M. & Radulescu, D. (1978). Soil polysaccharidases: activity and agricultural importance. In Soil enzymes (pp. 117-147). Academic Press
110
London. Kravkaz, İ. S., (2008). Kastamonu Yöresindeki Crocus spp.’nin Fenolojik Özellikleri”, Gazi üniversitesi, Fen Bilimleri Ens., Yüksel Lisans Tezi., Ankara. Kravkaz, Kuşcu, İ.; Karaöz, Ö., (2010). Toprak Enzimleri ve Özellikleri, International Conference on Organic Agriculture in Scope of Environmental Problems, Februaray 2010. Magosa, Kıbrıs. Kravkaz, Kuşcu İ. S. (2014). Kastamonu Yöresindeki Tarım-Mera-Orman Topraklarındaki Enzim (Katalaz- Üreaz) Aktivitelerinin Karşılaştırılması”, İstanbul Üniv. Fen Bilimleri Enstitüsü, Orman Mühendisliği Anabilim Dalı, Toprak İlmi ve Ekoloji Programı Doktora Tezi. Kravkaz, Kuşcu, İ.S.; Karaöz, Ö. (2015). Soil Enzymes and Characteristics. Internatıonal Journal of Engıneerıng Scıences & Research Technology. 4(1): January, 2015, ISSN: 2277-9655. Koçyiğit, R. (2011). Hayvansal Kompost ve Biyogaz Atıklarının Toprak Enzim Aktivitesine Etkisi, Gaziosmanpaşa Üniversitesi Proje Sonuç Raporu, Proje No:2011/73 Lohr, VI. & Pearson-Mims, C. (2000). Physical discomfort may be reduced in the presence of interior plants. HortTechnology 10 (1), 53-58. Mutlu, E.; Kutlu, B.; Demir, T.; Yanik, T. & Sutan, N.A. (2014). The Evaluation of Water Quality Parameters of Beydilli River (Hafik-Sivas). Journal of Selçuk University Natural and Applied Science, Special Issue 2nd International Conference on Environmental Science and Technology, Digital Proceeding of The ICOEST’2014-, SIDE, Turkey, May 14 – 17, 2014, 40-50 pp. Mutlu, E. & Tepe, A.Y. (2014). Yayladağı Sulama Göleti (Hatay) Suyunun Bazı Fiziksel ve Kimyasal Özelliklerinin İncelenmesi. Alinteri 27 (B)-2014, 18-23 Mutlu, E.; Yanik, T.; Akca, İ.; Kutlu, B. &Sonmez, A.Y. (2015). Determining the water quality of Lake Delice (İmranli-Sivas). Mar. Sci. Tech. Bull 4(2):11-19. Özdemir, N.; Kızılkaya, R. & Sürücü, A. (2000). Farklı organik atıkların toprakların üreaz enzim aktivitesi üzerine etkisi. Ekoloji Çevre Dergisi 10(37), 23-26. Šálek, L. & Güney, K. (2014). New host plant for the species Agapanthia lateralis Gangl.(Coleoptera; Cerambycidae). Entomological News 2014; 124 (1): 29-32. Şevik, H.; Yiğit, N. &Topaçoğlu, O., (2015). Taşköprü-Tekçam sariçam (Pinus sylvestris L.) konal tohum bahçesinde ibre ve dal karakterlerine bağli genetik varyasyon. Kastamonu University Journal of Engineering and Sciences 1(1):9-16, 2015, Kastamonu. Sevik, H. & Cetin, M. (2015). Effects of Water Stress on Seed Germination For Select Landscape Plants. Polish Journal of Environment Studies 24 (2): 689-693. Sevik, H. & Topacoglu, O. (2015). Variation and inheritance pattern in Cone and seed characteristics of Scots pine (Pinus sylvestris L.) for evaluation of genetic diversity. Journal of Environmental Biology 36 (5): 1125-1130 Sevik, H.; Cetin, M. & Kapucu, Ö. (2016). Effect of Light on Young Structures of Turkish Fir (Abies nordmanniana subsp. bornmulleriana). Oxidation Communications 39 (1–II): 485–492. Stevenson, F.J. (1986). Cycles of soil. Carbon, nitrogen, phosphorus, sulphur and micronutrients. Wiley, New York, pp 176–177. Tabatabai, M, A., Dick, W. (2002). Enzymes in Soil: Research and Developments in Measuring Activities. Enzymes in the environment, Editors; Burns, R, G, Dick, R, P.,ISBN: 0-8247-0614-5, 567-570, USA Turna, I. & Güney, D. (2009). Altitudinal variation of some morphological characters of Scots pine (Pinus sylvestris L.) in Turkey. African Journal of Biotechnology 8(2): 202208. 111
URL.1(2016).http://senr.osu.edu/sites/senr/files/imce/files/course_materials/enr6610/Sectio n02_Graphs.pdf (Erişim yılı,2016) Wiseman, A. (1987). Handbook of Enzymes Biotechnology. Second Edition. Chapter 3. The Application of Enzymes in Industry p. 274-373. Yiğit, N.; Ayan, S. & Sevik, H. (2010). Genetic variation in Taşköprü-Tekçam Scots Pine (Pinus sylvestris L.) clonal seed orchard according to some needles characters., BIORARE-2010, International Symposium on Biology of Rare and Endemic Plant Species, p.83, 26-29 May 2010, Fethiye, Turkey Yiğit, N. (2012). “Morfometrik Analiz Sistemi Kullanılarak Kastamonu Yöresi Meşelerinin Filogenetik Analizi”, Gazi Üniversitesi, Fen Bilimleri Ens. Doktora Tezi, Ankara Yiğit, N. (2014). “Some Non-Wood Forest Products of Kastamonu Region (Herbal Products Potential)”, International Journal of Pharmaceutical Science Invention (IJPSI) ISSN (Online): 2319 – 6718, ISSN (Print): 2319 – 670X www.ijpsi.org, Volume 3 Issue 12, December 2014, PP.42-45, 2014 Yiğit, N.; Öztürk, A. & Sevik, H. (2014). Ecological Impact of Urban Forests (Example of Kastamonu Urban Forest). International Journal of Engineering Sciences & Research Technology 3 (12): 558-562. Yiğit, N., Sevik, H., Cetin, M., Kaya, N. (2016), Chapter 3: Determination of the Effect of Drought Stress on the Seed Germination in Some Plant Species, Water Stress in Plants, Intech, Eds: Ismail Md. Mofizur Rahman, Zinnat Ara Begum, Hiroshi Hasegawa,126pp, ISBN:978-953-51-2621-8,Chapter page:43 -62, http://www.intechopen.com/books/ water-stress-in-plants/determination-of-the-effect-of-drought-stress-on-the-seed-germina tion-in-some-plant-species
112
Chapter 10 Micromorphological Studies on Plants and Their Importance Nurcan YIGIT FUNCTIONS AND CLASSIFICATIONS OF PLANTS Plants are the most important group of living beings in the world. They are vital for many other groups of living beings. Having spread nearly all around the world, plants have many various forms and structures as a result of living conditions, genetic structures, and phylogenetic characteristics (Akkemik, 2011). The science of botany refers to scientific research of plant structures. Namely, the term botany refers to a branch of biology that deals with plants and analyzes forms of life, characteristics, and biochemical processes of plants. This definition requires a complete comprehension of the concepts of “plantal” and “scientific research”. It is quite difficult to define and explain what a plant is. They have so many types, sizes, and variations that even a simple definition yields many exceptional situations (Mauseth, 2012; Taiz & Zeiger, 2008; Sarıbaş, 2008). Just as all the others living in the world, plants are also classified based on their relationships and similarity (Akkemik, 2011). The branch of science that categorizes the living beings according to their genetic, morphological, or other characteristics is called “taxonomy”. It was derived from combination of the Greek words “taksis” (organization) and namos (law) were referring to “law of organization”. Initial taxonomic studies made classifications based on morphological and genetic characteristics, degrees of relationship, and phylogeny (Akkemik, 2014). THE USE OF ELECTRON MICROSCOPE FOR PLANT CLASSIFICATION Systematic studies in botanic world constitute a basis to collect information in relation to the variety of viability, and categorize this information within itself, and reorganize it (Simpson, 2012). The branch of science dwelling on the external structures and physical forms of plants is known as “Plant Morphology” or “phytomorphology”. Generally, the main distinction between plant morphology and plant anatomy is that plant morphology studies plant tissues at microscopic level (URL-1, 2016). Plant morphology compares the same and similar types of plants at micro and macro levels, and analyzes their tissues, and external structures, somatic (body) and germ cells via electron microscope to study their development, growth, and origins (URL-1, 2016). In other words, plant morphology is a branch of science dealing with internal and external structures of the plants. It is intertwined with plant anatomy that studies cells and tissue structures of plant organs. The science of morphology is important for the definition and classification of taxa and their relation to certain groups. Micromorphological studies on plants enable micro-level analysis of pollens, leaves, tissues, seeds etc. of
Assist. Prof., Dr., Kastamonu University, Faculty of Forestry, Department of Forestry Engineering, Forest Botany, Kastamonu , Turkey
plants via scanning electron microscope (SEM). The term anatomy is generally used for plants analysis via light microscope or electron microscope with high capacity of identification (Simpson, 2012). Scanning electron microscope provides high zoom via high resolution imaging techniques. Therefore, it is possible to obtain morphological, structural, and elemental information from the plants at high zoom levels (URL-2, 2016). Plant terminology became more detailed and specific, and progressed following the invention of microscope (Simpson, 2012). There are two types of electron microscopes used for micromorphological studies and to identify the species systematically. These are Scanning Electron Microscope (SEM) and Transmission Electron Microscope (TEM) (Yiğit, 2012). The taxonomic problems that cannot be solved completely via the classification based only on classical morphology have been solved recently via the use of modern taxonomic parameters. Of these parameters, the anatomic and micromorphological characteristics are frequently used. The use of anatomic and micromorphological characteristics for certain groups of plants is of importance to eliminate the uncertainties regarding the classification (İçeli, 2011). Recently, there have been a need for data to support classical morphological data in order to comprehend the taxonomy of flowering plants in systematic studies, and to solve taxonomic problems that exist in many groups. Of these, genetic, anatomic, and micromorphological studies are most frequently studied parameters. Morphological characteristics of plants are obtained in numbers. They are analyzed according to these numbers; and the natural relationship among the plants are detected via this analysis. Unlike natural classification, statistical analyses are made for morphological identifications. Recently, phylogenetic classification has been used more frequently. In this type of classification, information obtained from various branches of biology such as micromorphology, genetics, cytology, and biochemistry as well as morphological characteristics are used; and the classification of plant kingdom is based on evolutionary relationships (Akkemik, 2014). HISTORICAL DEVELOPMENT OF THE USE OF ELECTRON MICROSCOPE Sample analysis via electron microscope is quite advantageous compared to other methods because there is no need for special preparations; and it yields higher quality images with high resolution. Scanning electron microscope was first designed by Knoll in Germany in 1935. His study was followed by others from Britain, France, and the USA (Bradford & Devaney, 1970). The electron microscope complying with the basic principles of the electron microscope that is currently used was put into use by Mc Mullan in 1953. The area of use of SEM is rather wide. Traces left by various vehicles, electrical accidents, analysis of the skin and hair after high voltage injuries, determination of age via injuries, the studies that are conducted with the hair of 4000year-old mummies, studies that are conducted with the teeth of cremated corpses, studies on thermal destruction of bones, comparisons of fiber and rope, bomb analyses, and identification of tree species are examples to its areas of use. In addition, SEM analyzes species classification of plants, leaf surface layer, stoma, trichomes and glandular hairs, and pollen structures. It is possible to make a long list of these examples (Böhm & Böhm, 1982; Gökdemir, 1995; Kim, Lee, Kim, Lee, & Park, 2011; 114
Kaya, 2011; Türkben, 2007; Huttunen et al., 2014; Stabentheiner et al., 2004). Electron microscopes, which have been improved to a great extent in recent years, are very special equipment that is hard to find in each laboratory. Electron microscope was employed to characterize and define leaf surface characteristics in many studies (Hardin, 1979; Bačić, 1981, Gellini, Bussotti, Bettini, Grossoni, & Bottacci, 1992, Merino, & García, 1994; Llamas, Perez‐Morales, Acedo, & Penas, 1995). These characteristics are very important for plant taxonomy studies. THE USE OF ELECTRON MICROSCOPE IMAGES IN OTHER STUDIES Plants are the source of life for living beings, and they carry out many functions at the places where they exist. In the place they grow, plants reduce air pollution (Tani & Hewitt, 2009; Efe, 2010; Atalay & Efe, 2010; Cetin, 2015a; Cetin, 2015b; Sevik, Cetin & Belkayali, 2015a; Cetin & Sevik 2016d; Açar, M.; Selvi, S. & Satıl, F. (2012); reduce noise (Yiğit, Öztürk & Sevik, 2014; Cetin, 2016a); increase aesthetic value (Sevik, Karakaş & Karaca, 2013; Sevik, Belkayalı & Aktar, 2014; Cetin, 2016b); non woods forest products (Altunel, 2010; Yaman ve Akyıldız, 2008; Altunel, 2011a; Altunel, 2011b) have a positive psychological effect (Atalay, Efe& Ozturk, 2014; Cetin, 2015c; Belkayalı, Güloğlu & Şevik, 2016); provide energy conservation (Cetin, Topay, Kaya & Yilmaz, 2010; Cetin, 2015c; Cetin, 2015d); prevent erosion (Turna & Güney 2009); reduce wind speed and hold the soil with their roots, thus preventing washing away of the soil with rainfalls and streams, and protect wildlife and hunting resources. Opengreen areas with plantation are important activity areas for both adults and children (Cetin & Sevik 2016a; Atalay & Efe, 2015; Mutlu, Yanik & Demir, 2013; Mutlu & Tepe, 2014). Besides, indoor plants increase the productivity of people working in the environment they grow in (Djukanovic, Wargocki & Fanger, 2002) as well as relieving physiological stress and reducing negative emotions (Chang & Chen 2005; Efe, 2010; Atalay& Efe, 2012; Lohr & Pearson-Mims, 2000; Sevik & Cetin, 2015). Such advancement of the plants market made the researchers to be interested in various issues such as defining the distribution areas of plants (Atalay et al., 2014;Mutlu, Kutlu, Yanik & Demir, 2014a; Mutlu, Kutlu, Yanik & Demir 2014b; Curebal, Efe, Soykan & Sönmez, 2015; Šálek & Güney 2014); protection of plants (Canbulat 2015; Kravkaz & Vurdu, 2010; Guney, Yigit, Seki, Ozturk & Akturk, 2015); cultivation of plants (Kravkaz Kuscu, 2008; Sevik & Güney, 2013; Cetin & Sevik, 2016b); resistance of plants to stress factors (Sevik & Cetin, 2015; Topacoglu, Sevik & Akkuzu, 2016a; Topacoglu et al., 2016b; Yiğit, Sevik, Cetin & Kaya, 2016); effects of water and water quality (Mutlu et al., 2014a; Mutlu et al., 2014b; Mutlu, Kutlu, Demir, Yanik & Sutan, 2014; Mutlu, Yanik, Akca, Kutlu & Sonmez, 2015); various areas of use (Yiğit et al., 2014; Kesik, Korkut, Hiziroglu & Sevik 2014); genetic variability of plants (Sevik,Yahyaoğlu & Turna, 2012; Güney, Hatipoğlu, Atar, Turna & Kulaç 2013; Güney, Yahyaoglu, Turna, Muller-Starck, 2014;Sevik & Topacoglu 2015, Turna & Güney 2009; Sevik, Cetin & Kapucu 2016b; Güney, Sevik, Cetin & Güney 2016), their relationship with the environment (Kravkaz, Kuscu, 2014; Kaya, Cetin & Doygun, 2009; Cetin et al., 2010; Cetin, 2015e; Cetin 2013a; Cetin 2013b; Kravkaz Kuscu & Karaöz 2010; Kravkaz Kuscu & Karaöz, 2015), thus resulting in various studies on these issues. Plants carry out these functions when leaves adapt to dynamic structure and environmental conditions. This adaptation takes place thanks to their plasticity and/or 115
adaptation skills (Gonzalez-Rodriguez and Oyama, 2004). Leaves are one of the organs that play an important role for plantal reproduction (Bruschi, Grossoni, & Bussotti, 2003). Leaf morphology plays an important role for photosynthesis as well as heat propagation and light intake. Since forest trees exist with different light intensities at different layers within the ecosystem, leaf morphology has various forms and sizes (Heredia et al., 2009). Leaf cuticular wax layer, the structures of leaf trichomes and glandular hairs, and stoma structures differ from one another both between and within species (Gökdemir, 1995; Kim et al., 2011; Kaya, 2011; Türkben, 2007; Huttunen et al., 2014; Stabentheiner et al., 2004; Aktaş, Şengonca, Özdemir & Civeyrel 2012; Kuş, Akçin & Güney 2012; Bačić, Krstin, Roša, & Popović et al., 2005) SOME STUDIES CONDUCTED ON TREE SPECIES USING ELECTRON MICROSCOPE IMAGES Quercus species constitute an interesting example to study leaf morphology. This is because the species show variation at rather high levels. It was seen that there are variations among various types of oaks, the populations that belong to the same species, the individuals that belong to the same population, and even between the leaves that are among the branches of the same individual (i.e. tree). There is an astonishing level of variation between broad-leaved trees in terms of shapes and sizes. Quercus is one of the dominant tree species prevalent in temperate forests that govern majority of northern hemisphere. The variation in its leaf size as well as the differences in lobulation are obvious. However, the leaf form is largely associated with environmental, and basically, the climatic conditions (Blue & Jensen, 1988; Bruschi et al., 2003). Oskay & Eş (2015) made a systematic contribution to the taxa that belong to Erodium species through their study. Moreover, they evaluated the mericarp structures in micromorphological terms with an innovative study. Selvi, Dirmenci, Satıl, Özcan & Erdoğan (2014) conducted micromorphological and anatomic studies on sect. Clinopodium and sect. Pseudomelissa species, which are prevalent in Turkey, they stated that both sections bear similar anatomic characteristics. Selvi et al. (2014) calculated micro anatomic measurements in cells and tissues of Thymus pulvinatus and Thymus cherlerioides (Lamiaceae) species, which grow on Mount Ida (Edremit/ Balıkesir). Yılmaz, Kaynak, & Yılmaz (2012) micromorphologically determined the hairs on the bodies, leaves, and fruits as well as the wax surface on the fruits of 17 taxa that belong to Alyssum (Brassicaceae), which is prevalent in Bursa and its neighborhood. Özdemir, Akçin & Kolcu (2012) conducted morphological, micromorphological, and anatomic studies on Myosotis (Boraginaceae), which is prevalent in Black Sea Region, to reveal characteristics that can be used for the systematic study of the species. This study aimed at eliminating the problems in identification of the species, and to guide other studies that will dwell on other relevant species. Akçin, Akbulut, Şenel, & Pelit (2012) conducted anatomic, morphological, and micromorphological studies on holoparasite Orobanche minor (Orobanchaceae) species to reveal characteristics to be used in the systematic studies of the plant. Aktaş et al. (2012) analyzed the pollen and seed micromorphology of Verbascum pycnostachyum (Scrophulariaceae) species for the first time. Kuş et al., (2012) conducted a micromorphological study on the fruits of Lappula barbata (Boraginaceae) species, which is prevalent in Central Black Sea Region. They stated that the structures of glossitis on the fruits, number of order, and fruit surface features are taxonomically 116
important. Satıl, Ünal & Sefalı (2012) studied three species that belong to Chorispora (Brassicaceae) category. They compared the leaf and seed micromorphologies of these three species. They tried to reveal distinctive characteristics in systematic terms. Kaya and Kaya (2008) asserted that seed surface micromorphology is a distinctive characteristic for taxonomic classification of certain Centaurea L. species. The samples are adhered onto the aluminum discs with double-side carbon bands, and fixed in order to make them ready to be scanned and shot on electron microscope. The fixed samples are covered with gold. Following this operation, the analysis and the shootings are made via scanning electron microscope. Microphotographs of the images obtained from the analyzed samples are taken via appropriate applications; micrometric measurements are made; and they are transferred to digital environment. Many data were collected regarding the importance of micromorphology taking into account the micromorphological studies conducted via SEM on plants. Seed characteristics are important markers in taxonomic terms. It is believed that seed shape and seed surface micromorphology can be useful in distinguishing the species. Testa and seed surface showed differences according to species. Seed surface characteristics that can be important for systematic identification of the species were revealed. Pollen type and forms are two of the the structures that may vary depending on the taxa. They contribute much to the systematic identification of the species. Oskay & Eş (2015) conducted a micromorphological analysis on mericarps of annual Erodium taxa, and revealed variations. Figure 1 shows the examples.
Figure 1. SEM images of mericarp surface of E. hoefftianum, a-Overall view of mericarp surface, b-Close-up of mericarp surface long and short hairs, c-Close-up of mericarp pit, dCapitate papillae in mericarp pit (Oskay & Eş, 2015).
It was observed that stoma types, layers in the median vein, the structures and numbers of vascular bundles, and trichomes and glandular hairs in transverse and surface facets, which are collected from the hair structures of the leaves, can be distinctive characteristics. Leaf and fruit characteristics are distinctive criteria for taxon 117
classification. It is beyond doubt that contributions to systematic studies will be helpful to identify close species. Leaf epiderm, stoma, and hair characteristics show difference according to the analyses conducted via SEM. It was stated that the structures of glossitis on the fruits, number of order, and fruit surface features are taxonomically important in relation to micromorphological analysis of the fruits (Oskay & Eş, 2015). Figure 2 shows electron microscope samples regarding various types of oak species.
Figure 2. a-b: Quercus sp. Upper level of the leaf, c: Quercus sp. Hair structures and stomas in the lower level of the leaf, d-e-f: Quercus sp. Stoma and hair images from the lower surface of the leaf
CONCLUSION AND RECOMMENDATIONS Plants are the most important group of living beings in the world. They are vital for many other groups of living beings. Basically, the life for living beings depends on the existence of plants. Having spread nearly all around the world, plants gained many 118
various forms and structures as a result of living conditions, genetic structures, and phylogenetic characteristics. These structures and the changes that take place due to conditions in the growth place are generally visible changes; yet, it is not possible to observe the micro-level changes through the naked eye. However, many previous studies that have been conducted so far including those defining and classifying the plants, determining the genetic variety, and revealing the reactions and resistance against stress factors were based on morphological characteristics while micro-level analysis of plant structures yield way too healthier results in the aforementioned areas of study. It is clear that many structures or characteristics of plants that look the same or similar when analyzed morphologically indeed differ from one another when micromorphological analysis is conducted via scanning electron microscope. In this sense, micromorphological analyses are useful to distinguish and identify the current species while detecting the new species and taxa. In addition, they offer important opportunities to understand the structures of the plants better. Therefore, electron microscope is used for many areas of study, and new areas of use are added to this list each day. REFERENCES Açar, M.; Selvi, S. & Satıl, F. (2012). Kazdağları’nda (Balıkesir, Çanakkale) Yetişen İki Thymus Türü (T. pulvinatus ve T. cherlerioides, Lamiaceae) Üzerinde Karşılaştırmalı Anatomik ve Mikromorfolojik Araştırmalar. 21. Ulusal Biyoloji Kongresi. İzmir. Akçin, Ö.E.; Akbulut, M.K.; Şenel, G. & Pelit, B. (2012). Holoparazit Orobanche minor (Orobanchaceae) Türü Üzerinde Anatomik, Morfolojik ve Mikromorfolojik Bir Araştırma. 21. Ulusal Biyoloji Kongresi, (s. 430). İzmir. Akkemik, Ü. (2011). Bitki Materyali (Gymnospermae) Ders Notları, İ.Ü, Orman Fak., 2011. Akkemik, Ü. (2014). Türkiye’nin doğal-Egzotik Ağaç ve Çalıları. I. Orman Genel Müdürlüğü yayınları, Ankara. Aktaş, K.; Şengonca, N.; Özdemir, C. & Civeyrel, L. (2012). Verbascum pycnostachyum (Scrophulariaceae) Üzerinde Mikromorfolojik Bir Çalışma. 21. Ulusal Biyoloji Kongresi, (s. 459). İzmir. Altunel, T., (2010). Odun Dışı Orman Ürünlerinin Dünya’da ve Türkiye’de Sosyoekonomik Boyutu, Doktora Tezi, İstanbul Üniversitesi, Fen Bilimleri Ens. İstanbul. Altunel, T., (2011a). Odun Dışı Orman Ürünlerinin Değerlendirilmesinde Dünya’dan Örnekler. 2. Uluslararası Odun Dışı Orman Ürünleri Sempozyumu, 8-10 Eylül 2011, Isparta. Altunel, T., (2011b). Odun Dışı Orman Ürünlerinin Geçmişi, Bugünü ve Geleceği. 1. Ulusal Akdeniz Orman ve Çevre Sempozyumu, 26-28 Ekim 2011, Kahramanmaraş. Atalay, I. & Efe, R. (2010). Structural and Distributional Evaluation of Forest Ecosystems in Turkey. J Environ Biol. 31 (1–2), 61. Atalay, I. & Efe, R. (2012) Ecological Attributes and Distribution of Anatolian Black Pine [Pinus nigra Arnold. subsp. pallasiana Lamb.Holmboe)] in Turkey. J Environ Biol 33 (2), 509 (2012). Atalay, I.; Efe, R. & Ozturk, M. (2014). Ecology and Classification of Forests in Turkey. Procedia Social and Behavioral Science (Elsevier) 120, 788. Atalay, I. & Efe, R. (2015). Biogeography of Turkey, Meta Press. İzmir. ISBN 9786058784079. (in Turkish). Bačić, T. (1981). Investigations of Stomata of Three Oak Species With Light and Scanning
119
Electron Microscope. Acta Botanica Croatica, 40(1), 85-90. Bačić, T.; Krstin, L.; Roša, J. & Popović, Ž. (2005). Epicuticular Wax on Stomata of Damaged Silver Fir Trees (Abies alba Mili.). Acta Societatis Botanicorum Poloniae, 74(2), 159-166. Belkayalı, N.; Güloğlu, Y. & Sevik, H. (2016). What Affects Perceptions of Local Residents Toward Protected Areas? A Case Study From Kure Mountains National Park, Turkey. International J. of Sustainable Development & World Ecology 23:(2),194–202. Blue, M.P. & Jensen, R.J. (1988). Positional and Seasonal Variation in oak (Quercus; Fagaceae) Leaf Morphology. American Journal of Botany, 939-947. Bradford, L. W. & Devaney, J. (1970). Scanning Electron Microscopy Applications in Criminalistics. Journal of forensic sciences, 15(1), 110-119. Bruschi, P.; Grossoni, P. & Bussotti, F. (2003). Within-and among-tree variation in Leaf Morphology of Quercus petraea (Matt.) Liebl. Natural Populations. Trees, 17(2), 164172. Cetin, M.; Topay, M.; Kaya, LG. & Yilmaz, B. (2010). Biyoiklimsel Konforun Peyzaj Planlama Sürecindeki Etkinliği: Kütahya Örneği. Süleyman Demirel Üniversitesi Orman Fakültesi Dergisi 1: (1), 83–95. Cetin, M. (2013a). Chapter 27: Landscape Engineering, Protecting Soil, and Runoff Storm Water. Advances in Landscape Architecture. InTech, Ed: Murat Özyavuz, 2013, p. 697723. DOI: 10.5772/55812 Cetin, M. (2013b). Sert zemin Tasarim ve Uygulamalarinda Yeni Bir Yaklaşim Plastiğin Kullanilmasi. TMMOB Peyzaj Mimarlari Odasi Peyzaj Mimarlığı Derg. 2013:(1),65–72. Canbulat, S. (2015). Checklist of Turkish Raphidioptera on the Basis of Distribution Pattern and Biogeographical Analysis. Turkish Journal of Zoology. 2015; 39(2): 225-234. Cetin, M. (2015a). Using GIS analysis to Assess Urban Green Space in Terms of Accessibility: Case Study in Kutahya. International Journal of Sustainable Development & World Ecology 2015; 22 (5): 420-424. DOI: 10.1080/13504509.2015.1061066 Cetin, M. (2015b). Evaluation of the Sustainable Tourism Potential of a Protected Area For Landscape Planning: a Case Study of The Ancient City of Pompeipolis in Kastamonu. International Journal of Sustainable Development & World Ecology 2015; 22 (6): 490495. DOI: 10.1080/13504509.2015.1081651 Cetin, M. (2015c). Determining the Bioclimatic Comfort in Kastamonu City. Environmental Monitoring and Assessment. 2015; 187 (10): 640. DOI: 10.1007/s10661-015-4861-3 Cetin, M. (2015d). Consideration of Permeable Pavement in Landscape Architecture. Journal of Environmental Protection and Ecology 16 (1),385–392. Cetin, M. (2015e). Chapter 55: Using Recycling Materials for Sustainable Landscape Planning. Environment and Ecology at the Beginning of 21st Century. Ed.: Recep Efe, Carmen Bizzarri, İsa Cürebal, Gulnara N. Nyusupova, ST. Kliment Ohridski University PRESS, Sofia; 2015. p. 783-788, ISBN: 978-954-07-3999-1. Cetin, M. (2016a). A Change in the Amount of CO2 at the Center of the Examination Halls: Case Study of Turkey. Studies on Ethno-Medicine 10: (2), 146–155. Cetin, M. (2016b). Peyzaj Çalışmalarında Kullanılan Bazı Bitkilerde Klorofil Miktarının Değişimi. Kastamonu Universitesi Orman Fakültesi Dergisi 16: (1), 239–245. Cetin, M. & Sevik, H. (2016a). Evaluating The Recreation Potential of Ilgaz Mountain National Park in Turkey. Environmental Monitoring and Assessment 2016; 188 (1): 52. DOI: 10.1007/s10661-015-5064-7 Cetin, M. & Sevik, H. (2016b). Chapter 5: Assessing Potential Areas of Ecotourism through a Case Study in Ilgaz Mountain National Park, Tourism - From Empirical Research 120
Towards Practical Application. InTech, Eds:Leszek Butowski, pp.190, ISBN:978-95351-2281-4, Chapter pp. 81-110 Cetin, M. & Sevik, H. (2016d). Measuring the Impact of Selected Plants on Indoor CO2 Concentrations. Polish Journal of Environmental Studies 25: (3), 973–979. Cetin, M.; Topay, M.; Kaya, LG. & Yilmaz, B. (2010). Biyoiklimsel Konforun Peyzaj Planlama Sürecindeki Etkinliği: Kütahya örneği. Süleyman Demirel Üniversitesi Orman Fakültesi Dergisi 1: (1), 83–95. Chang, C. & Chen, P. (2005). Human Response to Window Views and Indoor Plants in The Workplace. HortScience 2005; 40: 1354-1359. Curebal, I.; Efe, R.; Soykan, A. & Sönmez, S. (2015). Impact of Anthropogenic Factors on Land Degradation during Anthropocene in Turkey. J Environ Biol 36 (51–58), (2015). Efe, R. (2010). Biogeography. MKM Publishing, ISBN 978-605-5911-21-8, Bursa (2010) (in Turkish). Gellini, R.; Bussotti, F.; Bettini, D.; Grossoni, P. & Bottacci, A. (1992). Species of the genus Quercus in Italy: Characterization By Means of Leaf Surface Observation. Plant Biosystem, 126(3-4), 481-504. Djukanovic, R.; Wargocki, P. & Fanger, P.O. (2002). Cost-benefit analysis of Improved Air Quality in an Office Building. Proceedings of Indoor Air 2002: (1), 808-813. Gonza´lez-Rodrı´guez, A., Oyama, K., (2005). Leaf Morphometric Variation in Quercus affinis and Q. laurina (Fagaceae), two hybridizing Mexican red oaks. Bot. J. Linn. Soc. 147, 427–435. Gökdemir, K. (1995). Elektron Mikroskobu İle Kriminal Olayların Aydınlatılması. İçişleri Bakanlığı Emniyet Genel Müdürlüğü, Kriminal Polis Laboratuvarları Daire Başkanlığı. Ankara. Güney, D.; Hatipoğlu, E.; Atar, F.; Turna, İ. & Kulaç, Ş. (2013). Changes of Some Morphological Characteristics of Oriental Hornbeam (Carpinus orientalis Miller) seeds depending on altitude. In International Caucasia Forestry Symposium 2013, July Güney, D.; Yahyaoglu, Z.; Turna, I. & Muller-Starck, G. (2014). Genetic Variation in Pinus brutia in Turkey. Fresenius Environmental Bulletin 2014; 23 (5): 1249-1254. Guney, K., Yigit, N., Seki, N., Ozturk, A., Akturk, E., “Assessment of Endemic Plant Taxa in Kastamonu Province and Classification By IUCN Categories” IOSR Journal of Environmental Science, Toxicology and Food Technology (IOSR-JESTFT) e-ISSN: 2319-2402,p- ISSN: 2319-2399.Volume 9, Issue 12 Ver. II (Dec. 2015), PP 00-00
www.iosrjournals.org Güney, K.; Cetin, M.; Sevik, H. & Guney, B.K. (2016). Influence of Germination Percentage and Morphological Properties of Some Hormones Practice on Lilium martagon L. seeds, Oxidation Communications 39: (1–II), 466–474. Hardin, J. W. (1979). Atlas of Foliar Surface Features in Woody Plants, I. Vestiture and Trichome Types of Eastern North American Quercus. Bulletin of the Torrey Botanical Club, 313-325. Heredia, U., L., Valbuena-Caraban˜a, M., Co´rdoba, M., Gil, L., “Variation Components in Leaf Morphology of Recruits of Two Hybridising Oaks [Q. petraea (Matt.) Liebl. and Q. pyrenaica Willd.] at Small Spatial Scale” Eur J Forest Res, 128:543–554 DOI 10.1007/s10342-009-0302-6, (2009). Huttunen, S.; Bytnerowicz, A.; Arbaugh, M. J.; Bent, K.; Karhu, M. & Tuohimaa, P. (2014). Diagnostics of Epistomatal Wax of Californian Pine Needles, and Their Association with Ozone-Caused Chlorotic Mottle.American Journal of Plant Sciences, 5(12), 1733 -1744, Published Online May 2014 in SciRes. http://www.scirp.org/journal/ajps, 121
http://dx.doi.org/10.4236/ajps.2014.512188. İçeli, M. (2011). Türkiye’de Yayılış Gösteren Endemik Stachys pumila ve Stachys citrina Türleri Üzerine Karşılaştırmalı Anatomik ve Mikromorfolojik Çalışmalar. Selçuk Üniversitesi, Eğitim Bilimleri Enstitüsü, Ortaöğretim Fen ve Matematik Alanlar Eğitimi ABD. Yüksek Lisans Tezi, Konya Kaya L.G.; Cetin M. & Doygun H. (2009). A holistic Approach in Analyzing the Landscape Potential: Porsuk Dam Lake and its environs, Turkey. Fresenius Environmental Bulletin. 2009; 18 (8), 1525-1533. Kaya, A. & Kaya, Z. (2008). Bazı Centaurea L. Türlerinin Tohum Yüzey Mikromorfolojisi. 19.Ulusal Biyoloji Kongresi , s. 438. Kaya, A. (2011). Morphological, Anatomical and Trichomes Properties of Salvıa wiedemannii boıss. Endemıc to Turkey, Turk J. Pharm. Sci. 8 (3), 227-238. Kesik, H.I.; Korkut, S.; Hiziroglu, S. & Sevik H. (2014). An evaluation of properties of four heat treated wood species. Industrial Crops and Products 2014; 60: 60-65. Kim, W.K.; Lee, I.J.; Kim, C.S.; Lee, D.K. & Park, E.W. (2011). Micromorphology of Epicuticular Waxes and Epistomatal Chambers of Pine Species by Electron Microscopy and White Light Scanning Interferometry. Microsc. Microanal. 17, 118–124, doi: 10.1017/S1431927610093967. Microscopy Society of America. Kravkaz, i. S., (2008), “Kastamonu Yöresindeki Crocus spp.’nin Fenolojik Özellikleri”, Gazi üniversitesi, Fen Bilimleri Ens., Yüksel Lisans Tezi., Ankara. Kravkaz Kuşcu, İ.S., Karaöz, Ö. (2010). Toprak Enzimleri ve Özellikleri, International Conference on Organic Agriculture in Scope of Environmental Problems, Februaray 2010. Magosa, Kıbrıs. Kravkaz Kuşcu İ.S., Karaöz, Ö., (2015). Soil Enzymes and Characteristics. Internatıonal Journal of Engıneerıng Scıences & Research Technology. 4(1): January, 2015, ISSN: 2277-9655. Kravkaz, İ.S., Vurdu, H., (2010). Botany of Crocus ancyrensis through domestication. 3rd IS on Saffron, Eds.; M.Z. Tsimidou et al., Acta Hort. 850, ISHS 2010; P: 61-65. Kravkaz Kuşcu, İ.S., (2014). Kastamonu Yöresindeki Tarım-Mera-Orman Topraklarındaki Enzim (Katalaz- Üreaz) Aktivitelerinin Karşılaştırılması. İstanbul Üniversitesi. Fen Bilimleri Ens., Doktora Tezi., İstanbul. Kuş, S.; Akçin, Ö.E., & Güney, Ş. (2012). Orta Karadeniz Bölgesi’nde Yayılış Gösteren Lappula barbata (Boraginaceae) Türünün Anatomik ve Mikromorfolojik Özellikleri. 21. Ulusal Biyoloji Kongresi, (s. 542). İzmir. Llamas, F.; Perez‐Morales, C.; Acedo, C. & Penas, A. (1995). Foliar trichomes of the evergreen and semi‐deciduous species of the genus Quercus (Fagaceae) in the Iberian Peninsula. Botanical Journal of the Linnean Society, 117(1), 47-57. Lohr, VI. & Pearson-Mims, C. (2000). Physical Discomfort May be Reduced in The Presence of Interior Plants. HortTechnology 10 (1), 53-58. Mauseth. J.D., (2012). Botanik, Bitki Biyolojisine Giriş-Botany An Introduction To Plant Biology”, Çeviri edt: Hasan Çetin Özen, Murat Biricik, ISBN: 978-605-133-302-1, Nobel Yayıncılık No: 400, Ankara. Mutlu, E.; Yanik, T. & Demir, T. (2013). Horohon Deresi (Hafik-Sivas) Su Kalitesi Özelliklerinin Aylik Değişimleri. Alinteri 25(B)-2013, 45-57 Mutlu, E. & Tepe, A.Y. (2014). Yayladağı Sulama Göleti (Hatay) Suyunun Bazı fiziksel ve Kimyasal Özelliklerinin İncelenmesi. Alinteri 27 (B)-2014, 18-23 Mutlu, E.; Kutlu, B.; Yanik, T. & Demir, T. (2014a). Evaluation of Water Quality of Karacalar Dam (Ulaş-Sivas) by using, physico-chemical methods. Journal of Selçuk University Natural and Applied Science Special Issue 2nd International Conference on 122
Environmental Science and Technology, Digital Proceeding of The ICOEST’2014 - , SIDE, Turkey, May 14 – 17, 2014, 30-40 pp.. Mutlu, E.; Kutlu, B.; Yanik, T. & Demir, T. (2014b). Faraz Stream (Hafik-Sivas) water quality characteristics and monthly variations. Standard Scientific Research and Essays 2(11): 587-594. Mutlu, E.; Kutlu, B.; Demir, T.; Yanik, T. & Sutan, N.A. (2014). The Evaluation of Water Quality Parameters of Beydilli River (Hafik-Sivas). Journal of Selçuk University Natural and Applied Science, Special Issue 2nd International Conference on Environmental Science and Technology, Digital Proceeding of The ICOEST’2014-, SIDE, Turkey, May 14 – 17, 2014, 40-50 pp. Mutlu, E.; Yanik, T.; Akca, İ.; Kutlu, B. &Sonmez, A.Y. (2015). Determining the Water Quality of Lake Delice (İmranli-Sivas). Mar. Sci. Tech. Bull 4(2):11-19. Böhm, E. & Böhm, I. (1982). Bibliography of Scanning Electron Microscopy Application in Forensic Medicine. Scanning Electron Microscopy, (Pt 1), 305-309. Oskay, D. & Eş, Ö. (2015). Bazı Tek Yillik Erodium Taksonlarinin Merikarplari Üzerinde Mikromorfolojik İncelemeler. CBÜ Fen Bil. Dergisi Cilt 11, Sayı 2, , 135-142 s. Özdemir, G.; Akçin, Ö.E. & Kolcu, S.S. (2012). Karadeniz Bölgesinde Yayılış Gösteren Bazı Myosotis (Boraginaceae) Türleri Üzerinde Morfolojik, Mikromorfolojik ve Anatomik Bir Araştırma. 21. Ulusal Biyoloji Kongresi, (s. 460). İzmir. Merino, Á. P. & García, F. L. (1994). Aportaciones al Conocimiento Del Género Quercus En La Cordillera Cantábrica: I. Tricomas foliares de las Especies Caducifolias. Lagascalia, 17(2), 311-324. Šálek, L. & Güney, K. (2014). New host plant for the species Agapanthia lateralis Gangl.(Coleoptera; Cerambycidae). Entomological News 2014; 124 (1): 29-32. Sarıbaş, M. (2008). Dendroloji I Gymnospermae. ISBN: 978-975-387-101-3, Dönmez Ofset, 2008, Bartın. Satıl, F.; Ünal, M. & Sefalı, A. (2012). Türkiye’deki Chorispora (Brassicaceae) Türlerinin Yaprak ve Tohum Mikromorfolojisi. 21. Ulusal Biyoloji Kongresi, (s. 136). İzmir. Selvi, S.; Dirmenci, T.; Satıl, F.; Özcan, T. & Erdoğan, E. (2014). Türkiye’de Yayılış Gösteren Clinopodium (Lamiaceae) Cinsi (sect. Clinopodium ve sect. Pseudomelissa ) Türleri Üzerinde Mikromorfolojik ve Anatomik Araştırmalar. 22. Ulusal Biyoloji Kongresi, (s. 637). Eskişehir. Simpson, M.G. (2012). Bitki Sistematiği - Plant Systematic, ISBN: 978-605-133-350-2, Çeviri Edt. Zeki Aytaç, Nobel Yayıncılık No: 448, s. 452, 515, 2012. Ankara. Stabentheiner, E.; Pfeifhofer, H. W.; Peters, J.; Jiménez, M. S.; Morales, D. & Grill, D. (2004). Different Surface Characteristics of Primary and Secondary Needles of Pinus canariensis. Flora-Morphology, Distribution, Functional Ecology of Plants, 199(2), 9099. Sevik, H., & Guney, K. (2013). Effects of IAA, IBA, NAA, and GA3 on Rooting and Morphological Features of Melissa officinalis L. Stem Cuttings.The Scientific World Journal, 2013. Sevik, H. & Cetin, M. (2015). Effects of Water Stress on Seed Germination For Select Landscape Plants. Polish Journal of Environment Studies 24 (2): 689-693. Sevik, H.; Cetin, M. & Belkayali, N. (2015a). Effects of Forests on Amounts of CO2: Case Study of Kastamonu and Ilgaz Mountain National Parks. Polish Journal of Environmental Studies 24(1): 253-256. Sevik, H.; Karakaş, H. & Karaca, Ü. (2013). Color - Chlorophyll Relationship of Some Indoor Ornamental Plant. International Journal of Engineering Science & Research Technology 2(7), 1706-1712. 123
Sevik, H.; Belkayalı, N. & Aktar, G. (2014) Change of Chlorophyll Amount in Some Landscape Plants. Journal of Biotechnological Sciences 2014; 2(1): 10-16. Sevik, H.; Yahyaoğlu, Z. & Turna, İ. (2012). Determination of Genetic Variation Between Populations of Abies nordmanniana subsp. bornmulleriana Mattf According to some Seed Characteristics. Genetic Diversity in Plants, InTech, Editör:Mahmut Çalışkan, pp.510, ISBN:978-953-51-0185-7, pp. 231 -248 Sevik, H. & Topacoglu, O. (2015). Variation and Inheritance Pattern in Cone and Seed Characteristics of Scots pine (Pinus sylvestris L.) for evaluation of genetic diversity. Journal of Environmental Biology 36 (5): 1125-1130 Sevik, H.; Cetin, M. & Kapucu, Ö. (2016b). Effect of Light on Young Structures of Turkish Fir (Abies nordmanniana subsp. bornmulleriana). Oxidation Communications 39 (1–II): 485–492. Taiz, L.; Zeiger, E. (2008). Bitki Fizyolojisi. çeviri edt: İsmail Türkan, ISBN: 0-87893-8230, Palme Yayıncılık No: 455, s.1, Ankara. Tani, A. & Hewitt, C. N. (2009). Uptake of Aldehydes & Ketones At Typical Indoor Concentrations by Houseplants. Environmental Science and Technology 43 (21), 8338– 8343. Topacoglu, O.; Sevik, H. & Akkuzu, E. (2016a). Effects of water stress on germination of Pinus nigra subsp. pallasiana Arnold. Seeds. Pakistan Journal of Botany. 48(2): 447453. Topacoglu, O.; Sevik, H.; Güney, K.; Ünal, C.; Akkuzu, E.& Sıvacıoğlu, A. (2016b). Effect of Rooting Hormones on The Rooting Capability of Ficus benjamina L. Cuttings. Šumarski list, 2016, (1–2), 39–44. Turna, I. & Güney, D. (2009). Altitudinal variation of some morphological characters of Scots pine (Pinus sylvestris L.) in Turkey. African Journal of Biotechnology 8(2): 202208. Türkben, C. (2007). Bitkilerde Yüzey Mumu (Epikutikular Mum) ve Meyvelerdeki Önemi. U. Ü. Ziraat Fakültesi Dergisi, Cilt 21, Sayı 2, 21-26, (Journal of Agricultural Faculty of Uludag University). URL-1 (2016). Adminastör. Biyoloji.org. 2016 tarihinde http://biyolojik.org/botanik/111bitki-morfolojisi adresinden alındı. URL-2 (2016). Maden Tetkik ve Arama Genel Müdürlüğü. 2016 tarihinde alındı. http://www.mta.gov.tr/v2.0/birimler/laboratuvarlar/index.php?id=Taramali. Yaman, K., & Akyıldız, H., (2008). Kastamonu’da Yetişen Bazı odun Dışı Orman ürünlerinin Toplama, İşleme ve Pazarlama Maliyetleri. Kastamonu ün. Orman Fakültesi Dergisi, 8 (1), 26-36. Kastamonu. Yılmaz, A.; Kaynak, G. & Yılmaz, Ö. (2012). Bursa ve Çevresinde Yayılışı Olan Alyssum (Brassicaceae) Türlerinin Bazı Mikromorfolojik Özelliklerinin S.E.M. ile Belirlenmesi. 21. Ulusal Biyoloji Kongresi, (s. 673). İzmir. Yiğit, N., 2012., “Morfometrik Analiz Sistemi Kullanılarak Kastamonu Yöresi Meşelerinin Filogenetik Analizi”, Gazi Üniversitesi, Fen Bilimleri Ens. Doktora Tezi, Ankara Yiğit, N.; Öztürk, A. & Sevik, H. (2014). Ecological Impact of Urban Forests (Example of Kastamonu Urban forest). International Journal of Engineering Sciences & Research Technology 3 (12): 558-562.
124
Chapter 11 Environmentally Friendly Alternative Pulp and Paper Technologies Halil Turgut ŞAHİN* 1. HISTORICAL DEVELOPMENTS OF PAPER According to archeological findings, Egypt was the first nation to use cellulosic material as a writing media, where around 3000 B.C. They were developed a matrix structure of thin papyrus reeds, known as ‘papyrus’ as a writing material. However, around the year 105 A.D. Ts'ai Lun, succeeded in making paper with the bark of mulberry trees treated with lime, bamboo, and cloth to produce sheet in China. Hence, Ts'ai Lun has considered the founder of papermaking with his success. Since then, the paper recipe was carefully preserved for centuries by the Chinese rulers. Therefore, after the first paper produced about 500 years later, it reach to Asia and Japan, then Central Asia, Arabia and most recently as the year 1100’s into Europe and the American continents (Biermann, 1993; Scott and Abbot, 1995). Paper, despite reaching the European continent nearly a thousand years later, the development of raw material use and major technological developments were made in Europe and in the United States. Some of the important developments could be summarized as; In 1798, the first paper machine built in France, In 1840, the first mechanical wood pulp process (SGW) invented in Germany, In 1851, the soda chemical pulping process invented in UK, In 1867, the acidic sulfide process discovered in the United States, In 1884, the sulfate (kraft) pulping process invented in Germany, Since it was first invented, paper become one of the most important necessities of humanity and it has a great product in the cultural and industrial fields. Hence, paper which is an important intermediate materials for the establishment of social development and communication needs, has maintained its importance until today. However, in modern time, the level of paper consumption per capita have become an indication of cultural and civilization development. For instance, the level of paper consumption per capita have become use for comparison among nations to give clue on industrialization level (Scott and Abbot, 1995). However, as a result of technological developments and new inventions, many progresses have been made regarding paper manufacturing technologies. Today, 2,000 m/min high-speed papermaking machines produce paper products with controlling all variables (pH, moisture, density etc) automatically. In a usual papermaking process, approx. 50 billion particles (cellulose fibers, paperloading additives, functional additives, etc.) have laying on the paper machine with 40-60 km/hour speed to formed paper structure, so how papermaking process is complicated can be considersing. Typically, paper industry can be describe as; *
Prof. Dr., Suleyman Demirel University, Department of Forest Products Engineering
- High investment and operational cost, - High water and energy necessity, There are a number of paper based products manufactured for various purposes. Some examples of them are; security paper, business paper, industrial and packaging papers, newsapers, etc., Table 1 shows one brief example for paper classification based on some important properties (Biermann, 1993; Scott and Abbot, 1995; Smook, 1994). Table 1. Paper classification Based on densities
Based on color
Tissue: low density -120). If Y does not produce, then I produce (+120 > +100). From the point of view of Y: If X produces, I do not produce (0 > -170). If X does not produce, then I produce (+140 > 0).
Figure 3: Decision tree of enterprises according to prisoner's dilemma
Monty Hall problem Monty Hall problem is a puzzle of probabilities based on an America TV show called “Let's Make a Deal”. The problem takes its name by the game show host Monty Hall. The problem is also known as Monty Hall Paradox since it also comprises a paradox. Let's assume that you are taking place in this show and have the opportunity to choose one of the doors out of three. Behind one of the doors is a car and behind the others are goats. You are choosing one of the doors, let's assume door 1 and the host who knows what is hidden behind the doors opens alternative door, let's say door 3 with a goat behind. And then asks you: "Would you like to choose door 2?" Would changing your choice be to your benefit? As demonstrate in Figure 4, the possibility of choosing the car, goat A or goat B in the initial attempt is equal. A contestant staying with the initial choice wins in 1/3 of these equally likely possibilities, whereas a contestant who switches wins in 2/3. If the door chosen by the contestant is the one with the car, there would be two options for the host which are the ones with the goats. The host chooses one of these two options with 50% probability.
365
Figure 4: Probability template in Monty Hall problem (Wikipedia, 2016)
According to discrete random variables formula; ∈ 1, 2, 3 , Door number with the Car (Automobile) behind, ∈ 1, 2, 3 , Door chosen by the Contestant, ∈ 1, 2, 3 , Door opened by the Host. Because the car is randomly placed behind the doors, the conditions for all A values are equal. According to that, beginning (unconditional) probability of A is 1/3, for each A value. In addition, because the contestant's choice at the beginning is free from the location of the car, A and C variables are independent. Therefore, A's conditional probability for a C value is / , for all values of A and C. The host's choice is shown with H's conditional probability according to A and C values: | , 0, (The host cannot open the door chosen by the contestant) | , 0, (The host cannot open the door with the car) | , , (The probability of opening the doors without the car behind is equal) | , 1, (There is only one door that can be opened) After the host opens one of the doors, the contestant can calculate the probability for the car to be located behind either of the doors by using Bayes Rule. The value is the conditional probability of A, depending on H and C values chosen: | , | | , | Within this ratio, the denominator shows the marginal (component) probability:
366
|
, |
| ,
|
Thus, if the contestant chooses door 1 and the host opens door 3, the probability of winning in case of changing the door chosen is: 1 1 1 1 1 1∗ 0∗ 2/3 2| 1, 3 1∗ / ∗ 3 3 3 2 3 Consequently, Monty Hall problem decision tree according to conditional probability is demonstrated in Figure 5.
Figure 5: Monty Hall problem decision tree according to conditional probability
According to Figure 5, in case the host opens door 3 and the contestant changes his/her choice, he/she would win with a probability of 1/3 if the car is behind door 2 and would lose with a probability of 1/6 if the car is behind door 1. The probabilities depending on the host opening door 2 are not included in this calculation. To transform those conditional probabilities, they are divided into their sum. Thus, when the contestant chooses door 1 and the host opens door 3, the conditional probability of picking the car is (1/3) / (1/3 + 1/6) = 2/3. This solution depends on the limitation regarding the host to make the decision to open one of the doors randomly AFTER the contestant making his/her first choice in the problem (Behrends, 2006, pp. 48-57). But this modest analysis does not solve the problem properly which was posed. The conditional probability of you win if you switch, given that the contestant chooses door 1 and the host chooses door 3 or vice versa. Grinstead & Snell, (2000) set up the problem before getting this information and then calculate the conditional probability in order to solve this problem. The final decision tree with path probabilities are illustrated in Figure 6. The process takes place in several phases like the car is placed behind a door, the contestant chooses a door and the host opens a door. Thus these phases can be analysed using a tree with paths and conditional probability. A supplementary assumption can be made for example the contestant chooses the door with the car, then he/she may choose each door with a probability of 1/2. The assumptions made here define the branch probabilities of the tree and these in turn define the tree measure (Grinstead & Snell, 2000, pp. 133-182). This means that only two paths through the tree are possible, given the information explicitly that the contestant chooses door 1 and the host chooses door 3. The resulting tree is illustrated in Figure 7.
367
Figure 6: Monty Hall problem (Grinstead & Snell, 2000)
Figure 7: Conditional probability for Monty Hall problem (Grinstead & Snell, 2000)
368
Figure 7 shows the possible paths that the car is behind door 1 and door 2. The possibility of the path leads to the car behind door 2 is twice as likely as the one with door 1. Hence the conditional probability that the car is behind door 2 is 2/3 and door 1 is 1/3. Therefore, if the contestant switches he/she has a 2/3 possibility of picking the car (Grinstead & Snell, 2000, pp. 133-182). The probability of winning of the contestant in the Monty Hall problem is also given in Figure 8 as a graphical form.
Figure 8: The graphic for the probability of winning of the contestant in the Monty Hall problem
As can be understood by the graphic, the probability for the contestant to win by changing his/her choice is twice the probability to win without changing it. However, the problem does not look so at first glance. Via the example above, it is now clear that even a problem which looks simple at first can lead to confusion. On the other hand, the significance of business intelligence is also understood when the critical decisions the enterprises have to take are considered. The transformation process of the data, which are very variable within the global competitive environment, to value added information is both very difficult and complex. Furthermore, the process does not reach an end point here. To make an accurate decision, handled information should also go through certain processes. Business intelligence has been developed for effective management of the complexity of these kind of circumstances. FINDINGS Business intelligence is the adaptation tool of the digital age. Business intelligence applications are the entire applications and technologies that enable collection, storage, analysis of the data and planning via these data in order to increase the success of corporations' future-oriented strategies. They provide analytic business solutions focused on analysis, reporting, modelling, understanding business outcomes in a better, faster and easier way and making forward estimations after operational processes of corporations. Problem solving and theoretical logic within the business intelligence process Problem solving is making a solution-oriented, effective action plan after understanding the current situation or setting forth current problem upon identifying the 369
main factors that create this issue or problem, and then carrying out this plan until the problem is solved. During the process, the plans can be replaced by better ones if necessary (Watanabe, 2014, pp. 15-23). To give an example, Ali, the business manager of a big restaurant is having troubles with salt shakers which always get blocked. When Ali is asked to precisely express the problem, he defines it as follows; “How can we increase the amount of salt spilling from the salt shaker without our customers putting too much effort, in other words, without changing the speed and strength of shaking them while using our moisture-free salt shakers?” Even such simple problems can become complicated for enterprises. This is because it would be simple if there were 1 to 10 salt shakers in question. But how about it is 1000 salt shakers? If it is decided to change the salt shakers, that would incur high costs. This problem can be concluded by using a decision tree or a logic tree (Watanabe, 2014, pp. 15-23). Thus, a logic tree application is given in Figure 9.
Figure 9: Logic tree application in problem solving (Watanabe, 2014, pp. 1-111)
As seen in Figure 9, the solution of even simple-looking problems may include a few alternatives and a little bit complexity. At this point, the best alternative should be identified for Ali. So which is the lowest-cost, the most profitable and the most accurate decision for the enterprise? Is it increasing the number of holes on the lid of the salt shaker, is it minimising the grains of salt or enlarging the holes on the lid of the salt shaker? Or is it all of them? At the above circumstances, in order to utilise the limited time and opportunities in the best way one should not fall into the trap of collecting information and having made analysis only. The aim of each and every research performed during the business intelligence process is to help decision-makers in making decisions based on accurate and solid information. Therefore, it is necessary to make a decision by collecting information in an efficient and effective way and analysing them (Watanabe, 2014, p. 40). Strategic decision-making during business intelligence process The most significant point within the decision-making process is to identify the strategic targets. The enterprise has to identify a clear target at the very beginning of the business intelligence process. This clear target should be defined precisely. For example; instead of “Breaking into water purifying device market in Turkey”, the target should be like “Becoming the leader of the water purifying device market in Turkey by capturing 5% of the market within the first year, 25% within first 3 years and 40% within first 5 years”.
370
After clear targets are set, the gaps between the current situation of the enterprise and the targets should be filled in. For example; which enterprise is the leader of the water purifying device market in Turkey? What are the differences between this enterprise and ours? What are the factors that render the market leader superior to its competitors? How does it provide customer loyalty? What is the product quality like? It is essential to answer these questions and the ones like these because defining the current situation is possible via these methods. To remove the gaps between the targets and the current situation, hypotheses should be developed and as many as possible options and ideas should be listed. The best ideas should be chosen as a hypothesis (Watanabe, 2014, pp. 1-111). Hence, it is necessary to identify the situation and the main factors of the problem in the first stage. The following process should be followed up at this point: All the possible reasons that cause the problem should be listed. A hypothesis should be developed for the most probable reasons. The data required for hypothesis test should be collected and transformed into information. The information collected should be analysed. Main reasons should be identified with the analysis. And in the second stage, the solution should be developed. The following process should be followed up at this stage: Many solutions should be developed for solving the problem. Actions to be taken should be prioritised. An implementation plan should be made. A company manufacturing and marketing water purifying devices in Istanbul thinks about breaking into the market by making a sales test in a small town first. What kind of a strategy should this company apply with business intelligence applications for in the town, it is going to perform sales in? After the targets are set, the hypotheses and the flow charts related to the hypotheses are developed. Here are the hypotheses identified by the company and illustrated in Figure 10 as a flow chart: 1. In the town with a population of 1000, the percentage of people who have used water purifiers before or who are informed about water purifiers is 5%, i.e. 50 people. 2. Of the 50 people who are informed about water purifiers or who have used them before, 60%, i.e. 30 people have information about the water purifier manufactured by our company. 3. 100% of the ones who buy the water purifier, i.e. 30 people, would have the product serviced regularly. The flow chart in Figure 10 is designed by the hypotheses established based totally on the estimation of the management of the enterprise without any data, information and analysis - in other words based on previous sales but without having done any analyses. Table 3 has been prepared according to these hypotheses and flow chart given in Figure 10.
371
Total number of people: 1000
Did they have any knowledge about water purifiers or use them before?
No (95%; 950)
Number of people who don’t have knowledge about water purifiers and didn’t use them before: 950
No (40%; 20)
Number of people who don’t have knowledge about water purifier device produced by our company: 20
No (40%; 20)
Number of people who buy our water purifiers but don’t want to have periodic maintenance: 0
Yes (5%; 50)
Do you have any idea about our product?
Yes (60%; 30)
If you buy our product, do you want to make periodic maintenance?
Yes (100%; 30) Number of people who want to have periodic maintenance of our product regularly: 30
Figure 10: Flow chart of hypothesis tests (Watanabe, 2014, pp. 1-111)
The following information has been obtained from the analyses performed according to the above action plan; Analysis: How many people are there in the town who have detailed information about water purifying devices? Approximate number of participants: 1000 people. Question 1: Does the target audience have information about water purifying devices? How many people have used similar devices before? Answer 1: Yes = 300 people (30%) No = 700 people (70%) Question 2: Does the target audience have information about the device manufactured by our company? Answer 2: Yes = 30 people (10%) No = 270 people (90%) Question 3: How many of the buyers of the water purifier want to have the device serviced periodically? 372
Answer 3: Yes = 24 people (80%) No = 6 people (20%) Table 3: Problem solving tool kit: a draft plan (Watanabe, 2014, pp. 1-111) Problem
Hypothesis
Main Logic
Analyses and Activities
Source
How many people are there in the town who have detailed information about water purifiers?
Public relations unit Most customers have Such a product has not should make a survey no information about been offered for sale within the town's public and get information on water purifiers. About in the town before. 95% are uninformed. Using such devices is what they think about the product. Promotion not common among The total is 950 campaign for the device the population. people. should be planned.
Survey and analysis
Do the ones informed about water purifiers have plenty of information about the devices manufactured by our company?
They have no idea about the device sold. Around 20 people do The household water is believed to be not recognise the device. The remaining sufficiently clean. 30 people are assumed to be informed.
The comparison between household water and the water from the water purifier should be made.
Promotion
Will the buyers have the device serviced consistently?
Once the device is purchased, the buyer would have it serviced regularly. Approximately 30 people will have the device serviced.
It should be detected why the buyers would not want to have the device serviced periodically. Therefore, the customers who purchased the device but do not want to have it serviced should be interviewed individually.
Interview
The ones who had a free trial would want to have the device serviced periodically for its performance to be permanent.
Based on the above information, the following graphic in Figure 11 can be developed. Creating graphics for such analyses within the business intelligence process is important in terms of visualising and lucidity of the information.
Figure 11: 1. Graphic of the analysis
The flow chart according to the above information is redesigned as in Figure 12 and given below.
373
Total number of people: 1000
Did they have any knowledge about water purifiers or use them before?
No (95%; 950)
Number of people who don’t have knowledge about water purifiers and didn’t use them before: 950
No (40%; 20)
Number of people who don’t have knowledge about water purifier device produced by our company: 20
No (20%; 6)
Number of people who buy our water purifiers but don’t want to have periodic maintenance: 6
Yes (5%; 50)
Do you have any idea about our product?
Yes (60%; 30)
If you buy our product, do you want to make periodic maintenance?
Yes (100%; 30) Number of people who want to have periodic maintenance of our product regularly: 30
Figure 12: 1. Flow chart of the analysis (Watanabe, 2014, pp. 1-111)
The following outcomes can be obtained from the flow chart of the analysis given in Figure 12: The number of people not informed about water purifying devices in the town is 70%, i.e. 700. 30%, i.e. 300 people have information about such products. Among 300 people who are informed about water purifying devices, 90%, i.e. 270 people do not have information about the device manufactured by the company. 10% have information about the products of the company and are willing to buy the product. Of the 30 people who purchased the water purifier manufactured by the company, 80%, i.e. 24 people want to have the device serviced periodically whereas 20%, i.e. 6 people do not consider having periodical maintenance at all. The hypotheses identified by the company previously and the information obtained post-analysis are provided in Table 4.
374
Table 4: The hypotheses identified by the company and the information obtained postanalysis Hypothesis
1
Hypothesis Before Analysis In the town with a population of 1000, the percentage of the ones who have used water purifiers before or who are informed about water purifiers is 5%, i.e. 50 people.
2
Of the 50 people who are informed about water purifiers or who have used them before, 60%, i.e. 30 people have information about the water purifier manufactured by our company.
3
100% of the ones who buy the water purifier, i.e. 30 people would have the product serviced regularly.
Current Situation Post-Analysis The number of people not informed about water purifying equipment in the town is 70%, i.e. 700. 30%, i.e. 300 people have information about such products. Among 300 people who are informed about water purifying devices, 90%, i.e. 270 people do not have information about the device manufactured by the company. 10%, i.e. 30 people, have information about the products of the company and are willing to buy the product. Of the 30 people who purchased the water purifier manufactured by our company, 80%, i.e. 24 people want to have the device serviced periodically whereas 20%, i.e. 6 people do not consider having periodical service.
Result
6 times the people forecast within the hypothesis have information about the products.
The ratio of the people who are informed about the products of the company is 10%. It is not 60% as foreseen in the hypothesis.
Whereas 100% of the people who have purchased this device were foreseen to have it serviced in the hypothesis, this rate has been realised as 80% by 20% reduction.
After the differences between the hypotheses and the current situation are examined, a strategy towards the marketing of the product should be identified. The strategic decision scenario given in Table 5 is established according to the analysis results above. A grading for each decision has also been made according to “Create a desire to buy”, “Convincing of regular service” and “Importance for the enterprise” and given in Table 5. Enterprises should give decisions to receive maximum profit with minimum cost while considering the opportunity costs. They should take decisions according to cost, importance, creating purchase request, marketing and promotion dimension which was graded in Table 5. 375
Table 5: The strategic decision table established according to the analysis results for marketing of the product Grading (out of 10) Decision No
Method
Create a desire to buy
Idea
Convincing Importance for the of regular enterprise service
Cost of decision
I
Promotion of the product
The product should be promoted by house calls with the product.
10
8
10
6.000 TL
II
Promotion of the product
Visual media advertisements should be created.
5
6
10
150.000 TL
III
Promotion of the product
A product-specific website should be created.
7
8
8
7.800 TL
IV
Promotion of the product
Advertisements should be published in local radio channels.
4
4
7
90.000 TL
V
Comparing normal water with purified water
House calls should be made with the equipment to compare normal water and purified water and the benefits of the product should be demonstrated.
9
10
10
5.500 TL
VI
Talking about the significance of periodical service
Informative films showing the effect of the periodical service on the performance of the product should be prepared.
5
3
9
48.750 TL
According to these evaluations in terms of enterprises, a new table to measure the difficulty, easiness and effectiveness of the 6 strategic decisions formed above is established and illustrated in Figure 13.
Figure 13: Strategical decision effectiveness and easy application table
All kinds of decisions taken are directly related to enterprises' capabilities and capacities. Hence, effectiveness and easy application table enable the decisions of the enterprise to be tested via visual charts.
376
The water purifier enterprise achieved increasing its sales in the town identified as the target as a result of these business intelligence applications performed. These results are provided comparatively in Table 6. Table 6: Comparison table for total sales graphics after strategic decisions From 1000 people in town
Hypothesis
Result of the Analysis
Number of people who has the knowledge about water purifiers and using it
5%, (50 people)
30%, 300 people 83%, (830 people)
Number of people who have the knowledge about the device the 60% of 50 people, 10%, i.e. 30 enterprise produced within the people (30 people) people who also has the knowledge about water purifiers and using it
Total Sales After Strategic Decisions
20%, (166 people)
How many people are going to have periodic maintenance within the people 100%, (30 people) 80%, (24 people) 10%, (16 people) who purchased water purifier Total Sale
30 people
24 people
150 people
As can be understood by Table 6, although the total sales foreseen in the hypotheses were 30, the number of people who both had the product serviced and purchased it declined by 24 according to the analysis results. On the other hand, the number of people who purchased the product in the hypothesis consisted 60% of the 50 people who were informed about it. However, upon analysis, it has been understood that this was far from the real situation since in reality, only 10% of the 300 people were willing to buy the product. In addition, in the hypothesis it was stated that each customer who purchased the product would have it serviced regularly, but actually there is a decrease of 20%. After the strategic decisions are applied, the product has been sold to 166 people. Around 10% of these people did not want to have the product serviced regularly. As a result of researches, it has been identified that those people lived abroad and were not available for regular service since they came to the town only for the summer. Therefore, these data have been recorded and the scope of the business intelligence has been extended. CONCLUSION AND RECOMMENDATIONS It is the business intelligence applications which simplify and speed up these processes. Although the examples given are kept simple to better explain the subject, it is not possible for large scale enterprises, especially the ones making manufacturing, to survive by making sales only within a town. Thus, it is necessary to make analysis of all countries on many aspects such as economic, social, political and technological, etc. and to include these analyses into business intelligence processes. In this age of big data, huge amount of data should be analysed and turned into meaningful information by developing many models and/or templates. What makes business intelligence important is that it can manage all these processes in a very short time and very efficiently. In the environment of global competition, the lifecycles of enterprises and of their products are in direct proportion with increasing business intelligence and/or corporate intelligence within today's digital age. The oil of the 21st century is information. 377
Therefore, it is necessary to process business intelligence and render enterprises efficient and useful. Increasing the utilisation of business intelligence and widening its scope is directly associated with the amount of information analysed. The amount of information accessed and manipulated is what defines the power of enterprises. REFERENCES Altinay, A., Mercan, N., Aksanyar, Y. & Sert, S. (2012). İşletme Körlüğü, Silo Sendromu ve Çözüm Önerisi Olarak Örgütsel Zeka. Organizasyon ve Yönetim Bilimleri Dergisi, 4(1), pp. 13-19 Behrends, E. (2006). To change or not to change? The Monty Hall Problem. Five-minute Mathematics. Wiesbaden: American Mathematical Society, pp. 48-57. Brijs, B. (2012). Business analysis for business intelligence. Baco Raton: CRC Press. Cabral, L. M. (2000). Introduction to industrial organization. Massachusetts: MIT Press. Duxbury, N. (2002). Random justice: On lotteries and legal decision-making. London: Oxford University Press Grinstead, C. M. & Snell, J. L. (2000). Introduction to probability. American Mathematical Society. Hawking, P. & Sellitto, C. (2015). Business intelligence strategy: a utilities company case study. Business Intelligence: Concepts, Methodologies, Tools, and Applications. Hershey: Information Resources Management Association, pp. 305-317. Loshin, D. (2003). Business intelligence: The Savvy Manager's Guide, getting onboard with emerging IT. San Francisco: Morgan Kaufmann Publishers. Michalewicz, Z., Schmidt, M., Michalewicz, M. & Chiriac, C. (2006). Adaptive Business Intelligence. Adelaide: Springer Science & Business Media. Pareek, D. (2006). Business Intelligence for telecommunications. Boca Raton: CRC Press. Sabherwal, R., & Becerra-Fernandez, I. (2011). Business intelligence: Practices, technologies, and management. Hoboken: John Wiley & Sons. Sauter, V. L. (2014). Decision support systems for business intelligence. Hoboken: John Wiley & Sons. Scheps, S. (2011). Business intelligence for dummies. Hoboken: John Wiley & Sons. Stanford Encyclopaedia of Philosophy. (2014). Prisoner's Dilemma. Available at: http://plato.stanford.edu/entries/prisoner-dilemma/ [Accessed: 13.06.2016]. Thierauf, R. J. (2001). Effective business intelligence systems. Westport: Greenwood Publishing Group. Turban, E., Aronson, J. E., Liang, T. P. & Sharda, R. (2007). Decision Support and Business Intelligence Systems. New Jersey: Pearson Education. Watanabe, K. (2014). Problem Çözümüne Giriş 101, Zeki İnsanlar İçin Basit Bir Kitap. 3. Baskı, Ankara: TÜBİTAK. Wikipedia, (2016). https://en.wikipedia.org/wiki/Monty_Hall_problem [Accessed: 15.07. 2016]. Williams, S. & Williams, N. (2010). The profit impact of business intelligence. San Francisco: Morgan Kaufmann Publishers. Yuk, M. & Diamond, S. (2014). Data visualization for dummies. Hoboken: John Wiley & Sons.
378
Chapter 29 A Programming Study on Optimal Finding of Tandem Repeat DNA Sequences Abdulkadir YALDIR*, Onur İNAN** INTRODUCTION The advancements such as DNA chips, Polymerase Chain Reaction (PCR) chips and automations observed in Deoxyribonucleic Acid (DNA) technologies since the last quarter of the twentieth century have led the emergence of concepts such as Genetic Engineering, Bioengineering, Pharmacogenetics, and Bioinformatics. Bioinformatics approaches that are widely used in the analysis of DNA, Ribonucleic Acid (RNA), structure and functions of the protein, detection of new genes and determination of transcription variants and polymorphisms have brought the field of Bioinformatics to a significant position. The developments observed in the field of Bioinformatics enabled the researchers to obtain an excessive amount of DNA sequences. With the launch of the sequencing robotic automation system in the determination of DNA sequences, millions of DNA sequences from plants, animals, and other organisms have been collected in GenBank (Mount, 2004). The tandem repeat in DNA is sequential and contains similar copies of two or more nucleotide patterns. Tandem repeats are observed to cause diseases and to play a role in the regulation of the metabolism and in the determination of genetic variances. Thus; tandem sequences are significant practical tools. DNA sequence repeats such as simple sequence repeats (SSR) are frequently used in DNA marker technology. DNA markers have accelerated the development of genetic analysis (Powell, Machray & Provan, 1996). SSR markers are commonly preferred in many living organisms as they are abundant in the genome, they have a quite variable structure, and they are suitable for high throughput analysis. SSR development requires time, effort and high costs. Acquisition of genome sequences from freely accessible databases and searching of these resources through the utilization of measurement methods enables fast and lowcost development of markers. Expressed Sequence Tags (ESTs) are abundantly present in genomes, and they represent expressed genes. Consequently; they are the most suitable tools for the scanning of simple tandem repeats. They are limited as it is difficult to find out of intragenic tandem repeat information such as pattern size, the number of repeats, mutation history, etc (Rudd, 2003). Whereas some tandem repeats play a significant role in the regulation of genes, some of them have no function. Despite this fact, each of them is significant for genetic *
Assist. Prof. Dr, Pamukkale University, Faculty of Economics & Administrative Sciences, Department of Management Information Systems, Denizli, Turkey,
[email protected] ** Lecturer, Mehmet Akif Ersoy University, Bucak Emin Gülmez Technical Sciences Vocational High School, Burdur, Turkey,
[email protected]
analysis (Toth, Gaspari & Jurka, 2000). Tandem repeats attract attention for the following reasons: 1. They play a role in the formation of the hairpins at the replication stage (Shafer & Smirnov, 2000). 2. The nervous system diseases are associated with tandem repeats (Reddy & Housman, 1997). 3. They are used in DNA markers such as microsatellite and SSR and in genetic mapping (Scott et al., 2000). 4. They have significant effects on the protein they have coded (Klintschar & Wiegand, 2003). Within the framework of these developments, this study aims to use the data of the GenBank in order to develop software that could give us sufficient information about the distribution and functions of tandem repeat DNA sequences with respect to microsatellite and simple sequence repeats. This study presents new analysis software called as Tandem Repeat Miner that finds tandem repeats without the need to define the patterns or the pattern size. First, a GenBank sequence collection is formed. This collection represents tandem repeat areas possessing simple and complex patterns. These sequences constitute a base for the common problems met in tandem repeat areas. Using these GenBank sequences, the results of Tandem Repeat Miner software are compared with popular algorithms such as Tandem Repeat Finder. Tandem Repeat Miner successfully detects the SSR and variable length tandem repeat (VLTR) areas in DNA sequences. The results of the analysis show that, the tandem repeat areas present the size of the pattern, the number of replications and the structure of complex patterns in a wide range. Tandem Repeat Miner software is used in order to perform detailed scanning of the sequence patterns to detect Exact, Inexact and Compound Tandem Repeats through separate key words. The gene data files to be analysed are handled in FASTA format. The search module of the analysis software is used to scan the sizes of patterns that vary simultaneously in different pattern lengths depending on the user definitions or options. It was paid attention that the scanning results of the analysis software could be developed by the user. As it enables the detection of the tandem repeats present in ESTs, the software is intended to be used in genetic mapping and in the discovery of the repeats of the organs and patterns that are under the suppression or at the development stage. BASIS FOR THE SOFTWARE Simple sequence repeats used in the determination of tandem repeat DNA sequences are significant markers. On the other hand; they are rather difficult to obtain and develop. Background knowledge about sequences is necessary for their development. Development of simple sequence markers start with the determination of tandem repeats in genomic sequences. PCR primers are designed with the simple sequence repeats obtained. There are two approaches for the determination of sequences that include simple sequence repeats. These are; the molecular approach and the measurement approach. In the molecular approach, simple sequence repeat libraries are formed and cloned first. Then, simple sequence repeat patterns are determined manually or by using computer software. In measurement or Bioinformatics approach, sequences obtained 380
from GenBank accessible to everyone are scanned, and the ones including simple sequence repeats are quickly selected. The second approach was preferred in this study. In software language, DNA sequence, S, is defined as an n character sequence in alphabet ∑ , , , . S sequence is shown as , and it represents the elements of a sequence that starts with position i and ends with position j in 1 notation. Similarity Measurements between Exact and Inexact Tandem Repeats Tandem repeats are sub-sequences that are repeated at least for two times in a sequence. Exact and inexact or almost exact repeats of sub-sequences come to attention when tandem repeats are given as reference. This situation is given in Table 1 and the three different compatibilities of the sequence with the pattern are shown. Incompatibilities between the pattern and sequence are shown in bold. Table 1: Exact or similar compatibilities with the pattern PATTERN
ACCGTGA
Exact compatibility
ACCGTGA
Almost exact (not exact) compatibility that presents 3 incompatibilities. Hamming similarity measurement where k=3.
ACGGAGG
Similarity compatibility with 1 deletion, 1 insertion and 1 incompatibility. Levenshtein/Edit similarity measurement where k=3.
AA█GTGGA
The most common two similarity measurement methods are the Hamming similarity measurement (Hamming, 1950) and the Levenshtein/Edit similarity measurement (Levenshtein, 1966). Similarity measurements process in order to transform one sequence into another and compare the two sequences. The Hamming similarity measurement finds out the incompatible pairs only. On the other hand; the Levenshtein/Edit similarity measurement also includes the incompatible pairs and the pairs in cases of nucleotide deletion or insertion. The incompatibility of a single nucleotide is the replacement of a character from the alphabet ∑ with another character. When a single character is deleted, it means one character is removed out of the sequence. When a single character is inserted, it means any character from the alphabet ∑ is included in the sequence. Each similarity measurement has a cost that depends on the number of processes performed. The pair obtained at the end is a set of processes that transforms one sequence to another with the lowest cost. The current study uses the maximum number of processes permitted between two similar sequences or the threshold values that show the maximum cost. In patterns with k number of incompatibilities, the algorithm finds out all the probabilities of a pattern that possesses a maximum k number of incompatibilities. For example; in Hamming similarity measurement with k threshold value, incompatibilities have 1 cost value. On the other hand; in Levenshtein/Edit similarity measurement, a problem with k number of variances includes k number of incompatibilities, deletions or insertions. In Levenshtein/Edit similarity measurement with k threshold value, each process has 1 cost value.
381
Aligning Sequences through Dynamic Programming Dynamic programming is a technique used in the alignment of two or more sequences with another sequence in order to find the best compatible similarity between the sequences (Bellman, 2003). The global alignment between the two sequences and the local alignment between the sub-sequences of the two sequences are used in the determination of tandem repeat DNA sequences. In global alignment, space is placed inside or to the ends of S1 and S2 sequences. The two sequences are overlapped in such a way that; in both sequences, a character corresponds to a space or a space corresponds to a character. The spaces indicate deletion in the lower sequence, whereas they indicate insertion in the corresponding sub-sequence. For example; global alignment of ACGCTCTA and ACCTATGA sequences is as follows: ACGCTCT█A AC█CTATGA In this sequence, there is space on the opposite of both G’s whereas there is an incompatibility between the C and A that are written in bold. All the other positions indicate the compatibility between the two sequences. In local alignment, the space is placed inside the sub-sequence in sequence sub-sequence in sequence or to the ends. Similarly, the two and inside the sequences are overlapped in such a way that; in both sequences, a character corresponds to a space or a space corresponds to a character. For example; local alignment of ACGCTCTA and ACCTATGA sequences is as follows: CTCT CTAT In this alignment, there is an incompatibility between the C and A that are written in bold. All other positions indicate the compatibility between the two sub-sequences. The terms of compatibility, incompatibility and range we use for global and local sequences, are also used for similarity. Similarity measurement is the number of processes concerning the alignment of the two fixed sequences. For an 1. . sequence with n character and 1. . sequences with m character , similarity measurement shows the minimum number of similarity measurements needed to transform the first i character of to the first j character of . Similarity measurement , corresponds to global sequences of and sequences; similarity measurement , is solved for all the combinations ranging from 0 and 0 . In dynamic programming, the alignment of two sequences includes matrix measurement and backtracking steps. The relation of repeat consists of basic and recursive states. Each , determines how the scoring will be performed when i and j take the values of 0 and 0 respectively. As the placement of space at the beginning or end of the sequence or sub-sequence has no effect on scoring, in all cases of 0 and 0 ; ,0 0 0, 0
Each , cell is measured by using the values measured in matrix previously and by switching to the relevant cell again from these values depending on the states of 382
compatibility, incompatibility and space. As each space is assigned a value in the sequence, the recursive state is the best of the following; 1, 1 , 1, , 1 In the measurement, i values change from 0 to 0 . If in compatibility test, the , shows compatibility state; and if it shows incompatibility state. In global similarity measurement, 1 is assigned as the cost value for compatibility, incompatibility and range. Wraparound Dynamic Programming It is another method used for the detection of tandem repeats. In this method, all sequence patterns are scanned thoroughly with the known tandem repeat (Myers & Miller, 1988). Its wraparound feature extends the coverage area of dynamic , to , 1 and from , to programming by enabling switching from 1,1 in standard dynamic programming algorithm. This process is performed during matrix formation by a second switching from each matrix cell. The wraparound dynamic programming algorithm is given as follows; For each line 1. . , 1st switching: Calculate For each column 1. . Calculate , by using the recursive relation Copy , to ,0 2nd switching: Update , Switch from , to , 1 , again by using the recursive relation Calculate Forming GenBank Sequence Collection Various sequences with different properties were obtained from the freely accessible GenBank. The validity of the software was tested in this way. The sequence collection represents the tandem repeat areas possessing simple and complex patterns. In this collection, there are short and long patterned areas such as SSR, VLTR and variable period compound tandem repeats. The length of the sequences range from short sequences including single nucleotide isolated tandem repeats to medium length sequences with a few hundred kilo base pairs (bp) and very long chromosome sequences including several tandem repeat areas. Sequences include a wide range of organisms from bacteria to human beings. Table 2 shows the patterns with the sequence lengths concerning the types selected. The “♦” icon here shows the types of patterns defined in sequences according to the visual analysis. As these sequences include many details in the detection of tandem repeats, they can be regarded as the parts of sequences that need to be solved.
383
Table 2: GenBank sequence collection Sequence Length Base Pair (bp)
Simple Pattern Structures
Compound Pattern Structures
Sequences GenBank
Species
AMU73928
Honeybee
283
♦
♦
BOVTGN
Cow
725
♦
♦
General
♦
SSR
Long
VLTR
Compound
BTA132392
Cow
251
BTU75906
Cow
364
♦
DMPUGDMG1
Fruit Fly
2468
♦
ECTRNYSU
Bacteria
1655
♦
HSVDJSAT
Human
1985
♦
MM102B5
Mouse
704
♦
MMMSAT5
Mouse
412
♦
U00144
Cow
407
♦
♦
♦
♦ ♦
♦
Analysis of the Software that Finds SSRs In literature studies, it was aimed to develop effective, simple and high throughput applications that can find all SSR types that take place in a sequence. In this study, it was aimed to find out the extent of the approximation of the measurement in finding the SSR sequences with the developed software and SSR detection measures were defined as follows: The ability to detect single, double or multiple nucleotide repeats, The ability to find compound repeats and two or more compound repeat patterns, The ability to define various SSR types with the start and end points in a relevant sequence, The ability to detect the interrupting and useless discontinuous repeats, The ability to define SSRs in data stacks including several sequences, The ability to define the pattern name, pattern type and start and end points of tandem repeats in the throughput at least. The software that came to the forefront according to these measures, were analysed. The first of these was the Sputnik software. It is a simple application that finds the microsatellite repeats in DNA sequences in FASTA format (Abajian, 1994). Sputnik is mostly effective for relatively smaller throughput applications. Repeat Finder is another application developed for the detection of SSRs (WEB-1 2016). Though Repeat Finder is a suitable application for small and medium size data stacks, it is unable to find single nucleotide repeats, and it shows low performance in multiple data stacks. Tandem Repeat Finder is another application that indicates and locates tandem repeats (Benson, 1999). User data are given in FASTA format. There is no need to define the pattern, report the length or state the other parameters. The location and length of tandem repeat, the number of replications and the nucleotide content is obtained as throughput. The application is very fast, and it analyses 5 Mbp (Mega base pairs) length sequences in just a few seconds. Pattern sizes of tandem repeats may vary from 1 to 2000 bases. 384
Tandem Repeat Miner Software Development Until this time, SSR software was analysed in terms of speed, efficiency and the ability to give detail throughput concerning the detection of tandem repeat sequences. Tandem Repeat Miner software was designed to completely meet the demanded measures. By using the software, SSRs can be detected in FASTA format sequences and ESTs obtained from GenBank. Tandem Repeat Miner meets the following conditions; Through the software, the minimum amount of single, double and multiple tandem repeats and the length of residual sequences between tandem repeats can be adjusted as demanded. It accepts the sequence files in FASTA format. It scans the sequence following the “˃” mark and sequence name starting from the first nucleotide up to the final nucleotide. It deletes the spaces and the terms specific to FASTA. It eliminates the feature ‘once a line is processed switch to a new line’. It finds the sequence length, divides the sequence length to the number of tandem repeats and finds the length of repeat. It scans the sequence by shifting the tandem repeat length through the whole sequence. It repeats this same process for all the remaining tandem repeat patterns. Once a sequence is completed, and a new “˃” mark is met, it repeats the same processes for all the remaining sequences of the file. It logs the names of sequences in files or sequences, the types of tandem repeats, the number of repeats and the start and end points of repeats. The main user interface of Tandem Repeat Miner software is given in Figure 1.
Figure 1: Tandem Repeat Miner main user interface 385
Exact, Inexact and Compound Tandem Repeat – TR entries can be done here. If desired, the program can be enabled to find tandem repeats automatically. The source of sequence analysed and the acquired TR throughputs can be displayed simultaneously. Tandem Repeat Miner is an interactive user friendly application, and it offers the user another option for finding the results through overlapping method. A user interface concerning the relevant form is given in Figure 2. The source sequence and TR and overlapping TR throughputs can be displayed with their locations. In the next section, the performance of the software will be assessed in comparison with the Tandem Repeat Finder software on the sequence collections acquired from the GenBank.
Figure 2: Tandem Repeat Miner user interface
FINDINGS AND DISCUSSION In this section, GenBank sequences with various features will be entered into the software to test the validity of the algorithm. The outputs of the current study are compared with the results of Tandem Repeat Finder for assessment. The analysed sequences are included in the GenBank sequence collection. They contain samples from 386
various organisms from bacteria to human beings, and they cover tandem repeat areas with several patterns. GenBank Locus – AMU73928 This sequence is taken from Apis Mellifera (Honeybee). In GenBank, mini satellite areas stated to start from the 76th position and reach up to the 209th position; however, the patterns for tandem repeat areas are not stated. The sequence contains 17 bp-length non-SSR VLTRs and T-patterned SSRs nested in VLTR area. Tandem Repeat Miner software finds 4 consecutive 35-sequence-length tandem repeats between the 72nd and 209th indexes. The first of these contain 3 indels (insertiondeletion), the others are exact tandem repeats. They are exactly compatible with the Consensus pattern. Tandem Repeat Finder Software obtains the same result. The Consensus pattern is defined as; TTTTATAAGTACCAGCTAAAATTTTTTTTTTTTTT. 17-bp-length VLTRs are also detected. GenBank Locus – BOVTGN This sequence is taken from Bos Taurus (Cow). This sequence contains 46 and 82bp-length 7 replicated mini satellites and a 29-bp-length sequence combined with GT patterned SSRs for each replica. The patterns in the sequence are compound patterns, and they take place in the tandem repeat area in variable length. The sequence is observed to have TG sequence containing two tandem T nucleotides following the exact SSR sequence. Tandem Repeat Miner software finds 13 consecutive 2-sequence-length tandem repeats between the 327th and 352nd indexes. The pattern obtained is in GT form. The same pattern takes place for 19 times between the 425th and 462nd indexes; and for 25 times between the 641st and 690th indexes. All repeats are exact tandem repeats. They are exactly compatible with the Consensus pattern. Tandem Repeat Finder obtains the same result. Tandem Repeat Miner software finds two consecutive 48-sequence-length tandem repeats between the 330th and 425th. There is one incompatibility in the second repeat. The Consensus pattern is defined as; TGTGTGTGTGTGTGTGTGTGTGTTGCCTGTCTCCAGCGTAAGTAATCA. Tandem Repeat Finder finds the same consensus pattern for 2.5 times between the 330th and 448th indexes. There are 2 consecutive 62-sequence-length tandem repeats between the 378th and 501st indexes of Tandem Repeat Miner software. There are three incompatibilities in the first repeat. The Consensus pattern is defined as: TGTGTGTGTGTGTGTGTGTGTGTTGCCTGTCTCCAGAGTAAGTAATCAT GGGTGTGTGTGTG. Tandem Repeat Finder finds the same consensus pattern for 2.1 times between the 378th and 508th indexes. GenBank Locus – BTA132392 This sequence is taken from Bos Taurus (Cow). This sequence covers a 7 replica area in 24 and 27-bp-length. In the 24 or 27 nucleotide patterned area, there are GGT patterned inexact SSRs. The visual analysis presents that; the patterns that take place at the beginning and end of the area have 27 nucleotides, and the patterns are inexact. Tandem Repeat Miner software finds 6 consecutive 24-sequence-length tandem repeats between the 81st and 224th indexes. There are 9 incompatibilities in the first four repeats. The final two repeats are exact tandem repeats. The Consensus pattern is 387
defined as; GGTGGCTGGGGACAGCCACATGGT. Tandem Repeat Finder finds the same consensus pattern for 6.2 times between the 81st and 229th indexes. GenBank Locus – BTU75906 This sequence is taken from Bos Taurus (Cow). This sequence contains 29-bplength non SSR pattern and SSR that is placed in this area. There are exact SSRs in inexact SSR areas. Tandem Repeat Miner software finds 13 consecutive 2-sequence-length tandem repeats between the 45th and 70th indexes. The pattern is in GT form. It finds the same pattern for 24 times between the 282nd and 329th indexes and for 13 times between the 226th and 251st indexes. All repeats are exact tandem repeats. Similarly; it finds 27 consecutive 2-sequence-length tandem repeats between the 96th and 148th indexes. The pattern is in TG form. Tandem Repeat Finder software finds TG pattern for 27.5 times. Tandem Repeat Finder finds 3 consecutive 54-sequence-length tandem repeats between the 132nd and 287th indexes. Tandem Repeat Finder finds the same pattern for 3.3 times. GenBank Locus – DMPUGDMG1 This sequence is taken from Drosophila Melanogaster (Fruit Fly). This sequence contains well-protected TCTCTCT patterned tandem repeats. At one end, there is a small CT-patterned SSR area. Then the 25 replica exact tandem repeat TCTTCTCT pattern continues. Tandem Repeat Miner software finds 30 consecutive 7-sequence-length tandem repeats between the 2207th and 2416th indexes. The consensus pattern is in TCTCTCT form. There are 3 incompatibilities in total. Tandem Repeat Finder finds the same pattern for 30.6 times. GenBank Locus – ECTRNYSU This sequence is taken from Escherichia Coli (Bacteria). This tandem repeat sequence contains 178-bp-length pattern and it has three replicas. Tandem Repeat Miner software finds 2 consecutive 178-sequence-length tandem repeats between the 625th and 980th indexes. The consensus pattern is 177-sequencelength. 178-sequence-length is obtained by inserting two more. Tandem Repeat Finder software finds the same consensus pattern and the same sequence length for 2.3 times. GenBank Locus – HSVDJSAT This sequence is taken from Homo Sapiens (Human). This sequence consists of 36 compound patterns that are close to each other and in 9 and 10-bp pattern length. Tandem Repeat Miner software finds 16 consecutive 2-sequence-length exact tandem repeats between the 826th and 856th indexes. The pattern is in AC form and one insertion is done. Tandem Repeat Finder finds the same repeat in the specified number. Tandem Repeat Miner software finds 18 consecutive 19-sequence-length tandem repeats between the 1190th and 1531st indexes. Consensus pattern is again in 19sequence-length. There are 33 incompatibilities and 21 indels. Tandem Repeat Finder finds the same pattern for 18.4 times. GenBank Locus – MM102B5 This sequence is taken from Mus Musculus (Mouse). It consists of 234-bp-length tandem repeat area and two sub-units in 116 and 118-bp length. These consist of 3 sequences in 9-bp-length; GAAAAATGA, GAAAAAACT and GAAAAACGT. The 388
visual analysis of the section is revealed out to be a compound tandem repeat area. Tandem Repeat Miner software finds 3 consecutive 232 sequence-length tandem repeats between the 1st and 695th indexes. There are 20 incompatibilities and 4 indels. Tandem Repeat Finder software finds the same tandem repeat and the sequence length is detected as 231. GenBank Locus – MMSAT5 This sequence is taken from Mus Musculus (Mouse). It consists of 270-bp-length tandem repeat area. The SSR area here includes the mixture of AC, AT and GT patterns. Tandem Repeat Miner software finds 21 consecutive 2- sequence-length exact tandem repeats between the 251st and 292nd indexes. The pattern is in TG form. Tandem Repeat Finder finds the same repeat in the specified number. Tandem Repeat Miner finds 2 consecutive 49-sequence-length tandem repeats between the 118th and 215th indexes. There are 10 incompatibilities in total. Tandem Repeat Finder finds the same repeat for 2.2 times. Tandem Repeat Miner finds 5 consecutive 18-sequence-length tandem repeats between the 65th and 155th indexes. There are 12 incompatibilities in total and 2 indels. Tandem Repeat Finder finds the same repeat for 5.4 times. GenBank Locus – U00144 This sequence is taken from Mus Musculus (Mouse). This sequence covers SSRs with patterns in various sizes. Tandem Repeat Miner software finds 37 consecutive 2-sequence-length tandem repeats between the 321st and 395th indexes. There are 8 incompatibilities in total. Tandem Repeat Finder finds the same repeat for 37.5 times. CONCLUSION In this study, an application software was developed in order to find the Tandem Repeat DNA sequences whose sequence length could be adjusted as desired. In the development stage, a GenBank sequence collection was formed at first for making comparisons with the previous studies. Then, it was aimed to determine the consensus pattern in sequence belonging to each type. Tandem repeat length was detected, and the sequence was scanned thoroughly. Similarity with the consensus pattern was analysed considering the incompatibilities, insertions-deletions (indels) and the software was enabled to find simple sequence repeats. Data was accepted in FASTA form, and the software was designed in such a way that it was able to repeat the same processes again for the new sequence once the scanning of a sequence was completed. The results obtained were compared with the previous studies to make performance analysis. Time complexity was taken into consideration, and it was aimed to optimise the operation speed of the software. The distance between the patterns was emphasised in order to overcome this problem. Just like the previous studies, the throughput of the software was intended to give sufficient information to the user regarding the number of repeats, the length of repeats, exact compatibility, incompatibility, and insertion-deletion. Development of the current study may enable the researchers interested in this issue, the producers interested in creating new genetic products and specialists creating solutions for the detection of relevant genetic diseases to collect necessary materials and data. Furthermore; it can be used as a tool in the resolution of genomic faults of 389
unknown origin. REFERENCES Abajian, C. (1994). Sputnik. http://abajian.net/sputnik/ [Accessed Date:10.07.2016]. Bellman, R.E. (2003). Dynamic Programming. Princeton University Press, Princeton, NJ. Benson, G. (1999). Tandem repeats finder: a program to analyze DNA sequences. Nucleic acids research, 27(2), 573.-580 Hamming, R. W. (1950). Error detecting and error correcting codes. Bell System technical journal, 29(2), 147-160. Klintschar, M. & Wiegand, P. (2003). Polymerase slippage in relation to the uniformity of tetrameric repeat stretches. Forensic science international,135(2), 163-166. Levenshtein, V. I. (1966). Binary codes capable of correcting deletions, insertions and reversals. In Soviet physics doklady, 10, 707-710. Mount, D. M. (2004). Bioinformatics: Sequence and Genome Analysis (2nd ed.). Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY. ISBN 0-87969-608-7. Myers, E.W. & Miller, W. (198 8). Optimal alignments in linear space. Computer Applications in the Biosciences, 4, 11-17. Powell, W., Machray, G. C. & Provan J. (1996). Polymorphism revealed by simple repeats. Trends in Plant Science, 1(7), 215-222. Reddy, P. S. & Housman, D. E. (1997). The complex pathology of trinucleotide repeats. Current opinion in cell biology, 9(3), 364-372. Rudd, S. (2003). Expressed sequence tags: alternative or complement to whole genome sequences? Trends in Plant Science, 8(7), 321-329. Scott, K. D., Eggler, P., Seaton, G., Rossetto, M., Ablett, E. M., Lee, L. S. & Henry, R. J. (2000). Analysis of SSRs derived from grape ESTs. Theoretical and applied genetics, 100(5), 723-726. Shafer, R. H., Smirnov, I. (2000). Biological aspects of DNA/RNA. quadruplexes. Biopolymers, 56(3), 209-227 Toth, G., Gaspari, Z. & Jurka, J. (2000). Microsatellites in different eukaryotic genomes: survey and analysis. Genome research, 10(7), 967-981. WEB-1. (2016). http://www.genet.sickkids.on.ca [Accessed Date:10.07.2016].
390
Chapter 30 Electric Machinery Design With Finite Elements Method Yusuf ÖNER, Metin ERSÖZ**, Oğuzhan KEÇECİ***, Veysi ARSLAN*** INTRODUCTION Design of electric machinery comprises the solution of numerous, complex and interrelated engineering problems. There is not any best or optimum design. It can be said that electric machinery design presents a mathematically unspecific problem. It is necessary to consider electromagnetic, thermal and mechanical problems in the design of electric machinery. To achieve a design that will meet all these features and can be applied commercially, there is a lot of need for optimization studies. Use of the computers with the solution approaches such as finite difference and finite element allows for direct modeling of the machine behavior. Alternative designs are rapidly evaluated. Computer aided design solutions of the electric machines can be solved with the two approach methods, analysis and synthesis. Electric machine sizes to be designed in the analysis method, machine structure and details of the material to be used are provided by the designer as input data. Computer program is used in the calculation of the performance characteristics, and then these characteristics are examined by the designer using his/her experiences to change the design in order to meet the desired features. This operation is continued and repeated until the desired features of the design are met. In the synthesis method, however, logical decisions necessary to make a change in a preliminary design are included in the computer program as a group of expressions. The preliminary design itself can be produced with the current Computer Aided Design (CAD) package software; the design method that concerns a class of machines is included in the front section of the computer software, and details (such as lamination details) of the various materials are stored in the data library. The main advantage of the synthesis method is to allow the competent person to properly control the data. On the other hand, due to numerous interrelated logical decisions in the design operation, this method particularly requires attention and interest as much as programing effort and skill (Gürdal 2015). At least one modeling scheme is available in the heart of all CAD packages. Various equivalent circuits are successfully used in the modeling of electromagnetic problems and thermal fields in electric machinery. Electromagnetic equivalent circuits of the various classes of electric machinery are mentioned in detail in the relevant books related to the theory and study topic. For the numerical analysis of electromagnetic problems, most of the Computer Aided Design systems are based on the finite element method; this method is proven to be reliable and effective.
Assoc. Prof. Dr., Pamukkale University, Faculty of Engineering, Department of Electrical & Electronics Engineering,
[email protected], ** Senkron Ar-Ge Engineering Ltd, Denizli,
[email protected], *** Engineer, Pamukkale University, Faculty of Engineering,
Finite element package software are strong tools in research and design, as well. Analysis of quite different geometries and working conditions is possible without the need for building a physical prototype using a computer. In many cases, numerical simulation also provides reliable and accurate information about the machine behavior without paying regard to geometric complexity and material nonlinearity (Gürdal 2015). Computer aided design has proven its adequacy in the magnetic tool industry. After the computer-aided magnet design of the experimental physics community at the beginning of the 1960s, CAD software became indispensable for the industrial designer. Some commercial CAD systems are still available in magnetic analysis and design studies, and many more software packages are used by large industrial firms for relevant purposes. Although various CAD software system capacities change, methodology and purposes of all this software systems share a common ground. Accordingly, the approaches in the solution methods, the sizes that can be calculated and the success of the calculation results in meeting the designer needs have an important place. New and strong analysis techniques provided by CAD software in the design of electric machinery allows for receiving rapid and net results besides the current analytical calculation techniques. Since this strong effect of CAD is started to be felt also in the industry, it has strengthened the skills of the researchers making magnetic analysis and the experts in the industry. Magnetic tools are designed by combining the traditionally simplified circuit models with the rules based on experimental evidence. This technique can be called “design with rule”, however; since the tools are increasingly variable and getting complicated, and the rules are insufficient electromagnetic field problems are started to be solved with “design with analysis” based on the detailed logical solution. “Design with analysis” means design with numerical analysis that can calculate geometric complexity and nonlinearity in different tools such as switched reluctance motors, one of the direct current machines 1 (Fenercioğlu 2006, 2 Gürdal 2015). In this study, with Maxwell 2D field simulator of Ansys firm, the design of a magnetic system, solution stages in the prediction of electrical and magnetic parameters were discussed. Maxwell 2D field simulator program is an interactive software package. It solves 2D electrostatic, static magnetic and eddy current problems using finite elements method (FEM) 1(Fenercioğlu 2006, 2 Gürdal 2015), Ansoft 2002 ,3. This program is used in calculation of capacities caused by charges and static electric fields, force, torque and voltage distributions; force, torque, and inductances formed by static magnetic fields, static external magnetic fields and permanent magnets; simulation of the fields in the structures where linear and nonlinear materials are used and also calculation of thermal sizes such as temperature and heat flow (Fenercioğlu 2007). A sample motor design using ANSYS Maxwell program that is used most commonly in the market and providing a solution with finite elements method will be emphasized. For example, switched reluctance motor design, one of the traditional motor types, will be made.
SWITCHED RELUCTANCE MOTORS Although the history of the switched reluctance motors (SRM) dates back to 1800s, practical use of these motor could only be provided as a result of progression 392
and cheapening of the semiconductor switching technologies after 1980s. Switched reluctance motor name comes from being variable reluctance due to the fact that air gap reluctance between the stator and the rotor changes with the rotor position and being switched due to the necessity to switch each phase of these motors respectively to continuously generate a torque. Although SRMs are quite simple in structure, their control is difficult to the same degree and requires rotor position information. With the development of power electronics elements and use of the microcontrollers controlling the same more commonly, the cost of the driver circuits has decreased and their ability has increased to the same degree. Thus, the barrier before the development of SRMs has been eliminated, and the studies on SRM have rapidly increased. History of the Switched Reluctance Motor SRMs were referred to as reluctance motor or variable reluctance motors due to the fact that phase inductances are variable, and they are based on reluctance change principle in the air gap, which stems from the machine structure, before 1980. Afterward, considering the working principles (switching the phase windings on and off by the semiconductor switch elements) occurring thanks to converter power electronic circuit the term Switched Reluctance Motor has started to be used more commonly. Industrial interest in switched reluctance motors dates back to 1800s. Switched reluctance machine was first used by Dawidson to move a locomotive in 1838, in Scotland. In the 1920s however, a step motor having the features of today’s SRMs was invented by C.L.Walker. Afterward, the pioneers of the idea to use variable reluctance motors in continuous mode with power semiconductors unlike step motors were Nasar, French, Koch and Lawrenson in 1960s. However, since the semiconductor switching elements have quite limited features in those years, the dimensions of the studies made also remained limited ( Çınar 2008). Detailed studies on switched reluctance motors started at Leeds University, England in 1967 and then at Nottingham University in 1973. Until 1976, 67 patents about SRMs were obtained around the world while 1755 patents were obtained between 1976 and 1999. Likewise, it is detected that 11 articles about SRMs were published until 1976, and 1847 articles were published between 1976 and 1999 ( Miller, 2001) Modern age of the development of SRMs started with the patents of Bedford in 1972 ( Bedford, 1972). Today the expression “switched reluctance” for these machines was first put forward by Lawrenson at the beginning of the 1980s ( Lawrenson, 1980). The studies for commercial use of these motors were conducted by Byrne and Lawrenson as of this date, the commercial production thereof was made with Switched Reluctance Drives Ltd. license. One of the first applications of SRMs for being used in the vehicle drive is the study that was made at Nottingham University in 1984 ( Blake et al., 1984). In this study, SRM with a power of 20 kW is used for a van type vehicle drive. The first example of the traditional SRM with the outer rotor in the literature was designed for the hard disc drivers of the personal computers ( Lin et al., 1995). One of the first important studies about linear switched motor is the linear SRM design with 0.75 kW which was made by Corda in 1979 (Stephenson, 1979). One of the last studies about SRMs is the double layer SRM structure with each phase being isolated which was made by Afjei, Torkaman and Toulabi in 2012 and different from the traditional SRM structure (Torkaman, 2012).
393
Basic Information on Switched Reluctance Motor Switched reluctance motor is basically a type of synchronous machine reluctance motor that is made suitable to be controlled by semiconductor switches. There are protruding poles both in the stator, and the rotor of this motor and winding is available only its stator. Thus, the motor is sometimes referred to as a motor with double protrusions. There is not any magnet, winding or short circuit ring in its rotors, it only comprises solid iron or sheet package (Özoğlu, 1999). Stator has a structure composed of simple concentric poles. SRMs are also classified according to the stator/rotor pole ratios. Figure 1 a structure of 4-phase classical switched reluctance motor is shown. The motor referred to as 8/6 4-phase SRM is composed of stator pole with 8 protrusions and rotor pole with 6 protrusions. Since each protruded pole pair forms one phase in SRMs, the mentioned 8/6 SRM is a 4-phase machine. The reason for why stator pole numbers are different from rotor pole numbers stems from the necessity to take off in any position and to continuously rotate. Two reciprocal coils on the same axis are serially bonded to form a phase winding. While the windings are made, it is necessary to pay attention to make the phase windings in the same direction. In the SRM applications requiring high speed, while rotor pole number is generally smaller than the stator pole number, in the applications requiring high torque, however, rotor pole number is selected close to the stator pole number (Çalık, 2004). By considering the application requirements before starting the design, first, this condition should be considered.
Figure 1: SRM Structures
Switched reluctance motor basically rotates by pulling a protruded pole in the rotor to the position where magnetic reluctance will be minimum by the winding in the stator as in the electromagnet by the excited pole. Stator poles are excited respectively, and rotation continues by pulling another pole each time. Since this pulling operation can be performed by applying the excitation current in the same direction each time and there is no need to change the flow direction in the converter to be used, semiconductor switch number in the converter is reduced by half compared to the other electronically controlled motors. Moreover, thanks to the high motor output power in SRMs, especially high efficiency of the system and cost advantage, a strong alternative to the alternative and direct current motors is provided. 394
PARAMETER CALCULATION OF 12/8 POLAR THREE-PHASE SWITCHED RELUCTANCE MOTOR In this section, in the line with the basic data, calculation parameters composed of forty-five steps both main sizes and performance results of the motor can be calculated. The data to be obtained as a result of these analytical calculations are entered in Rmxprt module, sub-module of ANSYS Maxwell program, and numerical result control about the motor to be designed is made (Keçeci and Arslan, 2016). While switched reluctance motor design was made, an analytical method was used to calculate all the measurements and performance results of the motor. To determine the main dimensions, the design is started by determining the main data below. These data are power, voltage, speed and rated efficiency values. Power: 2.2 kW Voltage: 380 V (AC) Rated speed: 3450 rpm Rated efficiency: 0.80 Phase, Pole Number and Stress Computation After the stator and rotor pole numbers are determined, other calculations are started. 1. Stator poles N s 12 2. Rotor poles N r 8 3. Phase number is determined according to the stator pole number. Stator pole number is 12. One phase is obtained by winding two opposite poles. Six (6) phases are obtained from 12 poles. It is understood that this motor is 3-phase since the phases after 90 can be powered simultaneously. q 3 4. Winding terminal voltage is calculated U U 1.1
Ud 3 2 380 V 282,1356057V 1.1 2 2
(1)
“1” in the formula is the coefficient of increase of the capacitor voltage. Computation of the Basic Dimensions 5. Electromagnetic force Pem
Pem PN
1 1 0.80 2.2 KW 2.475KW 2 2 x0.80
(2)
6. Sensitivity rate 1.2 `
7. Electromagnetic load values A` , B ,
A` 19000 A / m, B` 0.35T
(3)
8. Outer diameter of the rotor is calculated in [mm] Da k P Da2 (1.05 Da ) 6.1 . i . em B A k m
n
395
(4)
6.1 0.5 2475 m 0, 06885327306 m 68,85327306 mm . 1.05 1.2 0.35 19000 0.8 3450 9. Core length l a
Da
3
la D A 1.2 68,85327306 mm 82, 62392768mm 10.
(5)
Outer diameter of the stator is calculated in [mm] DS , to this end, the ratio
D A / DS determined according to the pole number in Table 1 is utilized (0.57)
DS DA 0.53 68,85327306 / 0.57 mm 120, 7952159mm
(6)
Table 1 SRM phase, pole number table Phase
Ns
Nr
Da / Ds
r
S
3
6
4
0.5
30
32
3
12
8
0.57
16
15
4
8
6
0.53
23
21
Other measurements and Calculation of Winding 11. The gap between the rotor and the stator is determined g 0.4mm . 12. Stator and rotor polar diameter S ， r Table 1 13. Stator and rotor width is determined in [mm] bps ， bpr
bps ( Ds 2 g )sin
s 2
(120,7952159 2 0.4) sin
15o mm 2
9,091576509mm
bpr Da sin
r 2
(7)
68,85327306 sin
16o mm 9,582523523mm 2
(8)
14. Since the second gap gİ is
gi
bps
2
9,091576509 mm 4,545788255mm 20 g 2
(9)
gi 12 is taken. (Otherwise, the value obtained is equal to gi .) 15. Stator and rotor yoke heights are determined in [mm] hcr ， hcs hcs 1.3
bps
2
1.3
9, 091576509 mm 5,909524731mm 2 396
(10)
hcr 1.4
bpr 2
1.4
9,582523523 mm 6,707766466mm 2
(11)
16. Shaft diameter is calculated in [mm] Di Di Da 2( g i g ) 2 hcr [68,85327306 2 (12 0.4) 2 6,707766466]mm 32, 23774013mm
(12)
17. Stator slot depth is calculated in [mm] d S d S 1 ( D S D A 2 g 2 hC S ) 2
1 (120,7952159 68,85327306 2 0.4 2 5,909524731)mm 2 19, 66144669mm
(13)
18. In the figure 2 below, motor parameters calculated above is shown.
Figure 2: Motor sizes
19. Effective core length is calculated in [mm] l Fe l Fe K Fe la 0.93 82, 62392768mm 76,840252 74 mm
(14)
20. Rotor torque is calculated r r
DA Nr
x68,85327306 8
27,04950013mm
(15)
21. Nominal speed opening angle o ON u 0
(16)
397
Closing angle hr
1 2 1 360o ( r ) u ( 16o ) 2 Nr 2 8
(17)
14.5o 0, 253174603rad
Conduction angle c off on 14.5 o 0, 253174603 rad
22. Winding number in each phase is taken as
B PS =1.6T for Nph ,
(18) and B
recalculated;
B 0.805 N ph
bps
r
Bps 0.805
3.04 N rU c nB Da la
(19) 9,091576509 1.6T 0,432908205T 27,04950013 (20)
3.04 8 282,1356057 0, 253174603 204, 4543091 3450 0, 432908205 0,06885327306 0,08262392768
Calculation of the Current and the Torque 23. Electromagnetic torque is calculated in [Nm] Tem Tem Pem
(21)
2200 N .m 6,0896956 N .m 2 3450 / 60
24. Electromagnetic torque is recalculated over another formula Tem Tem N a N r w ` 12 8 0.8 N .m 6,10909 0 9 N .m Tem 4
4
Motor size values calculated are summarized in the table 2 below.
398
(22)
Table 2: Motor parameter summary Stator outer diameter Ds / mm Rotor outer diameter
120.7952159
Da / mm
68.85327306
Core length l a / mm
82.62392768
Air gap
g / mm
The second gap
g i / mm Stator pole arc
s / ()
Rotor pole arc
r / ()
Stator yoke height
hcs / mm Rotor yoke height
hcr / mm
0.4
Shaft
Di / mm
Stator slot depth
12
d s / mm
16 5.909524731 6.707766466 32.23774013 19.66144669
15
25. Winding current is calculated (RMS)
Pem 2475 A 6,513157 A 380 V
I
(23)
26. Peak current is calculated i m im
1 6,513157 I A 13, 026315 A 0.5 ki
(24)
Winding Design 27. The area between the stator poles,
1 120,7952159 68,85327306 5,909524731)2 ( 0.4) 2 ] { [( 2 12 2 2 1 9, 091576509 19, 66144669}mm 2 140,583mm 2 2
(25)
28. Wire cross-sectional area is calculated S a , during the calculation current density ` 2 J 5 A mm is taken,
Sa`
I 5,789474 mm2 1,157895mm2 ` 5 J
399
(26)
29. Total conductor net cross-sectional area in each recess SCU
1 1 N ph S a 204, 4543091 1, 094mm 2 111,8365mm 2 2 2
(27)
k S ratio S CU 111,8365 0, 795519 140,583 SW
k S
(28)
30. Current density is recalculated J J
I 5, 789474 5, 292023 A / mm 2 5 A / mm 2 Sa 1, 094
(29)
31. Average winding rotation length [mm] is calculated lav
a b Figure 3: (a) Magnetization curve, (b) Field windings total energy diagram
bw ( Da 2 g ) sin
1 b ps Ns 2
(30)
(68, 85327306 2 0.4) sin 1 9, 091576509 mm 13, 48889 m m 12
2
a bps bw (9,091576509 13,48889)mm 22,58047mm b la 2 5 bw (82, 62392768 10 13, 48889) mm 106,1128mm
(31) (32)
1 1 r 5 bw 5 13, 48889 11, 74445mm 2 2
(33)
lav 2la 2(bps 2 5) 2 r
(34)
[2 82, 62392768 2 (9, 091576509 10) 2 11, 74445]mm 252, 2532mm 400
32. Total length of each phase winding wire l N ph lav 204, 4543091 252, 2532m 51,57426m
(35)
33. Each phase winding resistance Rp Rp
l 51,57426 0.0217 1, 023 Sa 1, 094
(36)
Weight, Volume and Power Calculation 34. Copper weight is calculated in [kg] GCU 6 6 GGu qSal 8.9 10 3 1,094 51,57426 8.9 10 kg 1,4169 kg
(37)
3
35. Stator core volume is calculated in [ mm ] VSFe
D 1 D 1 VsFe { . [( s )2 ( s hcs )2 ] bps ds } 2Ns lFe 2 Ns 2 2 2
VsFe {
(38)
0,12 2 0,12 1 ) ( 5,909)2 ] 9,09 19,66} 2 12 76,84m3 2 12 2 2 2 [(
0, 328783 10 3 m 3 328783, 3518 mm 3
(39)
3
36. Rotor core volume is calculated in [ mm ] VRFe
D 1 Di 1 VRFe { [( hcr ) 2 ( i ) 2 ] bpr ( gi g )} 2 N r lFe 2 Nr 2 2 2
(40)
32, 23 32, 23 2 1 2 2 VRFe { 2 8 [( 2 6, 7) ( 2 ) ] 2 9,5825 (12 0, 4)} 2 8 76,84mm
37. Core weight is calculated in [kg] G Fe 6 GFe (VSFe VRFe ) 7.8 10
(41)
6 (328783,3518 131419,1078) 7.8 10 kg 3,589579kg
38. Electric charge is calculated in A m A A
qN ph I
DsI
3 204, 4543 6,51315 A m 18, 2491634 A m (0,068 2 0.0004) 401
(42)
39. Copper loss is calculated in [w] PCU PCU qI 2 R p 3 6, 513157 2 0, 9621w 244, 89804 w
(43)
40. Motor utilization factor K 2.2 103 T K 2N 3450 2 2 / 60 N .m / m 3 15539, 79136 N .m / m 3 Da la 0, 068 0, 082
41. Iron loss is calculated in [w] PF E PFE= 0.05n −0.5U 2 = 0.085 × 3450−0.5 × 282,13560572 w = 115,1927573w
(44)
(45)
42. Mechanical abrasion is calculated in [w] PFW PFW
17 nD 2 I 10 9 17 3 450 68, 85327306 2 82, 623927 68 10 9 w 22, 97328142 w
46)
43. Leakage loss is calculated in [w] PS
PS 0.07( PFW PCU PFE ) 0.07 ( 22,97328142 244,89804 115,1927573) w 26,814485 w
(47)
44. Total loss is calculated in [w] P P ( PS PFW PCU PFE )
(26,8144856 22,97328142 244898042 115,1927573) w 409,878566 w (48) 45.Efficiency PN 2200 η 100% 100% 84, 29511 PN P 2200 409,878566
(49)
MAGNETIC ANALYSIS OF 12/8 POLAR THREE-PHASE SWITCHED RELUCTANCE MOTOR In this section, modeling of the motor, the parameter calculation of which is made including motor main sizes, will be performed by means of ANSYS Maxwell program. For modeling, Rmxprt module feature of ANSYS Maxwell program will be utilized. Figure 4 the Switched reluctance motor option is selected from Rmxprt module and the parameter and sizes calculated are entered
Figure 4: Rmxprt module menu item 402
in the module one by one. This entry operations, the features such as stator, rotor, winding geometry and parameters are properly entered in the module. Then, the motor material is determined, and M19_24G is selected from the material menu as generally used a sheet. B-H curve of this sheet is seen in Figure 5.
Figure 5: B-H curve of M19_24G sheet
Motor shape is drawn according to the calculated values after the parameter values entered in the module. Motor model Figure 6. Figure 6: Motor model shaped according to the parameter values entered in Rmxprt
Rmxprt Analysis results The motor model obtained is analyzed in Rmxprt module and analytical analysis of the motor is completed. These results are compared with the calculations made with the previous formulation (Keçeci and Arslan, 2016). If the table 3 is examined, values such as Rmxprt and the current in the calculation, torque, input-output powers, and efficiency are approximately equal. Besides, copper and core weight, winding resistance and loss comparison were also made. As a result of the comparison, size and performance values calculated with formulation were quite close to the values calculated in Rmxprt module. Figure 7, values of the magnetization curves showing the relationship between the numerous positions between the linear and non-linear positions of the rotor and ring flux and one phase current as a result of Rmxprt analysis are given.
403
Table 3: Comparison of Rmxprt-Calculation Results Parameter Phase Stator Pole Number Rotor Pole Number Current(A) Torque(Nm) Efficiency Nominal Speed(rpm) Input Power(kW) Output Power(kW) Iron Loss (W) Copper Loss (W) Total Loss (W) Winding Resistance (ohm) Copper weight (kg) Core Weight (kg)
Rmxprt 3 12 8 6.87 6.093 84.14 % 3443.44 2.611 2.197 148.38 229.065 414.302 0.9266 2.015 3.5995
Calculation 3 12 8 6.52 6.087 84.30 % 3450 2.609 2.2 115.2 244.89 409.87 0.9621 1.4169 3.5895
Figure 7: Current-Flux Graph
Bottom curve corresponds to the position where rotor and stator poles do not correspond to each other while the top curve corresponds to the position where rotor and stator poles correspond to each other (Keçeci and Arslan, 2016). Figure 8, efficiency-output power-torque-current graph according to the speed is seen. Efficiency, output power, torque and current values in 3450 rpm, the nominal operation speed, are given in a single graph. Figure 9, Average Phase Current graph is seen. Marked position is the 180-degree position of the rotor, namely the position where rotor poles and stator poles correspond to each other. In case of this position, the current value is 0 since the winding current is cut. If the current was not cut when this position is reached, the motor would be braked, and motor speed would be cut. The other point to consider is the section where the current value is maximum. This point is the 90-degree position which is the intermediate rotor position. Figure 10, Flux graph is shaped according to the current duration is seen.
404
Figure 8: Efficiency-output power-torque-current graph according to the speed
Figure 9: Average Phase Current
Figure 11, air gap inductance is seen. Marked 180-degree position is the corresponding position of the rotor pole and the stator pole. As will be understood from here, inductance value is maximum is the linear position. This is because of the fact that flux path magnetic reluctance is in minimum value.
Figure 10: Flux graph is shaped according to the current duration
405
Figure 11: Air gap inductance graph
After Rmxprt module analysis is made and compared with the calculation results, the motor model is converted into 2D and 3D and transient analyses are made, and thus the real performance of the motor is determined. 2D Analysis and results In Figure 12, 2D model and network model of switched reluctance motor are shown. To perform the solution in a faster manner, ¼ analysis of the model is made. First mesh model of the motor is formed. Sensitive formation of the network model provides minimization of the error in the solutions (Keçeci and Arslan, 2016). As a result of the transient analyses, Figure 13 This value is seen to be approximately equal to the torque value in the calculations. Moreover, the torque obtained is an expected result according to the SRM characteristic. Torque direction is always toward the linear position.
Figure 12: 2D model and mesh model of switched reluctance motor designed
Figure 14, winding current and driver pulse are given together. Winding current is cut before rotor pole and stator pole correspond to each other and the voltage induced in the winding is rapidly absorbed. The reason for this is not to have a retarding effect on the rotor. As seen in Figure 14, the current is cut when maximum even before the rotor is in the corresponding position (Keçeci and Arslan, 2016). Figure 15, Flux graph is seen. Graph is shaped based on powering of each phase current. It is seen that flux is regular for each phase. 406
Figure 13: Torque graph
Figure 14: Winding current and driver pulse graph
Figure 15: Flux graph
Figure 16, magnetic flux density vector representation of SRM is given. Magnetic field direction and positive, negative torques occurring are clearly seen from vector directions here. 407
Figure 16: Magnetic flux density vectorial representation
Figure 17, magnetic flux density of SRM is given. If the figure is examined, the material continues its operation on the motor core before saturation. The operation of the material used in electric machinery before saturation is the indication of a suitable design (Keçeci and Arslan, 2016). Switched reluctance motor Driver Circuit Switched reluctance motor driver circuit is shown in Figure 18. If the figure is examined, each phase of the motor is switched with a different switching period, and motor windings are powered. There are two switching elements for each phase in this circuit (Keçeci and Arslan, 2016). CONCLUSION In this section, a sample motor design with ANSYS Maxwell program used most commonly in the market using finite elements method is emphasized. For example, 12/8 polar switched reluctance motor, one of the traditional electric machines, design and analytical calculation were made.
Figure 17: Magnetic flux density
Figure 18: SRM driver circuit
408
The data obtained in analytical calculations were entered in ANSYS Maxwell program Rmxprt module, and motor design was made. These design results were examined and compared with the calculation results. Besides the results compared being quite close to each other, 2D transient analysis of the model was made, and the results here were also similar to the calculated values. Thus, the design designed by calculation and realized with computer simulation program is made ready for application. Acknowledgement This study is derived from Kececi’s and Arslan’s (2016) Bachelor’s thesis prepared in Pamukkale University. REFERENCES Ansoft (2002), Corporation, Maxwell 3D Technical Notes,USA, Ansoft, 656–71 Bedford, (1972), Compatible permanent magnet or reluctance brushless motors and controlled switch circuits, U.S. Patent 3,678 Blake, R. J., Davis, R. M., Ray, W. F., Fulton, N. N., Lawrenson, P. J., and Stephenson, J.M., (1984), The Control of Switched Reluctance Motors for Battery Electric Road Vehicles, in Proceedings of International Conference PEVD, 361-364,. Çalık, H., (2004), Anahtarlamalı Relüktans Motorun Kontrolü, İstanbul: Fen Bilimleri Enstitüsü, Marmara Üniversitesi, Çınar M. A., (2008), Elektrikli Taşıtın Tekerlek Tahriği İçin Geliştirilen Dış Rotorlu Anahtarlı Relüktans Motor Tasarımı ve Analizi, Kocaeli Üniversitesi Fen Bilimleri Enstitüsü Fenercioğlu, A., (2006)x Helisel Yapılı Anahtarlamalı Relüktans Motorun (HY-ARM) Tasarımı ve Analizi, Doktora Tezi, Gazi Üniversitesi F.B.E. Fenercioğlu, A., Tarımer İ., (2007)x Bir manyetik sistemin Maxwell 3D alan simülatörü ile statik manyetik analizinin çömzüm süreçleri, Journal of Technical-Online Volume 6, Number:3, 221-242 Gürdal, O., (2015), Elektrik Makinalarının Tasarımı, s. 201-240, İstanbul, Atlas Yayın Dağıtım,. Lawrenson, P. J., Stephenson, J. M., Blenkinshop, P. T., Corda, J. and Fulton, N. N., (1980), Variable-speed switched reluctance motors, Proc. Inst. Elect. Eng. B., vol. 253, no. 265, p. 127 Lin, H., Chen, S., Chang, K. and Low, T., (1995), Design and Analysis of 4-Phase (In-hub) Mini-Switched Reluctance Motor for Spindle Motor in Hard Disk Drive, in Conference on Power Electronics and Drive Systems (PEDS'95), 645-650, Miller, T., (2001), Electronic Control of Switched Reluctance Machines, Oxford: Newnes Power Engineering Series, Özoğlu, Y., (1999), Anahtarlamalı Relüktans Motorunda Kutup Başlarına Şekil Vererek Moment Dalgalanmasının Azaltılması, İstanbul: Fen Bilimleri Enstitüsü, İTÜ Stephenson, J. C., (1979), Computation of Torque and Current in Doubly Sailent Reluctance Motors From Non-Lİnear Magnetization data, IEEE Proceedings Electric Power Aplications, vol. 126, pp. 393-396, Torkaman, H., Afjei, E., and Toulabi, M. S., (2012), New Double-Layer-per-Phase-Isolated Switched Reluctance Motor: Concept, Numerical Analysis, and Experimental Confirmation, IEEE Transaction on Industrial Electronics, vol. 59, no. 2,
409
SYMBOLS AND ABBREVIATIONS LIST
SRM
Ns
Switched Reluctance Motor
la
Core stack length [mm]
Phase angle [rad]
DS
Stator outer diameter [mm]
Stator pole number
g
Air Gap [mm]
Nr
Rotor pole number
gİ
The second gap [mm]
q
Phase number
S
Stator pole angle [ ͦ ]
Electromagnetic Power [w]
r
Rotor pole angle [ ͦ ]
Slenderness ratio
bps
Stator pole width [mm]
Da
Outer rotor diameter [mm]
bpr
Rotor pole width [mm] Stator slot depth [mm]
Pem
hCS
Stator yoke height [mm]
dS
hC R Di
Rotor yoke height [mm]
Effective core length [mm]
Shaft diameter [mm]
l Fe r
Nominal speed opening angle [ ͦ ]
J
Current density [ A / mm ]
Closing angle [ ͦ ]
lav
Winding rotation length [mm]
C
Conduction angle [ ͦ ]
Rp
Winding resistance [ ]
Nph
Winding number in each phase
GCU
Copper weight [kg]
Tem
Electromagnetic torque [Nm]
VSFe
Stator core volume [mm ]
I IM
Winding current [A]
VRFe
Rotor core volume [mm ]
Peak current [A]
Copper weight [kg]
A
Electric charge [ A / m]
G Fe PFW PS P
ON hr
PCU
Copper consumption [w]
K
Motor utilization factor
PF E
Iron loss [w]
410
Rotor torque [mm] 2
3
3
Mechanical Loss [w] Leakage loss [w] Total loss [w] Efficiency
Chapter 31 Characterizations of Matrix Transformations on the Series Spaces Derived by Absolute Factorable Summability Güllü Canan HAZAR*, Fadime GÖKÇE** 1. INTRODUCTION
In the study, we give necessary and sufficient conditions for | , 0| ⇒ and ⇒ | , 0| for the case 1 ∞, where is absolute factorable summability (Sarıgöl, 2016b; Hazar & Gökçe, 2016). So we obtain some known results. Moreover, we investigate some algebraic and topological properties of the spaces derived by the mentioned summabilities and characterize some matrix operators on these spaces. Let ∑ be a given infinite series with partial sums we denote n.th . By 1, of the sequence is said to be Cesàro mean of order , . The series ∑ absolutely summable , with index k, or simply summable | , | , 1, if |
(Flett,1957). Since
|
, the summability | , 0| is equivalent to |
∞ as
∞. 1.1
|
∞. 1.2
be a sequence of positive real constants with Let → ∞. The sequence-to-sequence transformation
⋯
→
1
of the , Riesz mean of the sequence , generated by defines the sequence the sequence of coefficients . The series ∑ is then said to be summable | , | , 1, if |
|
∞. 1.3
(Sarıgöl, 1992). Now, by let us denote the set of series summable by the summability method | , | . Then it is easily seen that *
Res. Assist., Pamukkale University, Faculty of Science and Arts, Department of Mathematics, Denizli, Turkey.
[email protected] ** Res. Assist., Pamukkale University, Faculty of Science and Arts, Department of Mathematics, Denizli, Turkey.
[email protected]
∞ ,
∶
and so it means that the series ∑ . ∈
is summable | ,
Here, Sarıgöl (2016b) extend the summability | , , follows: The series ∑ is said to be summable
1,
| if and only if the sequence |
with factorable matrix as 1, if
∞. 1.4
is one in which each entry , 0 1.5 0, where and are any sequence of real numbers. Note that it is possible to get ⁄ from it some known notations. For example, if one takes , 1⁄ 1 , , then are reduced to the summabilities | , | and and | , 1| , respectively. We denote by the set of all complex sequences. , , , denote the set of the sequence spaces of all bounded, convergent, convergent to zero and null and finite sequences, respectively and ∈ ∶∑ | | ∞ for 1 ∞. A factorable matrix
∈
We say that , or ∶
defines a matrix transformation from into , and it is denoted by → if ∈ for every ∈ , where 1.6
provided that the series on the right side of (1.6) converge for each and for all ∈ , and also the matrix domain of an infinite matrix in a sequence is defined by x x ∈ ∶ A x ∈ X 1.7) is called a triangle if 0 and 0 for all , , a A matrix triangle is called factorable matrix, if it is defined by . Let be any sequence subset of . A subspace of is called an space if it is a complete linear metric space with continuous coordinates ∶ → 0,1,2, … where . On the other hand, an space ⊃ is said to have ∑ if every sequence in has a unique representation , that .A space is a normed space. is lim → If and are methods of summability, is said to include (written ⇒ ) if every series summable by the method is also summable by the method . and said to be equivalent (written ⇔ ) if each method includes the other. Problems on inclusion dealing absolute Cesàro and absolute weighted mean summabilities have been examined by many authors (Bor & Kuttner, 1989; Bosanquet, 1950; Sunouchi,1949; Mazhar, 1971; Mehdi,1960; Sarıgöl, 2016; Sarıgöl, 2015; 412
Sarıgöl, 2013a; Sarıgöl, 2013b; Sarıgöl, 2011a; Sarıgöl 2011b; Sarıgöl & Bor, 1995; Sarıgöl, 1994; Orhan & Sarıgöl,1993a; Sarıgöl,1993b; Sarıgöl, 1992; Sarıgöl, 1991). On this topic, Bor (2009) proved sufficient conditions for equivalence of the summabilities | , | and | , 0| as follows. Theorem 1.1. Let 1 and 1.8
If 1.9 for all n, where is a constant such that 1, then | , | ⇔ | , 0| . It has been more recently shown by Sarıgöl (2013a) that the condition (1.8) is omitted, and the condition (1.9) is not only sufficient but also necessary for Theorem 1.1 to hold, and also been completed in the following way. Theorem 1.2. Let 1 ∞. Then, | , | ⇒ | , 0| if and only if ∗
1
where
∗
⁄
∗
⁄
1 , 1.10
denotes the conjugate index of , i.e.,
Theorem 1.3. Let 1
∞. Then, | , 0| ⇒ | , ∗
⁄
∗
1.
| if and only if
∗
⁄
⁄
1 , 1.11
where ∗ denotes the conjugate index of . Corollary 1.4. Let 1. Then, | , 0| ⇔ | , | if and only if condition (1.8) is satisfied. 2. NEEDED LEMMAS AND THEOREMS In this subtitle we give the following lemmas which are needed in proving our Theorems. Lemma 2.1. 1 ∞ Then, : → if and only if ∗
|
(Sarıgöl, 2015). Lemma 2.2. Let1 s ∞. Then, : →
|
if and only if 413
∞ 2.1
|
|
1 as → ∞. 2.2
(McFadden, 1942). Lemma 2.3. i) ∈ , if and only if lim exist and sup|
|
,
ii) Let 1
∞ .
∈
lim
,
∞ , for ∀ν.
if and only if
exist and sup
|
|
∗
∞ , for ∀ν.
(Stieglitz, M.; Titez, H. 1977)
Lemma 2.4. ∶ →
if and only if ⁄
∗
⁄
∗
where 1987). Proposition 2.5. Every triangle all ∈
1 , 2.3
is a factorable matrix with nonnegative entrice
has a unique inverse
(Bennett,
which also is a triangle, and for
(Wilansky, 1984). Proposition 2.6. is a basis of linear metric sequence space , , then is basis of with the metric defined by for all , ̃ ∈ , ̃ , (Malkowsky & Rakocevic, 2007). Remark 2.7. Matrix maps between spaces are continuous (Boos & Cass, 2000). Theorem 2.8. Let , and , be spaces, : → be continuous and linear, and let space (Boos & Cass, 2000). ∈ ∶ ∈ . Then is an Lemma 2.9. Let be an FK space with AK, be triangle, be its inverse and be an arbitrary subset of . Then, we have ∈ , if and only if ∈ , and ∈ , for all , where If
,
414
0,1, …
, 0 0
(Malkowsky & Rakocevic, 2007). Lemma 2.10. Let be a triangle and , ⊂ . Then ∈ ∑ where , that is for all and
, if and only if (Malkowsky, 1996)
∈
,
3. SECTION The aim of this section is to give more general results by extending Theorem 1.2 . Now we give following theorems and and Theorem 1.3 for summability method proofs (Sarıgöl, 2016b). Theorem 3.1.
Let 1 | , 0| if and only if
∞ and
be a factorable matrix given by (1.5). Then, ∗
⁄
1
⁄
1 , 3.1
∗
where
∗
⇒
denotes the conjugate index of , i.e.,
1.
∗
Proof.
Let
∗
⁄
∗
⁄
∗
and
∗
, where ,
is summable and | , 0| iff Then, ∑ the other hand, it can be written from (3.2) that 1 a
1. 3.2 ∗
∈
and
⁄
∗
⁄
∗
∗
1
a
which gives us ∗
∗
where
415
∈ , respectively. On
3.3
and so ∗
∗
,
⁄
∗
∗
⁄
⁄
∗
∗
⁄
∗
⁄
1
,
1
∗
3.4
, 0 , ⇒ | , 0| if and only if
Then,
|
∗
|
∞⇒
|
∗|
1,
∞ , . . , ∶
→
,
where is the matrix whose entries are defined by (3.4). Therefore, applying (2.3) to ⇒ | , 0| iff the condition (3.1) holds, which completes the matrix , we have that the proof. Theorem 3.2. Let 1 ∞ and be a factorable matrix given by (1.5). Then, | , 0| ⇒ if and only if 1
where Proof.
∗
⁄
∗
⁄
∗
1 , 3.5
denotes the conjugate index of .
Let 1 and (3.2). Then,
∗
∗
⁄
∗
and
⁄
∗
∗
⁄
⁄
∗
∗
∗
, where
is given by
∗
where ⁄
∗
⁄
∗
⁄
∗
, 1 0, . Since the reminder of the proof is similar to the above, so it can be omitted. Now Theorem 3.1 and Theorem 3.2 immediately give the following result. Corollary 3.3. Let 1 ∞ and be a factorable matrix given by (1.5). Then, | , 0| ⇔ if and only if the conditions (3.1) and (3.5) are satisfied.
vise Note that Theorem 3.1 and Theorem 3.2 do not include results | , 0| ⇒ versa, and ⇒ | , 0| vice versa for the case 1 s ∞. So, motivated by these theorems, a natural problem is that, what are the necessary and sufficient conditions in order that these results should be satisfied. The aim of following theorems is to answer these open problems (Hazar & Gökçe, 2016).
416
Theorem 3.4. Let 1 for all . Then,
∞ and be a factorable matrix given by (1.5) such that ⇒ | , 0| if and only if 1
1 | |
|
where
∗
1
0
∗
1 |
,
∞ 3.6
|
|
denotes the conjugate index of , i.e.,
1.
∗
Proof. ∗
Let ∈
∗
and
⁄
∗
for n 1. Then ∑ is summable and | , 0| iff ∈ , respectively. On the other hand, it can be written from (3.2) that ∗ ∗ 1 ∗ ⁄ ∗ 1 ⁄
which gives us ∗
where 1
1 ⁄
,
∗
1
1 ⁄
Then
∗
1 0, ⇒ | , 0| if and only if |
∗
|
|
∞⇒
|
,
1 ,
∞ . .
3.7
1
∶
→
where is the matrix whose entries are defined by (3.7). Therefore applying (2.1) to the ⇒ | , 0| iff the condition (3.6) holds, which completes the matrix , we have that proof. Theorem 3.5. Let 1 ∞ and be a factorable matrix given by (1.5). Then, | , 0| ⇒ if and only if ∗
1
|
|
|
|
where ∗ denotes the conjugate index of . Proof. 1, Let, for 417
∞ 3.8
,
whenever ∑ Then ∑ is summable whenever ∗ ∈ . Also, it follows that
⁄
∗
∗
is summable | , 0| if and only if ⁄
∗
∗
∈
∗
where ∗
⁄
Hence |C, 0| ⇒
, 1 0, if and only if : → . So, applying the matrix
to (2.1) gives
∗
1
|
|
|
|
∞
which completes the proof. Theorem 3.6 Let 1 and only if
s
be a factorable matrix given by (1.5). Then, | , 0| ⇒
∞ and
|
|
1 as → ∞. 3.9
Proof. Since the proofs of Theorem 3.6 is similar to Theorem 3.5, it is omitted. Theorem 3.7. 1 s ∞ and be a factorable matrix given by (1.5) such that , ⇒ | , 0| if and only if all . Then, 1 |
|
|
1 |
if
1 as → ∞. 3.10
|
|
0 for
Proof. Since the proofs of Theorem 3.7 is similar to Theorem 3.4, it is omitted. ⁄ If one takes and in Theorem 3.4 and Theorem 3.5, then the conditions (3.6) and (3.8) are reduced to 1
∗
∞ and
1
∞
respectively, which is impossible. So we get the following results.
418
Corollary 3.8. If s 1, then | , | ⇏ |C, 0| and also |C, 0| ⇏ | , |. ⁄ Also, by taking and in Theorem 3.6 and Theorem 3.7, we get the following results concerning the summability methods |C, 0|, | , | , | , | and |C, 0| . Corollary 3.9. Let s 1. Then, |C, 0| ⇒ | , | if and only if 1 Corollary 3.10. Let s 1. Then, | ,
| ⇒ |C, 0| if and only if ⁄
∗
as → ∞.
4. SECTION Now, we investigate some algebraic and topological properties of mentioned spaces and characterize some matrix operators on these spaces. Theorem 4.1. 1. Then, the set becomes a linear space with the coordinatewise Let addition and scalar multiplication, and also it is a space with respect to the , i.e., norm |
where g is natural norm of
|
and the matrix is defined by , 1 0, .
Proof. The first part is a routine verification, so it is omitted. Let us consider the matrix defined by , 1 0,
Then defines a matrix map from spaces and and are is a
into since it is triangle matrix. Further, since , then is a continuous linear map and so
(prop. 2.5, prop.2.6). Finally, to show that
is a space with
, let
of , where is a sequence whose only non-zero term is us consider the base 1. Let x ∈ and . Then, since y ∈ and has one in . place for property, there exists only one sequence of scalars such that
419
→ 0,
→∞
Thus, it is clear that
which gives the desired. Theorem 4.2. Let 1
∞. Then the space
is linearly isomorphic to the space .
Proof. To prove this, we should show the existence of a linear bijection between the and for 1 ∞. Let us consider the transformation defined by spaces following: :
→
→
where .
It is clear that sequence
is linear and injective transformation. For any by 1 .
‖ ‖
|
‖
|
∈ , we get the
‖
∞.
is bijective, linear and norm preserving. So , the space is Consequently, linearly isomorphic to the space . Now Sarıgöl (2016a) denote by | | the set of series summable by the summability method | , | .Then a series ∑ is summable by | , | iff ∈ | | , where | , | Theorem 4.3. Let 1 and
∶
1. Then |
1 ⁄
∞ .
| is BK- space with respect to the norm
420
⁄
‖ ‖|
|
|
1
|
.
⁄
(Sarıgöl, 2016a). Theorem 4.4. Let 1 ∞. Then the space | , | is linearly isomorphic to the space . Proof. Since proof of this theorem is similar as Theorem 4.2, it is omitted. Theorem 4.5. Let 1 ∞ and be a factorable matrix given by (1.5). Then | , 0| , if and only if
∈
∗ ∗
⁄
Proof. Let, for
1,
∗
⁄
sup
and
∗
∗ ⁄
∗
0
∞ 4.1 ∗
∞ ,
1,2, … 4.2
be matrices defined by 4.3
and , 1 4.4 0 , and respectively. Thus, with the notation of (1.7), it is clear that | , 0| ∗ . On the other hand, it is well known that every triangular matrix has a unique inverse which is also triangle by Theorem 2.8. Thus, there exists an inverse matrix of the matrix , which is given by ∗
⁄
∗
0 Then using by Lemma 2.9, we obtain that ∈ | , 0| ,
and
if and only if
∈
4.5
,
and for all
∈
,
where
is defined by ⁄
∗
and for all ⁄
∗
, 1 0, respectively. Now, from Lemma 2.10, ∈ , ∗ is a matrix in which each entry 421
if and only if ∈
,
, where
⁄
∗
∈ , Then, applying Lemma 2.1 and Lemma 2.3 with ∈ , and for all if and only if the condition (4.1) and (4.2) holds, respectively. Thus, the proof is completed. Theorem 4.6. Let 1 ∞ and be a factorable matrix given by (1.5). Then ∈ , | , 0| if and only if ∗
⁄
sup
1
sup
Proof. Let, for 1, and inverse matrix ∗
∗
∞ , 1
sup ∗ ∗
,
∞ ,
1,2, … 4.6
1,2, … 4.7
,
∞ ,
1,2, … 4.8
and be matrices defined by (4.4) and (4.3), of the matrix ∗ is given by 1 , 1
∗
1
, 0, , 1 Then using by Lemma 2.9 and as in proof of Theorem 4.5, we obtain that ∈
, | , 0|
iff
∈
,
∈
and for all
,
and
where
is defined by 1
,
and for all 1
,
,
1
, 0, respectively. Now, from Lemma 2.10, ∈ , if and only if ∈ is a matrix in which each entry 1 , ⁄ ∗
Then, applying Lemma 2.2 and Lemma 2.3 with 422
∈
,
and for all
,
, where
∈
,
if and only if the condition (4.6), (4.7) and (4.8) holds, respectively. So, the proof is completed. Theorem 4.7. Let 1 ∞ and be a factorable matrix given by (1.5). Then, ∈ | , 0|, if and only if
Proof. Let, for
1
∗
⁄
sup
∞ 4.9
be a matrix defined ∗
⁄
, 1 0, Thus, by (1.7), It is clear that and | , 0| and as in proof of Theorem (4.6), we obtain that ∈ | , 0|,
iff
∈
,
where
4.10
. Then using by Lemma 2.9,
is a matrix in which each entry ⁄
∗
if and only if the condition (4.9) holds which Then, from Lemma 2.2, ∈ , completes the proof. Theorem 4.8. Let 1 and be a factorable matrix given by (1.5). Then the necessary and sufficient conditions for ∈ , | , 0| are ∗
1
1 |
,
Proof. Let following.
⁄
⁄
∗
∞ 4.12 ∗
1 1
∗
1
sup sup
∞ 4.11
|
,
∞,
∗
be given by (4.10) and
that is its inverse defined by
1 ⁄
∗
,
1 , ⁄ ∗ 0, , 423
0,1,2 … 4.13
1 4.14 1
Then, as in proof of Theorem 4.7, we obtain that we have ∈ , and are given by Lemma 2.9. With a few calculations, we get where and 1 1 , ⁄ ∗ ⁄ ∗
∈
,
and 1
1 ∗
⁄
⁄
1
∗
,
4.15
0 Firstly , applying Lemma 2.1 with the matrix , we get the condition (4.10). Again , if , then (4.12) and (4.13) hold. Thus the proof is we apply Lemma 2.3 with completed. Theorem 4.9. Let 1 ∞ and be a factorable matrix given by (1.5). ∈ | , 0| , if and only if ⁄
∗
⁄
⁄
∗
⁄
and if and only if
∈
∗
∗
⁄
sup Proof. Let, for 1, Thus ∈ | , 0| ,
∗
⁄
∗
∗
1 4.16
∞ 4.17
be matrices defined by (4.3) and (4.10). , and for all ∈ , , where
is a matrix in which each entry ⁄
and for all
∗
⁄
∗
is defined by ⁄
∗
, 1 0, Then, from Lemma 2.4 and Lemma 2.3, ∈ , and for all ∈ , if and only if the condition (4.16) and (4.17) holds, respectively which completes the proof. Theorem 4.10.
If , 1 and be a factorable matrix given by (1.5). Then if and only if following conditions hold:
424
∈
, | , 0|
∗
⁄
,
⁄
∗ ∗
∞,
0,1, … 4.19
∗
1
,
⁄
1
1 4.18
∗
1
sup sup
⁄
∗
1
∞,
∗
0,1, … 4.20
Proof. Let we define the matrix and by (4.10) and (4.3). inverse of is defined by (4.14). Then as in proof of Theorem 4.9, we can write ∈ , | , 0| iff ∈ , and ∈ in which each entry
, ⁄
where ∗
and
are given where
1 ⁄
is a matrix
1 ∗
,
⁄
∗
and (4.15). Firstly, if we apply Lemma 2.4 with the matrix , we get the condition (4.18). Again, if we apply Lemma 2.3 with , then (4.19) and (4.20) hold. Thus, the proof is completed. REFERENCES Bennett, G., (1987). Some elementary inequalities, Quart. J. Math. Oxford 38, 401-425. Boos, J.; Cass, P. (2000). Classical and modern methods in summability, Oxford University Press, New York. Bor, H. (2009). A new result on the high indices theorem, Analysis 29, 403-405. Bor, H.; Kuttner, B. (1989). On the necessary conditions for absolute weighted arithmetic mean summability factors, Acta. Math. Hungar. 54, 57-61. Bosanquet, L. S. (1950). Review of [5], Math. Reviews, MR0034861 (11,654b). Flett, T. M. (1957). On an extension of absolute summability and some theorems of Littlewood and Paley, Proc. London Math. Soc. 7, 113-141. Hazar, G. C.; Gökçe, F. (2016). Bulletin of Mathematical Analysis and Applications, 8, 1, 22-26. Malkowsky, E.; Rakocevic, V. (2007). On matrix domains of triangles, Appl. Math. Comp. 189 (2), 1146-1163. Malkowsky, E. (1996). Linear operators in certain BK spaces, Bolyai Soc. Math. Studies 5, 241-250. Mazhar, S. M. (1971). On the absolute summability factors of infinite series, Tohoku Math. J.,23, 433-451. Mehdi, M. R. (1960). Summability factors for generalized absolute summability I, Proc. London Math. Soc. (3), 10, 180-199. McFadden, L. (1942). Absolute Nörlund summability, Duke Math. J., 9, 168-207. Orhan, C.; Sarıgöl, M. A. (1993). On absolute weighted mean summability, Rocky Moun. J. Math. 23, 1091-1097. Sarıgöl, M. A. (accepted-2016a). Spaces of series summable by absolute Cesàro and matrix operators, Com. Math. Appl. Sarıgöl, M. A.(2016b). On absolute factorable matrix summability methods, Bull. Math. Anal. Appl. 8, 1-5 425
Sarıgöl, M. A. (2015). Extension of Mazhar's theorem on summability factors, Kuwait J. Sci. 42, 1-8. Sarıgöl, M. A. (2013a). Characterization of summability methods with high indices, Math. Slovaca 63, No. 5, 1-6. Sarıgöl, M.A. (2013b). An inequality on matrix operators and its applications, Journal of Classical Analysis 2, 145-150. Sarıgöl, M. A. (2012). Matrix operators on , Math. Comp. Model. 55, 1763-1769. Sarıgöl, M. A. (2011a). Characterization of general summability factors and applications, Computers and Mathematics with Applications 62, 2665-2670. Sarıgöl, M. A. (2011b). Matrix transformations on fields of absolute weighted mean summability, Studia Sci. Math. Hungar., 48 (3), 331-341. Sarıgöl M. A.; Bor, H. (1995). Characterization of absolute summability factors, J. Math. Anal. Appl., 195, 537-545. Sarıgöl, M. A. (1994). On inclusion relations for absolute weighted mean summability, J. Math. Anal. Appl., 181 (3), 762-767. Sarıgöl, M. A. (1993a). On two absolute Riesz summability factors of infinite series. Proc. Amer. Math. Soc. 118, 485—488. Sarıgöl, M. A. (1993b). A note on summability, Studia Sci. Math. Hungar., 28, 395-400. Sarıgöl, M. A. (1992). On absolute weighted mean summability methods, Proc. Amer. Math. Soc., 115 (1), 157-160. Sarıgöl, M. A. (1991). Necessary and sufficient conditions for the equivalence of the summability methods and , Indian J. Pure Appl. Math. 22, 483-489. Stieglitz, M.; Titez, H. (1977). Matrix transformationen von Folgenraumen Eine Ergebnisüberischt, Math Z., 154, 1-16. Sunouchi, G. (1949). Notes on Fourier Analysis, 18, absolute summability of a series with constant terms, Tohoku Math. J., 1, 57-65. Wilansky, A. (1984). Summability Through Functional Analysis, Mathematics Studies. 85. North Holland, Amsterdam.
426
Chapter 32 On Geometry of Quaternions Serpil HALICI*, Şule ÇÜRÜK** 1. INTRODUCTION It is well known that the complex numbers form a plane. Their operations are very related to two-dimensional geometry. In particular, multiplication by a unit complex number, | | 1, which can all be written gives us a rotation by angle . The multiplication of any two complex numbers;
Fortunately, there is a better way to multiply complex numbers, thanks to L. Euler who proved that cos sin Geometrically, this last formula says that lies on the unit circle in [Girard, 2007 ]. Im cos sin θ
Re
If we multiply by a positive number , we get a complex number of length ; that is . By adjusting the length and angle , we can write any complex number in this away. And this gives a great way to multiply complex numbers; , and now .
*
Assoc. Prof. Dr., Pamukkale University, Faculty of Science and Arts, Depart. of Math.
[email protected] ** Postgraduate Student, Pamukkale University, Faculty of Science and Arts, Depart. of Math. Denizli
[email protected]
In particular, if we multiply a given complex number by which has unit length 1, the result has the same lenght as . It is rotated by degrees. So, we can use complex multiplication to do a rotation. The 19 th century Irish mathematician and physicist William Rowan Hamilton was fascinated by the role of in two-dimensional geometry [ Hamilton, 2000 ]. For years, he tried to invent an algebra of triplets to play the same role in three dimensions, ∈ The only normed division algebras which are numbers systems where we can add, subtract, multiply and divide, and which have a norm satisfying | | | || | have dimension 1, 2, 4 and 8 ( see [Kuipers, 2002 ]). Hamilton’s search continued into 1843. He discovered a 4-dimensional division algebra called the quaternions. Since the quaternions don’t commute, a useful topic for multiplication is given by John Baez as follows.
Figure 2 k Hence the quaternions are |
where , and
; , , ,
∈
are all square roots of 1. And ,
,
,
1 1.1 If we have studied vectors, we may also recognize , and as unit vectors.
The quaternion product is the same as the cross product of vectors; ,
,
In fact, for the cross product 0 428
while for quaternions, this is 1. We can think of a quaternion as having a scalar part and a vector part; ,
We can use the cross product, and the dot product .
to define the product of quaternions to do 3 rotations, so thing of three-dimensional space as being purely imaginary quaternions |
; , , ∈
.
Just like for complex numbers, the rotations are done using unit quaternions, that is cos
sin , cos
sin , cos ,
By analogy with Euler’s formula, we write these as Note that , and
sin ,
.
are just three special unit imajinary quaternions. We take,
as any unit imaginary quaternion that is any vector. Then cos sin is a unit quaternion. We write this, by analogy with Euler’s formula, as . We can take as the angle ∈ and reel axis and sin as the projection of onto the between the vector subspace of pure quaternions. Since 1 for any ∈ , is the set of unit vector quaternion, we have 1
!
!
!
⋯
cos
sin ,
for any real . From this definition De Moivre’s formula can be written as cos sin , for every integer Girard, 2007 . 2. QUATERNIONS AND THEIR GEOMETRY In this section we give some fundamental properties of quaternions. We consider the geometric interpretation of quaternions and quaternion multiplications. Theorem 2. 1: If
is a unit vector, and
gives the result of rotating
is any vector, then the expression
about the axis in the 429
direction.
In particular, quaternions gave rise to vector algebra, one of the most fruitful areas of mathematics. We may record each quaternion; as a formula some of the real number and the vector number part of , and its vector part. If we take two vector quaternion and as follows.
. We will call
the
, Then we can calculate the multiplication of their:
Thus, the real part of
;
and the imaginary part of
;
Note that the real and imaginary parts have a defined geometric sense. In [Horn, 1990], the scalar product of the vectors and is defined as follows; ,
| || | cos
Moreover, we can prove that , .
If we consider the above figure, we can easily see that cos , Moreover, if the non-zero vectors and are perpendicular, then their scalar product is zero. In this case the real part of the product is zero and is a pure vector. It 0 and and are perpendicular. follows that cos Now, we give the geometric interpretation of the vector part of the product . Recall that the cross product of the vectors and , We know that the vector , is perpendicular to each of the vectors and and its length is equal to | || | sin . That is this product is equal to the area of the and . paralellogram on the vectors In order to see the perpendicularity of the vectors , and . Its suffices to show 430
that their product is a pure vector: ,
, | |
,
Since
we can replace
,
by | | .
In the last equation second side of the equation is a sum of two vectors. Thus, the result is a vector. However, we can compute the length(area) of the vector , . According to definition its square is equal to The last expression is | | | | , or, according to the definition of the scalar product | | | | cos | | | | . Thus, we obtained that the length of the vector , as follows. | | | | sin where denotes the area of the parallelogram on the vectors and . Note that the orientation of the triple , , , in space is the same as the triple , , . By the aid of the definition of scalar and cross products we can write ,
,
.
That is the last equation is the multiplication of pure vector quaternions. In fact, the scalar and cross products are fragments of quaternion multiplication. Also, the operations of scalar and cross products that together with vector addition and multiplication of vectors by scalar are the basis of vector algebra. The vector algebra a branch of mathematics with various applications physics, mathematics and especially mechanics. It should be noted that the presentation of vector algebra studied later than the first studies on the theory of quaternions. . THE GEOMETRIC INTERPRETATION OF THE MULTIPLICATION OF A QUATERNION Firstly, we explain the geometric importance of the multiplication of a quaternion by a pure vector quaternion. If a unit quaternion as, , Then its absolute value is 1.
If we write , is the vector 180°, such that exists a unique angle , 0° cos ,
| |
431
,| sin
|
| |
1, then there
Also we can write
| | , | |
1
and
cos sin . It should be noted that any quaternion of absolute value 1 can be represented with a vector of unit length and this representation is unique. If we multiply the quaternion by a vector quaternion , that is perpendicular to p, then we have cos sin cos sin . is zero because and are perpendicular, and the vector part of The real part of is , , that is, | || | sin | |. , Also, we know that , is perpendicular to and . denotes the result of rotating through about . We can take the orientation of the rotation about is to be the same as the orientation of the smallest rotation from to about . Thus, we have cos sin
In order to above figure we can say the vector is obtained from by a rotation through about the vector . Briefly, we can say that if is a vector of length 1 and is any vector perpendicular to , then by multiplying on the left by the quaternion cos sin We rotate it about through the angle .
. REPRESENTATION OF AN ARBITRARY ROTATION IN SPACE BY MEANS OF QUATERNIONS In this section we investigate the rotations by quaternions. Theorem 4.1: The vector through 2 [Ward, 1997]. Proof: Assume that
is the result of rotation the vector
is perpendicular to . Then we can write
432
about the vector
cos
Note that
sin
cos
sin .
is again a vector perpendicular to . Thus, we have .
We know that the quaternion is the vector obtained by rotation vector through , see below figure.
If we denote it by
about the
, then
cos sin . cos sin is the vector obtained by rotating about through the angle . Then, it is clear that is the result of the rotating about through the angle 2 . Corollary 4.1: In the generally case if the vector is a multiply of , ⋋ , then and
If we take the vector components, that is where
is as an arbitrary vector, we can decompose it into two
is a vector perpendicular to , and
is proportional to . Then, we have . Thus, we conclude that the component is rotated about through the angle 2 and the component remains unchanged. But then is rotated about through the angle 2 . Corollary 4.2: The rotation about through the angle 2 takes the vector into the vector , where cos sin . Thus, we give some fundamental properties of quaternions. Moreover, we consider the geometric interpretation of quaternions and quaternions multiplications. 5. CONCLUSION In this study, we investigate the quaternions. We give some fundamental properties of these quaternions. Moreover, we consider the geometric interpretation of quaternions and quaternions multiplications.
433
REFERENCES Girard, Patrick R. (2007), Quaternions, Clifford Algebras and Relativistic Physics, Birkhauser Verlag AG. Hacisalihoglu, H. H. (1983), Hareket Geometrisi ve Kuaternionlar Teorisi, Gazi Üni. Yayınları, No.30,. Hamilton W. R., ( 2000), On quaternions. In: Halberstam and Ingram [13], chapter 8, pages 227-297. First published in various articles in Philosophical Magazine, 1844-1850. Horn, R.A., Johnson, (1990), C.R. Matrix Analysis, Cambridge University Press, Cambridge . Kuipers, J. B.(2002), Quaternions and Rotation Sequences, Princ. Uni., Press. Ward, J. P. (1997 ), Quaternions and Cayley Numbers, Springer Science.
434
Chapter 33 Fragmentation in the Macro-Urban Form and Natural Thresholds of a Delta and Riverfront City in Anatolia: Case of Silifke Nilgün Çolpan ERKAN*, Cenk HAMAMCIOĞLU
1. INTRODUCTION Rapid growth and changing macro-urban forms of contemporary cities reveal fundamental challenges in the context of natural environment today. Notably, many researchers and institutions in the international arena agreed that 'urban forms of cities have become one of the most evident sources of environmental problems' (Breheny, 1996, 13; Register, 2006, 47-49; EEA, 2006, 11; Jenks & Kozak, 2008, 71). Converting large portions of territories into built environment at the fringes of cities, depletion of fertile lands and natural landscapes, consumption of energy resources and disposal of wastes directly into the atmosphere are assigned as foremost issues in the report of European Environment Agency (EEA) (2006, 28-35). At the same time, growing ignorance of natural thresholds such as local climatic conditions, orientation, floods and earthquakes composed other group of factors indicated in unconsciously development of contemporary cities. Both set of problems pertaining to natural thresholds are valid not only for metropolitan cities but also recently for small and mid-sized cities in Turkey. Silifke, a delta and riverfront city in Anatolia is one of the small and mid-sized cities where similar problems can be observed distinctly. For that reason, rich natural landscape and thresholds that should have priority to shape the physical form of Silifke are examined in this study. Göksu River, sand dunes and lagoons in the delta which are subjected to the International Ramsar Convention, fertile lands for agricultural activities behind the delta, hilly topography covered with forest and scrubs encircling the plain and the river valley and semi-arid-less humid climate conditions are some of them. These natural features critically possess high potentials for the city’s economy, which is based on agriculture and related sub-sectors and tourism today. On the other hand, Silifke has been established on the traces of an ancient city likely in many cities in Anatolia. Therefore, the city involves both archeological and historic urban sites of a multilayered character. This study claims that, factors and mechanisms influencing the development of cities’ macro-urban forms change according to socio-economic, politic and technological milestones. As an example for these factors’ enforcement in between the macro-urban form and natural thresholds relationship, Silifke is evaluated in three main periods. The study, additionally aims to contribute to understand the physical development process of Silifke discussed very little in scientific literature. *
Assoc. Prof. Dr., Yıldız Technical University, Faculty of Architecture, Department of Urban and Regional Planning.
2. MUTUAL RELATIONSHIP BETWEEN MACRO-URBAN FORM – NATURAL THRESHOLDS AND METHODOLOGY FOR THE STUDY Complex structures of cities comprise various factors that determine their macrourban forms. In other words, human environment of cities are products of physical and non-physical factors and in the scientific literature mainly grouped into two as; human and nature based (Gallion & Eisner, 1963:4-5; Kostof, 1992:7; Morris, 1994:10; Schwarz, 2010:30). Accordingly; human-based factors involving economy, policy, law, planning decisions, population, density, level of technology and nature-based factors such as landscape and topography, soil and geological structure, climate, vegetation characteristics, flood, earthquake, landslide are predominant components in shaping the form of cities. Meanwhile, these two major groups of factors interact with each other as well as with their components. 'Urban form' concept roughly represents the physical structure of settlements and characteristics. While, Lynch (1984:47) resembles urban form to “spatial pattern of large, stable and permanent physical objects”, Anderson et.al. (1996:7) stated the form of a city as “spatial layout composed of certain elements”. On the other hand, Batty (2008:769) and Tsai (2005:141) explored that the form of a city is “the pattern formed by a certain time and place of human activities”. Urban morphologists and topologists identify and study ‘urban form’ as a field of science at the schools of Conzen, Muratori and Versailles since 1950s and 1960s. These studies intend to analyze the whole city or historical development process of certain parts, organization schemes and spatial characteristics in order to gather information for inputs for the future urban design and plans. (Moudon, 1997:8; ISUF, 2014). Relatively, the content of this research focuses on the interaction between urban form and natural thresholds in macro-urban scale considering the population, land use (urban facilities, transportation network), spatial growth and magnitude components. In general, nature provides nutrition, raw materials and energy sources, while offering a variety of environment to shelter and to engage different activities for humankind. If the cities of pre-industrial period with limited technology and production are remembered, generally an adjustment to a certain balance between human activities and nature will be recognized (Pollio & Morgan, 1960:24-31; Money, 1972:64-65; Lozano, 1990:209-214; Tekeli, 2011:42). McHarg (1969) observed that in pre-industrial period communities shaped their cities taking advantages of favorable opportunities for living and economic activities, while preventing from the risks as much as possible (Özügül, 2012:108). For example, during the establishment of cities; easily defended inefficient lands, hills and their sloping terrain were preferred according to security, domination of environment and political factors. Meanwhile, fertile plains were allocated to basic livelihood and agricultural activities. Another fact influencing the macro-urban forms of the cities were the destructive features of earthquakes, floods and landslides. Areas exposed to such threats measures have been taken and comprehended as natural thresholds that those must not be exceeded. For an example in the past, the cities were located with a distant to the Nile in Egypt in order to take advantage of natural irrigation for agricultural activities. Similarly in Mesopotamia, channels were built on rivers to protect cities from the devastating impacts of floods (Mumford, 2013:74-81). On the other hand, topography and local climate factors formulated allocation of facilities in land use, orientation, size and proportion of streets, plots, and buildings, form of architectural plans, roofs, material and the authenticity of a society 436
and settlement character. However, the adjustment established between the nature and cities began to change following the capitalist approach in production and industrial society through technological, economic and political processes. During this transformation, size of cities became the main distinctive indicator from the pre-industrial city in terms of macro-urban form (Raddison, 2001:67-69). Firstly Colby (1933) explained that the spatial structure of a city is a product of centripetal forces of attraction and congestion, centrifugal forces of dispersion and decongestion, and forces of areal differentiation (Balchin et.al, 2000:87; Bontje, 2001:44-45, Uzun, 2012:146-147). But many theories on spatial structure and urban growth found to be unsatisfactory, and today it is widely accepted that every city has its individual dynamics. Since, some of the cities erect under the influence of industry and technology, but some others by tourism or trade sectors including a set of political, legal and planning decision processes. At this point, putting assets such as common rules and adjustment with environment aside, it leads rupture in the interaction between the macro-urban form and nature in return (Whitehand & Morton, 2004:275). Hough (1984:2) bases the collapse in natural environmental assets with socio-cultural ties upon the hegemony of technology whereas economic interests became the focal point. Consequently, the growing macro-urban forms of many cities pollute and consume basic natural sources (fertile soil, water, vegetation) of urban economy and ecology. On the other hand, Tekeli (2009) argued that “dilemma” in the policies of administrative and planning mechanisms about the allocation of facilities threats the health of human society and environment facing with higher costs. Undoubtedly, it has motivated and provoked scholars and practitioners in different disciplines to seek new forms of solutions for human settlements that will meet the requirements of sustainability and enable built environments to function in a more livable way than at the present (Jabareen, 2004:38). In the context of sustainability two main urban approaches have been addressed; ecological/green city and compact city. In ecological city approach the city is compatible with the climate and the environment, flora and fauna are protected, water, air and soil pollution is prevented, energy consumption is reduced, energy is supplied from renewable sources, the waste is converted (Beatley 2000, Low et.al, 2005). Compact city approach requires rural conservation, development and improving the quality of life including energy consumption and greenhouse gas emissions reduction (Frey, 1999, Burgess, 2000). This article highlights natural thresholds that should be taken into account in both sustainable urban models. In Turkey studies on the urban form often focuses on urban sprawl in metropolitan cities, while the relation with natural thresholds of small and mid-sized cities have not been addressed sufficiently. On this account, natural thresholds of Silifke are analyzed over current goggle maps at first. In next sections, macro-urban form development and natural threshold relationship is discussed due to factors and mechanisms in pre-1923, 1923-1967 and after 1967 periods enhanced by the demographic and economic data collected from public associations. 3. THE LOCATION AND NATURAL THRESHOLDS OF SILIFKE Silifke is located in the south of the Taurus Mountains with a distance of 14km inland the sea in Mersin province at the Mediterranean region of Turkey. It stands on a distinctive geography adorned by a harsh river flowing through a rift valley and 437
irrigating a very fertile delta plain circumscribed by forests, boshes in patches over hilly landscape before empty its water to the sea. Geography concerns very rich environmental features that are critical for the sustainable development of city. In the natural threshold analysis; the Göksu river and floodplain area, fertile lands and local climate conditions are accepted as three major components. Furthermore, the delta that is subjected to the International Ramsar Conven-tion principles in the Environ-ment Conservation Area1 composes lively habitat at proximity (Fig.1). Göksu river and floodplain area Taking the source from Taurus Mountains, the Göksu River flows 250km and passes through Silifke and deports into the Mediterranean Sea from the delta plain. The river meanders at the gate towards the plain and increases flood risk where the city develops today. Concurrently with heavy amount of precipitation on the mountainous area invigorates probable flood risk especially during the winter and spring seasons (Turkish State Meteorological Service, 2016). About the issue General Directorate of State Hydraulic Works3 in 1951 announced that, 125 meters from both sides of the river was determined as under the flood risk. However, these boundaries were inadequate and unrealistic because in Figure 1. Location and Natural Thresholds of Silifke in November 2001 and March Göksu Delta2 2004 large-scale, in May 2009 a part of the city has been faced with floods (Fig. 2). For an example, while 600 residents and shops remained under the flood in November 2001, more than 10.000 residents and shops exposed to 1,5m river waters (Municipality of Silifke, 2004). These floods caused real injuries and gave damage to the infrastructure and buildings. But due 1
The Göksu Delta declared as Environmental Conservation Area according to the Environmental Law of Article 9 and "Protocol Concerning Specially Protected Areas in the Mediterranean," in1990 is one of 12 Special -one in Turkey designated by the Turkish Council of Ministers and listed in the 1st Degree Natural Protected Areas by the Ministry of Culture in 1996. 2 Floodplain boundary given in the figure is taken from the digital database of Regional Directorate of the Special Protection, 2008. Demirel et.al. (2010, 178) also utilized the same floodplain boundary in their research about the Göksu Delta. 3 State Water Works Silifke VI. Region/62. Directorate regarding the Göksu River Flood Area Boundary, June 15, 1951 and 7838 decisions published in the Official Gazette numbered 12920.
438
to its location and topography, the historic part of the city survived. Therefore, the floods happened recently and topography is considered in defining the natural boundary of floodplain (Fig. 2). Fertile agricultural lands The formation of delta plain composed of alluvial earth where the capability of soil is not steady against the earthquakes and floods invading occasionally. However, it provides necessary activities for agriculture and makes it to be the leading economy in Silifke. Facilitated with improved irrigation systems and appropriate climate, it is possible to harvest three times a year from the fertile fields. Strawberry (50% of Turkish Mediterranean), tomato and lemon (6% of Turkey) are some of widespread products in agriculture (Environmental Conservation Institution, 2009). These fields also take over a buffer zone role between the city and Environment Conservation Area declared in 1990 (Fig. 2).
Figure 2. Major Natural Thresholds of Silifke
Local climate conditions According to the climate categorization of Turkish State Meteorological Service (2016), in the region of Silifke summers are generally hot and without rain, winters are mild and rainy possessing semi-arid and humid Mediterranean climate features. The average temperature measures 10C in winters and 27,8C in summer seasons. In the context of local climate, topography, prevailing moderate breeze and orientation concern vital roles. While the city is completely surrounded by hills from three sides, it only opens to the plain in east direction. Therefore, territory on the south of the river is the most convenient part for development orienting to the north and east advancing prevail gentle breeze where the traditional part of the city was also founded. However, the flat plain area and the hills overlooking south and west directions are inconvenient because of long hot summer days (Fig. 2). 4. THE CHANGE IN INTERACTION WITH NATURAL THRESHOLDS THROUGH THE HISTORIC DEVELOPMENT PROCESS In this section the interaction of natural thresholds reviewed above and the macrourban form of Silifke is investigated in three periods; from Seleuica Ad Calycadnum to Silifke (before 1923), 1923-1967 and after 1967. Since the ancient times until the declaration of Republic is the period where natural thresholds are predominantly considered. Between the years 1923-1967, rapid development gained momentum and started to inhibit natural thresholds available for the sustainable development. After 1967 master plans are on the agenda, however inefficient growth displaying beyond the natural thresholds could not be prevented because of a set of socio-economic issues and 439
politic mechanisms carried on. 4.1. From Seleucia Ad Calycadnum to Silifke (Before 1923) Seleucus I Nicator, a general of Alexander the Great, founded Seleucia ad Calycadnum in the early third century B.C. The city is established just crest of a conical steep hill at an altitude of ~184 meter controlling the entrance of a grumpy valley performing a defendable area especially against attacks from the sea. There were several settlements similar in this name (Seleucia Tigris, Seleucia Pieria …) that is why the river was added as a reference to the city, since then, the city was called Seleucia ad Calycadnum (Gürtürk, 1987:29; Yurt Ansiklopedisi, 1982:5; Everett-Heat, 2005). Excellent geopolitical position gained strength by the crossroads of trade routes where the land, river and the sea meet and rich cultivable land earmarked Seleucia ad Calycadnum enable to achieve a considerable commercial and cultural prosperity of its time (MacKay, 1976; Uçar, 2009:16; Çakmak, 2009:56; Taşkıran, 1994:22). However in the late periods of Roman and Byzantine, Seleucia ad Calycadnum became one of the commotion areas between the new diffusing religion (Christianity) and the advocators of Ancient Greek believes in the 4th century A.D. Following ongoing invasions by the Arabs in the 7th century, Turkmen and Crusaders attacks in the 11th century, the city was suffered, dwindled and a limited number of traces4 left behind the worthy built structure of the Hellenistic and Roman periods. For that reason, inferences about the spatial organization of the city during Antiquity are not concrete. Even so, the mind behind the allocation of existing facilities of antiquity demonstrates that the city had been evolved with certain principles. Notably the situation of the city over the sloping terrain monitoring the trade routes connecting inland Anatolia and the Mediterranean Sea through a natural transport corridor provided security and defend. Meanwhile the fertile plain was devoted to agricultural activities. As Gallion & Eisner (1963:24-26) and Mumford (2003:84, 204) emphasized the role of topography and height in shaping the Antiquity city, sloping terrain provided the city to be perceived from a distant. Pitched topography also provided a well-drained area protecting the city from probable overflows often caused by the Calycadnus River. As in many ancient cities, the local climate conditions are one of the natural components shaping the macro-urban form (Pollio & Morgan 1960:24-31). As well as the advantages of river, plain and scene, to be able to shorten duration of long summer sun and to benefit from the northern breeze are favored principles perceived in the orientation and site location of ancient public facilities. Allocation of the Acropolis and major buildings on the east and northeast of the hillside certifies this argument. According to the archeological excavations the city might have spread over 43Ha area with a population5 of between 4
Jupiter/Zeus temple, theater, stone bridge, water cistern, hippodrome/stadium and cemetery are the heritage ruins in the city from antiquity (Hellenic, Roman, Byzantine)(Keil, Wilhelm, 1931). 5 Hanson (2011, 254) has identified possible population of the city according to different densities: 100p/HA=4,300 people, 150p/HA=6,450 people, 250p/HA=10,750kiş of 400p/HA=17,200 people. Venetian J. Barbaro who visited Silifke in the 15th century mentioned that the dimension of the theater (85x65m) in Silifke was similar to the theater of Verona (100x70m) in terms of size and shape which has a capacity about 10,000 (Gürtürk, 1987, 252-
253; Taşkıran, 1994, 32). ın the respect of this information, the theater in Seleucia ad Calycadnum might have the available capacity between the 5,000-10,000. The population of the town with this inference could be estimated around 10,000.
440
5.000-20.000. In the 13th century Silifke experienced the Seljuk and Principality of Karamanids sovereignty. The settlement recovered within the Ottoman rule in the 15th century and a new era began on the ruins of the ancient city with a new name. At the beginning of this period, prominent component in the macro-urban form was topography, distinguishing the city into two different settlements. Former was the medieval ovoid shaped castle settlement covering an area of 3Ha by walls continuing its military based function with some houses and a masjid inside. The other was down the hill orienting towards the river in an open settlement model that inherited its infrastructure from antiquity. This part of the settlement developed around the first Turkish-Islamic building (Grand or Alaadin Mosque) constructed by Seljuks in 1226 situated over the foundation of an ancient temple or church. Both Tanyeli (1987:66-67) and Tekeli (2011:38-39, 230) consider that the settlements during the Ottoman period stretched out of the castle onto flat plain where the new facilities (khan, bazaar…) were built towards caravan routes. In this context, establishment of security under the Ottoman rule, the caravan trade has gained importance again at the Göksu valley corridor.6 The castle settlement gradually lost its significance during the construction of Taş Han (Stone Khan) and shops7 down the hill. Thus the population8 advanced from 430 in 1500 to 1227 in 1584 and expanded fivefold of castle and reached to 16Ha. Between the 16th and 19th century the population of the settlements in Anatolia remained stable in accordance with the geographical conditions, type of land management, production based on organic energy and transport infrastructure reasons (Aktüre, 1975:119; Tekeli, 2011:227). The macro-urban form of Silifke which identifies a centric rural village character function according to Yalçın (2004b:82), preserved the size of 1/3 of Roman era, taking floods, fertile lands and local climatic conditions into account. In the 19th century, the population and physical growth of settlements in Anatolia gained momentum depending on three basic political factors (Aktüre, 1975:107; Tunçdilek, 1986:127-128; Tekeli, 2011:237-250). In this context, former factor influenced the development of Silifke was migrations which head for to more secure urban settlements from the countryside enforced by the Jalal revolt erupted and the move of Muslim communities from the regions going out of the control of the Ottoman Empire. The second factor was semi-colonial trading activities via capitulations realized by industrializing countries such as England and France in order to supply raw materials and trade. Finally the third one was the reform endeavors aiming to adapt new socioeconomic and governance system in the state during the process of decline. At the end of the 19th century in addition to the Turkish and Gypsy communities, Rum (Anatolian Greek) and Armenian groups who escape from the revolts involved to 6 Silifke was located on the secondary caravan roads in the network system in the Ottoman period. Although the environment possesses fertile agricultural land and potential product range, the economy in Silifke was focused on the limited production activities (Yalçın, 2004, 75; Uçar, 2009, 53). 7 According to Temettuat yearbook the number of shops has increased from 30 in 1550 to 50 in 1584 (Uçar, 2009, 53). 8 In 1500, according to Temettuat yearbook 86 households (an average of about 430 people considering that in each household five people were living) and in 1584 Silifke was composed of 322 households, around 1227 habitants (Uçar, 2009, 54-55).
441
the city’s population. Thus, the population increased to 1.708 in 18799 (Yalçın, 2004a:26). According to Adana Province Salname (yearbook) the number of neighborhoods in Silifke was two in 1876, increased to five in 1879 and eight in 190210. Consequently, at the first decades of the 20th century Silifke approximated to the limits of Seleucia ad Calycadnum in the ancient period and partially reached to 38Ha exceeding into the floodplain zone (Fig. 3).
Figure 3. The relation with natural thresholds in Silifke until 1920s (Thresholds designated over the map of Keil & Wilhelm (1931) dating 1925).
Nevermore, the picture dating 1905 and Keil & Wilhelm’s map of 1925 shows that the northern bank of the river was still native and empty (Fig. 4). On behalf of changes in the hierarchy of governance appertaining to reforms, Silifke became a Sanjak center and started to evolve rather than a rural character to a more commercial center ruled by the capital networks. Regulations also necessitated new types of urban public facilities and institutions (municipality, government head office, caserne …) to be established next to the market center (Aktüre, 1978:90-98, Tekeli.2009, 108). Therefore during the late Ottoman period, the macro-urban form begun to shape with the reinforcement of public facilities. Silifke municipality was founded in 1854, a branch of Ottoman Bank indicating the growth of economic activities was established in 1906. And, according to Adana Salname the number of shops in the town doubled and reached to 200 between 1872 9
During this period, the population of Silifke modified into a multicultural atmosphere as perceived from the construction of the Armenian Church at Cam-i Kebir Neighborhood, the Greek Church and Reşadiye Mosque at Saray Neighborhood. However, this structure suffered at the end of the 1st World War and the War of Independence in terms of international treaties. 10 While Turkish community inhabited at Cami-i Kebir, Mukaddem, Pazarkaşı and Saray neighborhoods at the north-east of the castle, Rum community at Saray, Armenians at Bucaklı and Cami-i Kebir, Gypsies at Say Neighborhood which was a necropolis in the antiquity (Taşkıran, 1994, 38; Yalçın, 2004a, 58).
442
and 1879 (Yalçın, 2004a:65). However, the operation of Adana-Mersin railway in 1886 highlighted Mersin city, which afterwards became an international busy harbor in the East Mediterranean and reduced the importance of Silifke-Central Anatolia route and trade activities to secondary.
Figure 4. Roman Bridge and agricultural fields on the north of river in 1905 (Bell, 1905).
4.2 Growth of Republican Period City on Banks of the River (1923-1967) Since the establishment of Republic in 1923 until the first approved urban development plan of Silifke in 1967 is the era, when the fragmentation in the macrourban form with natural thresholds appeared for the first time. The modification in the management hierarchy of settlements conducted by the newly state and the urbaneconomic development policies are the issues gradually influenced physical growth adversely in terms of thresholds. Subsequent the establishment of republic, national governance stated to transfer the authority of central province from Silifke to Mersin city in 1933 on behalf of the act of “changes in the status of certain provinces” (Gürtürk, 1987:213). Within the framework of the development initiatives launched after the War of Independence to accomplish a new center, urban spaces and institutions that will symbolize western and modern perspective of new Republican state promoted in most of the cities of Turkey (Keskinok, 2010:184). In light of these circumstances and despite the modification in the hierarchy of Silifke; investments for education, social and health facilities have begun to be installed parallel with the State's modernization endeavors in 1930s. However, the allocation of these public service facilities on the north of Göksu River inadequately oriented the physical development towards the territories where vulnerable cultivable lands, flooding area and uncertain climate conditions overlapped (Fig. 5). After the Second World War in 1950s the adoption to a multi-party government model parallel to the open international market economy received support from the Western World. The Marshall aids and other incentives encouraged the utilization of technology in agriculture and rubber-wheeled vehicles in transportation sectors. The radical shift in transport policies from railways to motor vehicles necessitated the construction of asphalt roads. Hence Silifke’s macro-urban form development gained another impetus due to the given priority to motor vehicle traffic.
443
Figure 5. Inadequate development towards thresholds 1923-1967 Population Exchange between Rums with the Turkish population living on Aegean islands and voidance of Armenian community were significant demographic issues realized at the beginning of 1920s. Even so, according to the official figures Silifke inhabited 4.801 people in 1927. Following up the open economy, technology gradually took place of organic energy and augmented unemployment particularly in rural areas after 1950s. The migration from rural territories primarily influenced large cities such as Istanbul, Ankara at first, but latterly bear middle-small scale cities as a result of improvements in public services and accessibility. Thus, the population in Silifke grew from 6.643 in 1950 to 11.000 in 1960 (TÜİK, 2013). Urban land-use Silifke continued to preserve the physical atmosphere and traditional urban functions inherited from the late Ottoman period. However, in convenient conditions displayed by the natural thresholds could not prevent the construction of public hospital, high school and public house facilities in order to keep face with the modernization endeavors on north bank of the river. Such a case creates gravity for one or two storey accommodations with gardens at first. On the other hand the construction of highway between Mersin-Konya and the second bridge (Atatürk Bridge) reinforced attractiveness on north side of the river (Fig. 5 and 6). Spatial growth and magnitude
The allocation of public investments demonstrates that north of the river had been proposed for the contemporary visage of Silifke.Installation of highway propped up automobile dependency and enforced the city to develop on to the delta plain towards north and east directions. Due to these facts, the number of neighborhoods increased to 444
8 and the magnitude of the city spread over 120Ha at the end of 1960s (Fig. 5).
4.3. Sprawl Dominated to Master Plans (After 1967) A master and set of revision plans dominate the period after 1967. Besides the planning endeavors, migration from rural hinterland and growing car ownership constitute substantial factors in the physical development of Silifke until today. Aiming to ensure requirements for housing and a planned future, the first
Figure 6. Silifke in 1950s (URL 1).
master plan is prepared by a development and investment bank in the status of specialbudget joint-stock company “İller Bank” in 1967 with a prediction population of 27.000 for 1985. This master plan proposed the city to develop on the southern slopes of Silifke-Konya highway, but also along the banks of Göksu River that has been already exceeded. The second master plan in 1987 was the revision of the first plan awarded again by the İller Bank in which most of north of the river was designated with high density (Fig. 7). In 1994, the third master plan has been prepared as a revision of the second master plan again, which was intended to reduce stress on fertile agricultural fields. But this time macro-urban form of the city is encouraged to develop inappropriately on the south-facing slopes of Taurus Mountains at north of the city contradicting with the local climatic conditions (Fig. 8). Moreover, significant decisions that will deeply affect the allocation of urban land use are taken in 2004 master plan revision due to an inflated estimate population of 150.000 for the year 2020. As a result, the macro-urban form of Silifke recently developing up to the boundary of Environment Conservation Area.
Figure 7. Master plan of Silifke, 1987 Figure 8. Revised master plan in1994 On the basis of the statements explored by Keleş (1990:26-33) migration from rural territories towards larger cities eventuates especially since 1960s in Turkey with 445
"centrifugal, centripetal and transmitter" forces. Accordingly, fragmentation in the ownership of agricultural lands, challenges in manufacturing, construction of dams, unemployment as well as natural disasters comprise centrifugal driving forces of migration from rural hinterland to Silifke. Correspondingly infrastructural development of services, growth of dynamic wholesale and retail sectors and increasing job opportunities depending on investments in agricultural economy and sub services such as packaging and installation of an industrial area are centripetal forces of attraction. Improvements in accessibility of Silifke due to the perfect link at the intersection of intercity highways (D-400 Antalya-Mersin, D-715 Silifke-Konya) and proximity to Taşucu port become major transmitter forces of migration. Population In this period natural disasters and economic investments substantially shape the population of city. Due to a series of landslides and flood disasters occurred in the hinterland of Silifke respectively in 1968, 1981, 1983 and the construction of Kayraktepe Dam11 lead to destruction in settlements. Most suffered inhabitants domiciled at disaster housings built by the central authority at different parts of city (Fig. 9). Besides these, SEKA Paper Factory founded at Taşucu in 1982 prolonged concentration of population in 1980s. According to TÜİK (2016), habitants doubled from 14.000 in 1970 to 28.111 in 1985. After 1985, the private investments have gained priority in the local economy of Silifke in line with the central government policies and process of liberal markets in the global economy. In this context, tourism potentials and activities along the Mediterranean coasts, diversified agro-based products with response to greenhouse sector and development of supplier industry became leading factors in attraction. At the same time national development policies aiming to hold population down in mediumsized cities have received response in Silifke and in addition to new high schools, Silifke Technical College appertains to Mersin University opened to education in 1994. Such policies accelerated the population and the habitants living in Silifke increased to 53.151 in 2010 and 55.501 in 2012 (TÜİK, 2016). Urban land-use Silifke under go a broad set of structural modifications in land use during the planning processes. Allowing the agricultural fringes depended on floodplain and also inappropriate in regard of local climate conditions for the urban development are most notable decisions in land use influenced the growth of macro-urban form negatively. In this context, bus terminal, stadium, museum and the administrative facilities such as county police and forestry directorate necessitating larger service area are concentrated on the fertile lands along the Mersin-Taşucu-Antalya highway. Similar attempt has been paid to the allocation of high education facilities and a small industry site on Taşucu highway after 1994. These site decisions relevant to public facility services approved by the master plans oriented the city in east and south directions by a gravity force of attraction and initiated macro-urban form to sprawl inefficiently towards the Environment Conservation Area in the delta plain (Fig. 9). Although Silifke possesses a pedestrian scale accessible settlement character, giving the priority to motor vehicles in 11
During the construction of the Kayraktepe dam, 9413 inhabitants have to be evacuated from 9 villages (1/5000 Master Plan Report, 2004). 446
urban transport brings about sprawl type of urbanization. Nevertheless, the third bridge (Feyyaz Bilgen) which is opened to pedestrian and vehicular traffic in 1992 linked commercial activities sprawling on both sides of the river, but could not consolidate the holistic development in return.
Figure 9. Urban development of Silifke in 2013
In the current revision of the 2004 Master Plan, administrative facilities such as the municipality and governor’s office are proposed to locate at the crossroads of KonyaAntalya-Mersin highway roundabout junction called as Dörtyol. In the revision plan, the development of commercial activities is being expanded from the Dörtyol Highway Junction, Ataturk Bridge and northeast direction up to the new bus terminal proposed on Mersin route along the state highway. These decisions that are proposed in the latest master plan revisions leads the macro-urban form tributary to grow along intercity highways. Moreover, the master plan decisions envisaging the relocation of public facilities, which may bring risks for consequential loss of traditional center identity in the historical memories of the city on the agenda. Apart from these, such proposals will negatively solidify the existent stress of macro-urban form development on the Environment Conservation Area.
447
Spatial growth and magnitude In addition to the improvements on the road system since 1967, location of disaster housing areas in three different parts of the urban pattern and master plan decisions have been the determinants specifying development directions of the city. Accordingly, two of disaster housing areas have been situated at the north side of the river. While one of them located at Göksu Neighborhood on Atatürk Boulevard in 1970s, other was built at Sayağzı Neighborhood on Uzuncaburç road in 1980s over the fertile fields in the floodplain area. The third disaster housing area has been built at Mukaddem Neighborhood at south of the Silifke-Konya highway, which was convenient in terms of climate conditions orienting to north (Fig. 9). On behalf of these housing areas the city started to sprawl at north on the Uzuncaburç and Mersin roads, and towards Taşucu at south directions. In order to discourage pressure on the plain and delta, south facing slopes at north of the city proposed to be the new development site in 1994 master plan. However, in 2004 the revision plan again changed the development direction adversely against on to the natural thresholds (Fig. 10). Figure 10. View of Silifke toward the castle in 2000 (URL 2). Another factor continuously affecting the macro-urban form at this point is the leaping growth of summer resorts and second home buildings on the Mediterranean coastline. Second homes buildings that some are composed of 10-15 storey apartment blocks developed over the sandy beaches and cultivable lands concentrated between Antalya-Mersin (D400) highway that comprises the border of Environment Conservation Area and the sea. But being lack of daily services, these settlements correspond their requirements from Silifke city center (Erkan, et.al., 2007:134-136). As a result, the urban functions and commercial activities critically tend to spread right across the Silifke-Mersin highway towards secondary home settlements as provided in the revision master plan of 2004. The number of neighborhoods in Silifke reached to 14 with the involvement of Sayağzı and Sarıcalar neighborhoods in 2013 and Kabasakallı Neighborhood on the Mersin highway at immediate vicinity to the secondary home area.The total developed area of the city is 700Ha today, but access to residential areas at farthest distance from the city center exceeds 3km (Fig. 9). However, it becomes compulsorily to use cars because of outrunning pedestrian scale in accessibility. 6. EVALUATION AND CONCLUSION As an inevitable consequence of increasing population and socio-economic reinforcement, the cities necessitate new housing, workspace and public facility areas. Favoring the investment and operating costs in the contemporarily developing cities which are shaping by the central and local government policies, primarily flat and plain 448
lands are preferred for these requirements. However, such plots are often composed of agricultural or potentially cultivable lands. Additionally, the fluctuations encountered in the agricultural market economy fight down resistance of agricultural lands in the urban peripheries. As a result of these circumstances, it leads the owners of agricultural lands choose to benefit from valuation of their properties and higher revenues returning back in a short term. One other natural component usually subjects to rent in the growth of cities is water’s edges, which acquires prestige, scenery and natural air corridor properties. In spite of that, developing on these areas sometimes brings along risks according to the characteristics of the water and coast. As a precaution, the line of approach or floodplain boundaries imposed by laws generally determined in lack of characteristics of topography, soil and water, which do not reflect the reality as experienced in Silifke. Especially at coasts of rivers under the risk of flooding, this issue requires a greater precision. When the development of Silifke city assessed in terms of these components, it is observed that natural thresholds have been considered up to 1930s, although fundamental changes came into existence in the population, density, land use, growth area and magnitude components of macro-urban form during the process under the rule of different cultures (Table 1). The main fragmentation between the city's macro-urban form and natural threshold relationship realized when the settlement expanded onto the fertile agricultural lands at the north plain of the river. The reasons arose this milestone in Silifke were the location decision to build a new center and socio-cultural public facilities in the 1930s and the transportation policies dominated on road infrastructure encouraged by the state since 1950s. Widespread use of motor vehicles and the reflection of growing population have manifested itself in the horizontal development of city during the 1960s. Thus, the city's population ascended to 11,100 by the migrants and the magnitude spread over 120Ha in 1960, but the gross density of the city has fallen to 93k/Ha comparing to the prior periods because of low-density development at the north side of river (Table 1). In the same years, with the enact of condominium ownership law, urban land officially gained appreciate and gradually multi-storey buildings began to take the place of detached houses in Silifke similar to many cities in Turkey. Such a case has multiplied the tendency of owners to provide ground rent in speculative land market argued by Keleş (1990: 393-395) and Tekeli (2009: 124). As a result, either sides of the river, but particularly on the northern side, building density started to increase with the construction of multi-storey buildings in vertical, meanwhile uncontrolled development process continued to grow horizontally over the natural thresholds. In Silifke, it is possible to follow the impacts of economic, political, legal and urban planning approaches pursued in Turkey after 1960s. The changes in technology, transportation and agriculture, migration from rural settlements, disaster housing location decisions and master plans and their planning decisions prepared in accordance with a comprehensive understanding are drastic issues shaped the macro-urban form development in this period. In order to avoid aimless growth the first master plan of Silifke come into force in 1967 and the development of settlement influenced by three additional and revision plans until today. In the reports of master plans, although the aspects concerning the protection of fertile agricultural lands and floodplain area of 125m from both sides of the river are highlighted, but could not be realized within the 449
applications. Table 1. Historical development process of macro-urban form in Silifke
Today, one of the main reasons of sprawl in Silifke is the estimated population and new development areas respecting this population specified in the process of master plans. In the report of the Revision of Master Plan in 2004, estimated population is determined based on mathematical calculations instead of paying attention to the natural thresholds. The current 2004 master plan with a projection of 2020 foresees 150.000 inhabitants. Although four years are left prior to the date of projection, the population could only reached to 1/3 of the estimated population yet. Thus, the settlement continues to scatter before the existing neighborhoods had completed their development process. Consequently, the average gross density of Silifke reduced to 76k/Ha where the limits of the city grow at a territory of 700Ha, composing 300Ha of fringing area developing in a rural character pattern. Contradictorily, while the traditional center of city occupies a density of 175-225k/Ha, the north of the river has a density of 125175k/Ha as perceived from Table 1. The varying density calculated between 25-75k/Ha at the outskirts certifies Ewing’s (1997) identifications about urban sprawl. Recently, Silifke continues to grow towards the delta plain and Environment Conservation Area with a population of 57.764 as per 2013. 37% (approximately 260Ha) of the total urban area of 700Ha remains within the limits of the floodplain area. This corresponds nearly 30,00012 people that are half of the population, living in an area under the constant risk in terms of social and environmental health. Ascertained from the analyses, about 300Ha of the total delta area, which covers 5,500Ha fertile agricultural land, has been converted to urban fabric. And 71% of the entire district and 18% of the city population is employed in agriculture sector according to data given in the report of Çukurova Regional Plan Current Status 12
The total populations of Göksu (12.122 people), Gazi (9.529 people), Atik (3.269 people) neighborhoods and part of Buçaklı (1.705 people), Sayağzı (4.998 people) and Sarıcalar (3.593 people) neighborhoods remain in the natural floodplain boundary (TÜİK, 2013). 450
Assessment (2013:55). Ongoing urbanization continues to sprawl over the fertile agricultural lands depending along the intercity highways possesses contradictions in terms of city's wealthy future economy and identity. Inconvenient development in terms of local climatic conditions increases the consumption of energy particularly for cooling purposes due to warm and dry weather between May and October. While urban sprawl consumes natural environment, it also enforce motor vehicle traffic that has a significant impact on local climate change (Stone et.al. 2010). In this context, Ilgaz (2013:71) asserts that based on the results of climate change revealed in Turkey until 2100, most probably Goksu Delta would encounter the risk of being under flooded. Located adjacent to the delta, urban sprawl of Silifke denies the consequences of climate change and contradict to the principles of sustainability. On behalf of these inferences, the macro-urban form reveals vehicle traffic accessoriented development indicating a linear growth model. The presence of natural thresholds such as fertile agricultural lands, flooding area requires the city’s population and magnitude to be calculated in the light of all these components and a planning point of view that will reconcile the growth of the settlement with natural environment and ecology. REFERENCES Aktüre, S. (1975). “17. Yüzyılın Başından 19. Yüzyıl Ortasına Kadarki Dönemde Anadolu Şehrinde Şehirsel Yapının Değişme Süreci”, M.E.T.U Journal of the Faculty of Architecture, 1(1), pp.101-128. Anderson, W. P., Kanaroglou, P. S., Miller, E. J. (1996). Urban Form, Energy and the Environment: A Review of Issues, Evidence and Policy, Journal of Urban Studies, 33(1), pp.7–35. Balchin, P.,N., Isaac, D., Chen, J. (2000). Urban Economics, A Global Perspective, Palgrave, New York. Banz, G. (1970). Elements of Urban Form, MCGraw-Hill Book Company, New York. Batty, M. (2008) The Size, Scale and Shape of Cities, Science Journal, 319(5864), pp.769771. Beatley, T. (2000). Green Urbanism: Learning from European Cities, Island Press, Washington. Bell, G. (1905). Getrude Bell Archive, access date (12.01.2011) [http://gerty.ncl.ac. uk/photos_in_album.php?album_id=4&start=50]. Bontje, M.A. (2001). “City, Region, Network: Theories about Urban Form, Urban Networks and Daily Mobility”, The Challenge of Planned Urbanisation: Urbanisation and National Urbanisation Policy in Netherlands in a Northwest-European Perspective, University of Amsterdam, pp.43-62. Breheny, M. J. (1996). “The Compact City: A Sustainable Urban Form?”, Cetrists, Decentrists and Compromisers: Views on the Future of Urban Form, eds., M. Jenks, E. Burton and K. Williams, London.E & FN Spon, pp.13-35. Burgess, R. (2000). “The Compact City Debate: A Global Perspective”, ed., R. Burgess, M. Jenks, Compact Cities: Sustainable Urban Forms for Developing Countries, Spon Press, New York, pp.9-24. Çakmak, Ü. (2009). Rough Cilicia (Olba) Region between IV-VII. Centuries of Social Life and Economic Structure Overview, Arkeoidea e-Journal, vol.VII, 53-59. Demirel, Z., Özer, O., Dabanli, S. (2010). “Göksu Deltası’nın Tarım, Hayvancılık, Arazi 451
Kullanımı İle İlgili 3 Boyutlu Haritalarının ve CBS’nin Oluşturulması”, Biyoloji Bilimleri Araştırma Dergisi 3(2), pp.175-179. Erkan, N., Hamamcıoğlu, C., Eryılmaz, S.S. (2007). Treats and Opportunities in The Mediterranean Coastal Cities: The Impacts of Secondhomes on Nature and Culture of Space in Silifke, Medi3ology2 Coastal Settlements, Culture, Conservation, International Gazimagusa Symposium, ed. U., Dağlı, M., Faslı, Ö., Türker, K., Güley, C., Boğaç, P., Uluçay, Eastern Mediterranean University Press, Gazimağusa, 129-137. European Environment Agency – EEA (2006). Report on Urban Sprawl in Europe: The Ignored Challenge, no.20/2006, Copenhagen, [htpp://www.europa.eu] Erişim Tarihi (25.03.2014). Everett-Heat, J. (2005). Concise Dictionary of World Place-Names, [http://www.encyclopedia.com] Erişim Tarihi (12.12.2012). Ewing, R.H. (1997) Is Los Angeles-Style Sprawl Desirable?, Journal of American Planning Association, 63(1), pp.107-126. Frey, H. (1999). Desiging the City: Towards a More Sustainable Form, E. and FN Spon Press, New York. Gallion, A. B., Eisner, S. (1963). The Urban Pattern: City Planning and Design, Second Edition, D. Van Nostrand Company, INC., USA. Gürtürk, S. (1987). Silifke Tarihi, Can Matbaa, İstanbul. Hanson, J.W. (2011). "The Urban System of Roman Asia Minor and Wider Urban Connectivity", editors A. Bowman, A. Wilson (2011) Settlement, Urbanization and Population, Oxford University Press, New York, pp.229-276. Hough, M. (1984). City Form and Natural Process, Von Nostrad Reinhold, New York. Ilgaz, M. (2013). “Risk Altındaki Topraklar”, National Geographic Türkiye, n.149, Eylül / September 2013, pp.66-79. Isuf–International Seminar on Urban Morphology (2014) [http://www.urbanform.org/ about.html] Erişim Tarihi (12.06.2014). Jabareen, Y.R. (2006). “Sustainable Urban Forms”, Journal of Planning Education and Research, (26) 38-52. Jenks, M., Kozak, D. (2008). “Polycentrism and ‘Defragmentation’: Towards a more Sustainable Urban Form?”, World Cities and Urban Form: Fragmented, Polycentric, Sustainable?, (eds.) M. Jenks, D. Kozak, P. Takkanon, Routledge, New York, pp.71-94. Keil, J., Wilhelm, A. (1931). Denkmaler aus dem Rauchen Kilikien, MAMA Band III, Manchester. Keskinok, H.Ç. (2010). Urban Planning Experience of Turkey in the 1930s, METU Journal of Faculty of Architecture, Ankara, 27(2), pp:173-188. Keleş, R. (1990) Kentleşme Politikası, İmge Matbaa, Ankara. Low, N., Gleeson, B., Green, R. Radovic, D. (2005). “The Green City: Sustainable Homes, Sustainable Suburbs”, ed., N. Low, Taylor and Francis Group, New York. Kostof, S. (1992). The City Assembled: the Elements of Urban Form Through History, London: Thomson and Hudson Ltd. Lozano, E., (1990). Community Design and the Culture of Cities, Cambridge University Press, USA. Lynch, K. (1984). Good City Form, First paperback edition of A Theory of Good City Form (1981), The Massachusetts Institute of Technology Press, London. Mackay, T S. (1976). Seleucia Ad Calycadnum-Silifke Rough Cilicia, Turkey, ed., R. Stillwell, W.L. MacDonald, M. Holland McAllister, The Princeton Encyclopedia of Classical Sites, Princeton University Press, Princeton, [http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.04.0006%3Aid% 452
3Dseleucia-ad-calycadnum&redirect=true] Erişim Tarihi (25.12.2012). Money, D.C. (1972). Patterns of Settlement: Human Geograpgy in Color, Evans Brothers Limited, London. Moudon, A.V. (1997). “Urban Morphology as an Emerging Interdisciplinary Field” Urban Morphology, (1):3-10. Mumford, L. (2013). Tarih Boyunca Kent: Kökenleri, Geçirdiği Değişimler ve Geleceği, Ayrıntı Yayınları, The City in the History: Its Origins, Its Transformations and Its Prospects, Penguin Books 1991 baskısından çeviren: G. Koca, T. Tosun, 2. basım, İstanbul. Municipatility of Silifke – Silifke Belediyesi (2004). 1/5000 Silifke Nazım İmar Plan Raporu. Özügül, M.D. (2013). “Ekolojik Planlama”, ed., M. Ersoy, Ninova Yayınları, ss.107-112. Environmental Conservation Institution - Özel Çevre Koruma Kurumu, Su Kaynakları Yönetim Projesi Raporu, 2009. Pollio, V., Morgan, M.H. (1960). Vitruvius: The Ten Books on Architecture, Dover Publications, New York. Raddison, R. (2001). “The City as Environment”, Handbook of Urban Studies, ed., R. Raddison, Sage Publications Ltd., London. Register, R. (2006). Rebuilding Cities in Balance with Nature, Revised Edition, New Society Publishers, Canada. Schwarz, N. (2010). Urban Form Revisited-Selecting Indicators for Characterising European Cities, Journal of Landscape and Urban Planning, 96(2010), pp.29-47. Stone, B., Hess, J.J., Frumkin, H. (2010). Urban Form and Extreme Heat Events: Are Sprawling Cities More Vulnerable to Climate Change Than Compact Cities?, Environ Health Perspect; 118(10):1425–1428. Tanyeli, U. (1987). Anadolu – Türk Kentinde Fiziksel Yapının Evrim Süreci (11.-15. YY), yayınlanmamış Doktora Tezi, İstanbul Teknik Üniversitesi, İstanbul. Taşkıran, C., (1994). Silifke-Seleucia on Calycadnus and Environs, Sim Matbaası, Ankara. Tekeli, İ. (2009) Modernizm, Modernite ve Türkiye’nin Kent Planlama Tarihi, Tarih Vakfı Yurt Yayınları, İstanbul. Tekeli, İ. (2011). Anadolu’da Yerleşme Sistemi ve Yerleşme Tarihleri, Tarih Vakfı Yurt Yayınları, İstanbul. Tsai, Y. (2005). Qualifying Urban Form: Compactness Versus Sprawl, Journal of Urban Studies, 42(1):141-161. Tunçdilek, N. (1986). Türkiye’de Yerleşmenin Evrimi, İstanbul Üniversitesi, Deniz Bilimleri ve Coğrafya Enstitüsü Yayınları, İstanbul. Turkish State Meteorological Service – Orman ve Su Bakanlığı Türkiye Meteoroloji Kurumu (2016) [http:// http://www.mgm.gov.tr/iklim/iklim-siniflandirmalari.aspx?m= SILIFKE] Erişim Tarihi [15.04.2016] TÜİK - Türkiye İstatistik Kurumu (2016) Nüfus İstatistikleri. [http://tuik.gov.tr] Erişim Tarihi [16.04.2016] T.C. Çukurova Kalkınma Ajansı (2013) Çukurova Bölge Planı Mevcut Durum Değerlendirme Raporu [http://www.cka.org.tr/main.aspx?id=267] Erişim Tarihi (07.07. 2014). T.C. Enerji ve Tabii Kaynaklar Bakanlığı (2010) Enerji ve Tabii Kaynaklar Bakanlığı 20102014 Stratejik Planı, Ankara. T.C. Orman ve Su İşleri Bakanlığı Meteoroloji Genel Müdürlüğü, (2014) İklim Sınıflandırması Mersin-Silifke, [http://www.dmi.gov.tr/iklim/iklim-siniflandirmalari. aspx ?m=SILIFKE] Erişim Tarihi (07.06.2014). 453
Uçar, A. (2009) Temettuat Defterlerine Göre 19. Yüzyılda Silifke, Silifke Kültür ve Dayanışma Derneği Kültür Yayınları, İstanbul. URL 1: D. Andrey, [http://silifkemiz.net] access date (12.01.2011) URL 2: Municipality of Silifke, 2011, [http://silifkebld.gov.tr] access date (13.01.2011). Uzun, N. (2012). “Şikago Okulu”, Kentsel Planlama Ansiklopedik Sözlük, ed., M. Ersoy, Ninova Yayınları, ss.416-417. Whitehand, J.W.R., Morton, N.J. (2004). Urban Morphology and Planning: the Case of Fringe Belts, Cities (21):275-289. Yalçın, A. (2004a). Geç Osmanlı Döneminde Silifke 1860-1904, Taşeli Ofset Matbaa, Taşucu. Yalçın, A. (2004b). Temettuat Defterlerine Göre 19.Yüzyıl Ortalarında Silifke Kazasının Sosyal ve Ekonomik Yapısı, Osmanlı Tarihi Araştırma ve Uygulama Merkezi Dergisi, ss.13-87. Yurt Ansiklopedisi (1982). İçel, Anadolu Matbaa, İstanbul, 5.
454
Chapter 34 The “Strange” Earthquakes and Seismic Sources – Possible Explanations Boyko Kirilov RANGUELOV*
1. INTRODUCTION There are many “strange” earthquakes and seismic sources located on the Earth. To be clearer what means “strange”, we labeled them by the following definition: Earthquakes with the following characteristics: • Their observed effects can not be clearly modeled by recent seismological knowledge and practice or • Show peculiarities, which are not common for the dominant number of earthquakes or • Are located in not easy explainable locations or • Generate most extreme and some curios effects, demonstrated and/or observed for the first time. definition about “strange seismic sources”. Sources which: - Generate “strange” earthquakes - Have curios peculiarities which are not common for the global seismic sources Or in more general – strange earthquakes and seismic sources are those with unusual location, strange properties, demonstrate effects observed for the first time and have curios characteristics. The goal of this chapter is to give a lot of examples of strange earthquakes and seismic sources in the Earth’s interior and to try to make possible scientific explanations about their uniqueness. 2. HISTORICAL SEISMIC EVENTS 2.1. Lisbon, (Portugal) 1755. Very strong earthquake – the magnitude assessment according to the recent magnitude scale is over 8.0 occurred 1st November 1755. This earthquake still has unknown location – somewhere in the Atlantic Ocean. No one of the recent models can detect the epicenter area and describe the effects observed after the quake – very heavy destructions of Lisbon and Portugal coastal area, huge tsunami (the water fulfilled the bay of the Tajo river, increasing the level of the ocean in some places more then 9-10 meters) – fig.1. More then 30 000 deaths, according to the very accurate observation, organization and registrations of Marquise de Pombal have been reported. The *
Prof. Dr., University of Mining and Geology “St. Ivan Rilski”, Sofia 1000 Bulgaria, Email:
[email protected]
unknown source of this seismic event threats both Atlantic coasts by megatsunami in any time. The measures taken by the coastal countries of the Ocean to avoid heavy damages and victims include the Atlantic tsunami early warning system and the cooperation in the filed of earthquakes studies. (Рангелов Б., 2010).
Figure 1. Lisbon earthquake 1755 – historical pictures.
2.2. Mississippi (New Madrid) great earthquakes, US 1811-1812. A sequence of extremely strong earthquakes changing the land elevation more then 20 meters in some places – fig.2. Tsunami generated in the Mississippi river. New Madrid and St.Louis were strongly affected. (Historic Earthquakes, 2011)
Figure 2a. Drawing of the Mississippi earthquake The three earthquakes and their major aftershocks (Johnston, A. C. & Schweig, E. S. (2006). December 16, 1811, 0815 UTC (2:15 a.m.); (M 7.5 -7.9) epicenter in northeast Arkansas. It caused only slight damage to manmade structures, mainly because of the sparse population in the epicentral area. The future location of Memphis, Tennessee, experienced level IX shaking on the Mercalli intensity scale. A seismic seiche propagated upriver, and Little Prairie (a village that was on the site of the former Fort 456
San Fernando, near the site of present-day Caruthersville, Missouri) was heavily damaged by soil liquefaction. December 16, 1811 (aftershock), 1415 UTC (8:15 a.m.); (M 7.4) epicenter in northeast Arkansas. This shock followed the first earthquake by five hours and was similar in intensity. January 23, 1812, 1500 UTC (9:00 a.m.); (M 7.3 -7.6) epicenter in the Missouri Bootheel. The meizoseismal area was characterized by general ground warping, ejections, fissuring, severe landslides, and caving of stream banks. Johnson and Schweig attributed this earthquake to a rupture on the New Madrid North Fault. This may have placed strain on the Reelfoot Fault. February 7, 1812, 0945 UTC (3:45 a.m.); (M 7.5 -8.0) epicenter near New Madrid, Missouri. New Madrid was destroyed. In St. Louis, Missouri, many houses were severely damaged, and their chimneys were toppled. This shock was definitively attributed to the Reelfoot Fault by Johnston and Schweig. Uplift along a segment of this reverse fault created temporary waterfalls on the Mississippi at Kentucky Bend, created waves that propagated upstream, and caused the formation of Reelfoot Lake by obstructing streams in what is now Lake County, Tennessee. Absolutely unusual location – in the stable part of North American plate. No clear explanation what could be the reason to have such events at that place. One hypothesis tried to explain the generating mechanism as an ancient (neoproterosoic - older then 750 million years ago) rift faults fig.3.a). During the last years a seismic tomography model discovers the deep flow movement in the asthenosphere with contradicting directions, just under the location of the epicenters of these huge seismic events (GRL, 2007) – fig.3 b). It could be a probable reason for the observed very strong intra plate earthquakes. According our view the so called turbulence hypothesis could explain the strange appearance of these earthquakes in a Figure 2b. Land elevation on the Earth’s stable North America plate. surface The essence of this theory is that the turbulences can be expected in the solid earth strata. They act the same way as the atmospheric and oceanic turbulences but in the solid earth and its layers – lithosphere, asthenosphere, mantle, outer and inner core (Gurov R., & Ranguelov B., 2007). There are a lot of examples confirming such a behavior of the single earthquakes and/or seismic sources.
457
a) b) Figure 3. New Madrid seismic zone and possible models: a) ancient faults; b) mantle flows (GRL, 2007)
2.3. Assam (India) 1897 The Assam earthquake of 1897 occurred on June 12 in Assam, India, and had an estimated moment magnitude of 8.3. Considering the size of the earthquake, the mortality rate was not that high, with about 1,542 casualties, but property damage was very heavy. Damage from the earthquake extended into Kolkata where dozens of buildings were badly damaged or partially collapsed. Shaking from the event was felt across India, as far as Ahmedabad and Peshawar. Seiches were also observed in Burma (Myanmar). (LaTouche, T. H. D., 1917). The quake is remarkable with the observed intensities (in some places reaching XII degree (the highest possible), with the changes of the relief – according some reporters up to 200 m – fig.4. The earthquake occurred on the SSW-dipping reverse Oldham fault that forms the northern edge of the Shillong Plateau within the Indian Plate. There was a minimum displacement on the main fault of 11 m, although up to 16 m has been calculated, one of the greatest for any measured earthquake displacements. The calculated area of slip extended 180 km along strike and from 9– 45 km below the surface, indicating that the entire thickness of the Earth’s crust was involved. Thought to have happened 32 km underground, it left 390,000 square kilometres of masonry buildings in ruins and was felt over 650,000 Figure 4. Surface effects of Assam earthquake square kilometres, from Burma to Delhi. Observers reported surface earth waves in many places. The earthquake resulted in Shillong plateau being thrust violently upwards by about 11 metres. The fault was about 110 km in length. while the fault slip was about 18 m. At 458
the epicentre vertical acceleration is thought to have been above 1g force and surface velocity 3 m/s. 2.4. Messina, (Italy) 1908 On December 28, 1908, at approximately 5:20am, Europe's most powerful earthquake shook southern Italy. Centered in the Messina Strait, which separates Sicily from Calabria, the quake's magnitude estimated a 7.5 by today's Richter scale. Moments after the quake's first jolt, a devastating tsunami formed, causing forty-foot waves to crash down on dozens of coastal cities. The city of Messina, which only had a population of 150,000, had been entirely destroyed, along with the nearby city of Reggio di Calabria, and other outlying areas – fig.5 It is estimated that the combined earthquake and tsunami killed almost 100,000 people, that fateful December morning. Over 40% of the population of Messina and more than 25% of Reggio di Calabria killed by the earthquake and tsunami, as well as by fires in some parts of Messina. (Рангелов Б., 2010).
Figure 5. Messina earthquake 1908 - macroseismic map and picture of destructions
Up to now, no any model can explain the generation of so huge tsunami by the earthquake with such a magnitude.
3. THE STRANGE BULGARIAN EARTHQUAKES: A) The most ancient seismic event with determined parameters in Europe is recognized in Bulgaria. This is an event related to the 4500 (+/- 60) years BC in the area of Provadia archeological site – Solnitsata, where the observations have been made. Using calibration curves about the intensity attenuation and the GPS measurements of the fallen stones of an ancient bastion, the magnitude estimation shows magnitude between 7 and 7.5. The coordinates of the epicenter are determined by the direction of the acting seismic force, its power and the location of the well known seismic source – Shabla-Kaliakra. Many possibilities were explored, but this solution matches best the observed facts. (Рангелов Б., 2012). B) Provadia seismicity – tectonic and human induced. Due to the exploitation of the large salt body near Provadia, a intensified seismic activity is observed during the last decades. According to our investigations some of the 459
observed earthquakes have tectonic (natural) origin, but some of them – (many with the magnitude between 3 and 4.5 – some of them destructive) are due to the salt solution extraction - the main method for salt production. This so called “induced seismicity” well correlates with the volume of the extracted solvent. As the salt production is intended to be increased, the seismic hazard of the region becomes higher. Main measures to limit these effects are: - local seismic network installed, to control the local seismicity - the strengthen the local rules for antiseismic design of structures and homes - to install a signaling system for the local administration and population. C) There are also some peculiar evidences about Bulgarian strong earthquakes. From the created catalogues of earthquakes, is seems that most of the strong seismic events (magnitude 5.0 and more) tend to occur in so called “doublets”. There are several examples: - 1901 earthquakes near Shabla-Kaliakra. A fore shock with magnitude 4.6. occurred several hours prior the strong (M7.1) seismic event on 31 March. The observed intensity reached up to X EMS and well visible tsunami was generated. Landslides, stohefalls, subsidence and soil liquefactions have been reported. Mnay victims and injured, as well as homes destructions. (Ranguelov, B.& Gospodinov, D., 1994) - 1904 earthquakes in Kresna seismic zone. An earthquake occurred 4th of April, in 10AM with a magnitude 7.2. Twenty minutes later stronger event with a magnitude 7.8 occurred in the same area. This seismic event is the strongest one in the continental Europe since last 200 years. The last event triggered almost all secondary effects related to strong earthquakes – landslides, surface faults (some of them barraged Struma river and formed an artificial lake), soil liquefaction, stonefalls, many deaths and destructions. The aftershocks lasted more then 10 years. - 1928 earthquakes – Plovdiv-Chirpan. Two earthquakes occurred on 14th and 18th April. The first one with a magnitude 6.8 (near Chirpan) and the second – with a magnitude of about 7.0 (near Popovica-Plovdiv). Both events created macroseismic intensity up to X degree EMS, large soil liquefaction, Earth’s cracks (very well documented by the geodetic measurement of Eng Mirkov and mentioned by Ch.Richter in his famous book – Elementary Seismology), many deaths (over 150) and large destructions in the epicenter area. The felt aftershocks lasted more then 7 years. (Рангелов Б., 2012) - 1986 Strajica seismic sequence. On February M5.3 event preceded the strong M5.7 earthquake near Strajica town. Landslides, soil liquefaction, large destructions of the homes and structures have been reported. [6] All these examples suggested that most of Bulgarian earthquakes tended to occur as “doublets”. D) On May 22nd 2012 an earthquake near Pernik shook Sofia and the vicinities. The strange element of this earthquake was its magnitude – 5.8. In this area according the recent seismic zoning map, expected Mmax for the local fault structures do not exceed M5.5. E) Even not belonging to the Bulgarian territory a seismic source located near Crimea peninsula (Black Sea) generated strange seismic events in the northern part of the Black Sea. Almost all events occurred 1927, generated the observed fire plums over the sea surface. Most probable reason for such effects (not known for other seismic 460
sources) is the methane emission generated by the seismically active faults. 4. RECENT STRANGE AND STRONG EARTHQUAKES ALL OVER THE WORLD 4.1. Lituya Bay (Alaska), 1958
At 9th of July, 1958 a strong seismic event (M7.9) occurred in Alaska, generated the highest tsunami wave ever known during the human history – 525 meters. The event was pretty well documented by the high water level which brushed out the forest from the hill slope and observed by several witnesses – fig.6. There are several models trying to solve the tsunami generation problem, but the classical one did not succeeded – fig. 7 a). This means that the measured slid deposits on the bottom of the bay, do not respond to the height of the observed tsunami. The new model was suggested, considering the fall-out of the nearby located glacier and it Figure 6. Lituya bay – aerial view – the cleaned hill seems rather effective – fig.7 slope by the tsunami is visible at the back side. b). This model considered the slide parts of the glacier to the waters of the bay. (WARD ST. and DAY S. 2010). After the huge tsunami was created by the moved landslide and the glacier ice wall fallen (observed by the way, of the witnesses on boats in the bay during the event) the huge tsunami could be explained. Then the broken glacier masses melt and only the effect of the highest tsunami could be observed today. 4.2.Chile (1960) and Alaska (1964) earthquakes - the strongest ever recorded events In Chile the most powerful ever recorded seismic event occurred with a magnitude 9.4-9.6 – 22nd May. In Alaska, a magnitude M9.3 earthquake occurred – 27th March. Both events happened in the subduction zones of the Pacific Ocean at depths between 20 and 30 km and generated huge tsunami waves. These events are remarkable with their power and supported again the hypothesis, that the subduction zones are the most powerful generators of the strongest seismic events and always generate huge tsunamis. (Ranguelov B., 2011). Such huge seismic events usually generated the Earth’s tides and own oscillations and frequently changed the position of the rotational ax of the Earth. It is rather strange, how the Earth’s strata can accumulate so huge strain and stress without destruction, as it happens with the less powerful earthquakes in the subduction zones. Probably there are some not well known properties, which can help such accumulation. If so, these areas of the Earth’s interior can generate even more powerful seismic events. It is still under expectation, is it possible to have an earthquakes with magnitudes larger then 10. (Ranguelov B., 2010a).
461
a) b) Figure 7. Two models – a) on the left and b) on the right modeling the generation of the highest tsunami wave in the global history (525 m.) – according (Ward S. & Day S. 2010)
4.3.Sakhalin (Neftegorsk) earthquake, 1995 The 1995 Neftegorsk earthquake occurred on 27 May at 23:03:55 local time with M7.0 and a maximum intensity of IX (Violent). The depth of the event was about 13 km. Because of the small depth, the destructive effect of the quake was devastating – fig.8. The strike-slip earthquake affected the settlement of Neftegorsk on northern Sakhalin Island in Russia. During the time of the earthquake the total population of Neftegorsk (“Oil Mountains” – in Russian) was about 3000 people. Almost 2,000 residents in the town were killed and another 750 were injured. This earthquake is considered as the only one, which after the shaking the city was not recovered. All ruins have been buried by the heavy machines. (https://www.eeri.org/lfe/pdf/Russia_Sakhalin_Insert_Jul95.pdf)
462
Figure 8. Heavy damages by the Neftegorsk earthquake
4.4.Sumatra, 2004. Extremely powerful earthquake with magnitude 9.1 occurred 26th December 2004 near Sumatra in the Indian Ocean – fig.9. This was unexpected event with such power occurred in this area. The earthquake produced huge tsunami in the Indian ocean (the strongest one reported ever) with more then 300 000 deaths, 2 million affected people, 3 continents, 8 countries and losses estimated to 100 billions US$. Both events – the earthquake and the tsunami – considered as the deadliest catastrophe in the human history. What was most surprising – the ruptured zone to the bottom of Indian Ocean reached 1200 km. This part of the Earth’s crust was ruptured for about 6 minutes and the vertical amplitude of the bottom displacements reach in some places about 20 meters (Ranguelov B., 2010a). 4.5. Indian Ocean strike-slip strong earthquakes, 2012 Two very strong earthquakes occurred on 11th April.2012 very near to the famous Sumatra earthquakes from 2004 (M9.1). Both strike-slips and have the following parameters – М8.6 (8.38UTC) and М8.1 (10.43UTC) in time interval of about 2 hours (which is not very usual case) with depths of about 30 km. (Рангелов, Б., Спасов E., 2012). Despite its power these earthquakes did not produce tsunamis; even their epicenters are located under the deep water column – fig. 10. (Рангелов, Б., Спасов E., 2012). About one year later three remarkable paper appeared in “Nature”: “Nature” 1st paper – Matthias Delescluse, Ecole Normale Superieure in Paris “Nature” 2nd paper – Thorne Lay – Univ. California “Nature” 3rd paper - Fred Pollitz , USGS All of these papers suggest for the first time of the modern geodynamics, that these Indian Ocean events might be indicators of a new tectonic boundary formation. This means that probably a new tectonic epoch is starting its development. As it is pointed out, this hypothesis can be proved during the next millions of years. 463
Figure 9. The Sumatra 2004 earthquake source zone (left) and the tsunami travel times (right) all over the world 464
Figure 10. The strike-slip earthquakes of 11th April, 2012 (red and white circles) and their aftershocks positions (blue and cyan ellipses). The unusual position (red polygon) suggests the new tectonic boundary formation.
4.6. Chile, 2010 Off shore Chile was stricken by a strong earthquake (M8.8) on 27th February 2010. This seismic event was located at the South America subduction zone, where the most powerful earthquake occurred during the instrumental era of seismology in 1960 (M9.6). The destructed volume of the earth crust of the M8.8 event was estimated to be a parallelepiped with approximate dimensions of 600х100х50 км. (Ranguelov B., 2010b) – fig.11.
Figure 11. The strong earthquake zourse zone (600х100х50 км.) and the displacements of the part of South America continent due to the Chile earthquake (27th Feb., 2010) and the GPS measured displacements (red arrows).
For the first time the GPS measurements revealed huge displacements (more then 3 meters in the city of Concepción area) and the behavior of the entire continental crust as elastic/nonelastic body – fig.11. Even to the Atlantic coast the measured 465
displacements reached several centimeters (for example, Buenos Aires shifted to the west about 4 cm). It is estimated that Chile's territory could have expanded 1.2 km² (0.46 mi²) as a result of this earthquake (Ranguelov B., 2010c). 4.7. Japan, 2011 11th March, 2011, 14.46PM LT. Earthquake with a magnitude of 9.0 struck Japan. 30-40 min later a huge tsunami attached the nearest Shore of Hokkaido Island. 30 000 deaths and about 30 000 disappeared. This is one of the most tragic events of the recent human history. This earthquake is remarkable with some facts: (Ranguelov B., 2010a). (Ranguelov B., 2010b). 1. For first time the seismic (SEWS) and tsunami (TEWS) early warning systems acted simultaneously, saving the lives of many, many people. 2. For first time the world media disseminated information about tsunami inundation in real time 3. For first time the movements (displacements) of big islands was documented in details by GPS measurements – fig. 12. 4. For first time the NPP catastrophe was triggered by earthquake and tsunami. 5. For first time the seismic zoning of Japan was sown to be wrong. In some places the observed seismic acceleration reached about 10 times higher value that is predicted by the seismic zoning map of Japan. 6. For first time the tsunami heights reached about 22 meters in some places including the higher level overlapping the protective tsunami wall in front of Fukushima NPP The explanation of such huge seismic event was performed considering the triple point junction of the three continental plates merging in that area. The scientists apologized to the people and specialists that they did not expect so huge event. Even in the history of Japan, there were several indications in the past times that similar very heavy earthquakes occurred, this seismic event produced the highest NPP catastrophe in the world history. The Fukushima NPP melted the active zone of the nuclear reactors and contaminated soil, underground waters and the ocean. This event is one of the best documented in the global world and could be used as etalon of the realized damages and the secondary hazards generated by strong earthquakes – fig.12.
Figure 12. Consequences by the Japan, 2011, M9 earthquake
466
4.8. Virginia earthquake, US, 2011 On 23rd August 2011 M5.9 earthquake struck the Piedmont basin in Virginia. This is the strongest event ever recorded in this region with a depth of hypocenter of about 56 km (considered shallow) and seems rather strange: - The quake occurred in a fault system (fig.13 a) located in Proterozoic and Paleozoic rocks (fig. 13 b) – with age of more then 500 million years. This is the area where the specialists explain as a result of the collision of continents that created the supercontinent Rodinia and the Appalachian orogeny during the formation of Pangaea. The last major event in the history of the Piedmont was the break-up of Pangaea, when North America and Africa began to separate. Large basins formed from the rifting and were subsequently filled by the sediments shed from the surrounding higher ground. Such an ancient origin does not provide conditions for the intensive seismic activity. - The time distribution of the maximum shaking movements has strong peculiarities, related to the modification and delay in several seconds that the standard model predicts. The highest anomalies are located north and south of the epicenter – fig 14 a) and the aftershocks are positioned perpendicularly to the direction of the main fault system, which is unusual – fig.14 b).
b) a) Figure 13. The faults system of the M5.9 occurred – a) and the simplified geology map of the region – b)
The fault movement generated by the quake was characterized as trust event. In such case, with the determined depth of the hypocenter, such magnitude has to create surface rupture. Such rupture was not detected. There are several attempts to explain the peculiarities of the M5.9 Virginia seismic event. The first one is related to the heavy rain origin of the quake. According the seismologist Betim Muco’s idea, the heavy rains put into the Earth’s interior enough water to 5-6 km depth, which generated the sliding effect on the fault in 450 dipping – fig.15. Another evidence of this hypothesis is that the most distant landslide occurred due to the quake was detected at 250 km far from the epicenter. This is a world record for such size of events. The second hypothesis about the origin of the Virginia earthquake of 2011 is related to the idea of the detachment of some parts of the Earth’s crust to higher depths in the mantle. Such effects are considered to occur at depths more than 50-60 km. In 467
both hypotheses contradictory elements can be found.
a) b) Figure 14. The maximum shaking time distribution – a) and the aftershocks locations of the M5.9 Virginia earthquake – b)
Figure 15. Consequences of the M5.9 earthquake in Virginia
4.9. Sea of Okhotsk deepest and strongest earthquake, 2013 A magnitude 8.3 earthquake occurred deep beneath the Sea of Okhotsk on May 24, 2013. At a depth of about 610 kilometers, the intense pressure on the fault should inhibit the kind of rupture that took place – fig. 16 a) and b).
468
a)
b)
Figure 16. Sketch of the earthquakes mechanism - a); the deep profile of the subduction zone – b). (https://en.wikipedia.org/wiki/2013_Okhotsk_Sea_earthquake)
"It's a mystery how these earthquakes happen. How can rock slide against rock so fast, while squeezed by the pressure from 610 kilometers of overlying rock?" said prof. Thorne Lay, at the University of California. It is still unexplainable, how these deep earthquakes can happen. Similar earthquake occurred in continental Bolivia in 1994 (9th of June) with M8.2 and depth of 650 km. The earthquake is the largest felt earthquake in the world – from Antarctica, to Toronto and North Canada. Due to its big depth, the earthquake was not victimized. The reason is that while traveling 650 km from the hypocenter to the Earth surface the seismic waves attenuated so much that can not produce violent shakings. 4.10. Nepal, 2015 25th April, 2015 – an earthquake with a magnitude 7.8 shocked Nepal at 11.56 LT. The coordinates of the epicenter - 28.28 N ; 84.79 E located the shock 83 km NW of Kathmandu, Nepal ( population 1,442,271 ) and 75 km NE of Bharatpur (pop: 107,157). The depth of the shock was estimated of about 10 km. Both cities were affected strongly and a lot of deaths, injured and structural collapses have been reported. This event produced an isometric macroseismic field covering very broad area. A lot of secondary effects have been observed adding new victims and destructions. Several landslides and stonefalls have been triggered by the strong seismic event. A lot of avalanches fall down from the mountain regions and also killed people. Large destructions covered huge area of Nepal, India and China. The total direct estimated losses overpass 2 billions US dollars. More than 10 aftershocks with magnitude greater then 5.5 occurred during the first ten days after the main shock. These aftershocks created additional damages and collapses. But the most surprising event was the shock of the M7.3 earthquake on 12th May 2015. It was located at the opposite end (NE from Kathmandu) of the seismogenic area activated during the 25th April event.
469
Figure 17. Macroseismic fields of the strongest Nepal seismic events – 25th April (M7.8) and 12th May (M7.3), 2015. The comparison shows completely different seismic energy emission. The isometric one is for the first shock and elongated one – for the second event. This can explain easily the lower damages generated by the second shock. The all aftershocks location outline pretty well the seismic source area of the seismic activated region – in general elongated in NW-SE direction (http://earthquake.usgs.gov/earthquakes/.)
Both shocks triggered a lot of aftershocks, but the second one even located at the same neotectonic environment produced strongly elongated (in almost NE-SW direction) macroseismic filed – fig.17. Such configuration of macroseismic filed is typical for strike-slip seismic event, but no such evidences have been observed to this second large shock in Nepal. (Ranguelov et al., 2016).
5.STRANGE SEISMIC SOURCES 5.1. Vrancea seismic zone Except the single or multiple strong seismic events with mystery characteristics, there are also some specific earthquake sources with unusual behavior. The most famous in this respect is the Vrancea seismic source. It is located in the eastern Carpathians at the corner of the mountain. The seismogenic layer has a thickness from 90 to 150 km in depth and according the standard classification is generating intermediate earthquakes, under the Earth’s crust in the upper mantle and overlapping the asthenosphere layer. What is unusual is that the projection on the earth’s surface of the seismogenic layer is a very small almost circular area with the diameter of about 30 km. Such so concentrated earthquake source (the volume is no more then 45.103 km3 and looks like a pillar in the Earth’s interior) can produce very strong earthquakes, reaching magnitude up to 7.5. The accumulation of the stress in so small volume and very high activity of the source (average repeatability of strong earthquakes with magnitude more then 7.0 is high) ranged this source to the very active ones and No 1 in Europe. Due to the intermediate depth, these earthquakes’ macroseismic fields are usually very large, with isoseismals reaching more then 1000 km. Another specific is that sometimes the seismic energy is emitted in elongated semi ellipses with NE and SW directions making sharp curves just over the source (Ойнаков E., Б. Рангелов., 2016). 470
The most mysterious element in this story is that there is not unified model which can explain all mentioned peculiarities. Up to now there are two contradicting concepts trying to model this source. The first one assumed that this is a slab component remaining of an ancient subduction zone (Martin M., et al, 2006) . The second hypothesis supposed that this is a part of the Earth’s crust entering the interior of the globe not very far in the past geological times in a way of the turbulence theory (Gurov R. & Ranguelov B. 2007). Both hypotheses have their positives and some no explainable elements of the observed facts (Martin M., et al, 2006) – fig.18 a) and b).
a)
b)
Figure 18. Surface 2D projection of the GPS modeled the spiral structure of the Vrancea source – a) and 3D model of the velocity structure around the Vrancea earthquakes (white dots) – b). (Schmitt G., et al., 2007; Е. Ойнаков, Б. Рангелов., 2016).
5.2. Hindukush source zone Hindukush source is a relatively small area concentration of huge earthquakes between Afghanistan, Tajikistan and Pakistan. It is far from any big continental collision and fault structures. The Hindukush seismic source zone is famous with its very deep and destructive earthquakes. According the plate tectonics there are not a typical subduction zone, but some evidences exists. That why the zone is called “relict seismic zone”, remaining that probably the seismic activity in this strange zone (Hindu-kush in Hindi, means “killer of the Indians”) is due to the ancient subduction. The zone is elongated to NE-SW and is characterized as intermediate seismic area. The source produces very strong earthquakes on the whole range of depths – starting from earth’s surface, down to 300 km. The shallower events are located to the periphery of the zone, while the central part is dipping like a turned down pyramid – fig.19. 5.3. Gibraltar source zone One of the strangest seismically strong and active zones is located just below the Gibraltar straight. There are clear plate boundary faults, which are expressed on the Earth’s surface and sea bottom. These boundaries are generators of shallow earthquakes and there is nothing specific. Just north, to the continental Spain, very strong and very deep earthquakes occurred at the depths reaching about 600 km. In between very few intermediate events occurred with much lower magnitudes. Probably, there is some remaining former subduction, but again – the typical local active volcanism is not observed – fig.20. 471
Figure 19. The Hindukush seismic source – location and seismic events depths distribution (web: CSEM-EMSC)
472
Figure 20. “Gibraltar source” – deepest seismic events in Europe occurred at depths even more then 600 km (CSEM-EMSC).
6. CONCLUSIONS Several cases of so called strange earthquakes have been investigated. Attempts to explain scientifically the observed unusual peculiarities have been made and new and surprising results obtained. There are much more case-studies showing strange properties of the earthquakes and seismic sources. The nature makes surprises and thus creates interest, knowledge and respect.
473
REFERENCES Geophysical Research Letters. (2007). No3 - cover page Gurov R., Ranguelov B. (2007) The corkscrew theory – a new mechanism of the solid Earth geodynamics, in “Rotational processes in geology and physics” (Ed. Milanovsky), URSS, pp. 411-431. Moscow. Historic Earthquakes. (2011). New Madrid Earthquakes 1811-1812 USGS Archived 14 May 2011 at WebCite https://1811%E2%80%9312_New_Madrid_earthquakes Johnston, A. C. & Schweig, E. S. (2006). The Enigma of the New Madrid Earthquakes of 1811-1812. Annual Review of Earth and Planetary Sciences, Volume 24, pp. 339–384. Available on SAO/NASA Astrophysics Data System (ADS) LaTouche, T. H. D., (1917) A Bibliography of Indian Geology and Physical Geography, Geological Survey of India, Calcutta pp.571. Martin M., Wenzel F. and the CALIXTO working group. (2006). High-resolution teleseismic body wave tomography beneath SE-Romania – II. Imaging of a slab detachment scenario., Geophys. J. Int. (2006) 164, pp. 579–595 Ranguelov, B.; Gospodinov, D., (1994). Seismic activity after the earthquake of 31 March, 1901 in the Shabla-Kaliakra zone. Bulgarian Geophysical Journal. pp. 44–49. Ranguelov B., (2010a). Continental movements due to the strong earthquakes. Ecological Engineering and Environment Protection., vol.3-4, pp. 86-91. Ranguelov B., (2010b). The great subduction earthquakes – Chile (Mw8.8, 2010) and Sumatra (Mw9.1, 2004) sources of the continental plate movements. Proc. 6-th National Geophysical Conference. Sofia, 17th Dec. 2010., 4pp. (on CD). Ranguelov B. (2010c). The seismological potential of the subduction zones – the two great earthquakes: Chile (Mw8.8, 2010) and Sumatra (Mw9.1, 2004) – indicators about sudden plate movements. Ann. of M&G University, Vol. 53, Part I, Geology and Geophysics., p. 201-206 Ranguelov B., 2011. Tsunamigenic potential and GPS movements of the great subduction earthquakes., Сб. Популярни и научни докл.-Дни на физиката, 2011, ТУ-София, 1316 Април, с. 149-153 Ranguelov B., et al., (2016). The Nepal Earthquakes, 2015 – geography specifics (secondary effects, damages, resilience) of the destructive seismic events. Proc “GEOMED 2016 The 4th International Geography Symposium”, Kemer, 22-26 June, 2016, Turkey. Ward St. and Day S. (2010). The 1958 Lituya Bay Landslide and Tsunami — A Tsunami Ball Approach. Journal of Earthquake and Tsunami, Vol. 4, No. 4 (2010) , pp. 285–319 Ойнаков E., Б. Рангелов., (2016). МИКРОСЕИЗМИЧНО СОНДИРАНЕ - сеизмогенна зана Врaнча., Сб. Популярни и научни докл.-Дни на физиката, 2011, ТУ-София, 19-21 Април, с. 149-153 Рангелов Б., (2012). Разгневената Земя – природните бедствия., изд.БАН, С., 294 с. Рангелов Б., (2008). Турбулентната теория – един нов поглед към неспокойната Земя., в кн. Земята – неспокойната планета (Ред. А.Кунов), изд. БГ-Принт., с. 608-615. ISBN 978-954-9325-54-6 Рангелов Б., (2010). Гигантските сеизмични катастрофи – земетресения, митове, загадки и действителност., Минно дело и геология, бр. 5-6, с. 27-31. Рангелов, Б., Спасов E., (2012). СИЛНИ ОТСЕДНИ ЗЕМЕТРЕСЕНИЯ (М8.6 и М8.1) ОТ 11.04.2012 Г. В РАЙОНА НА СУБДУКЦИОННАТА ЗОНА КРАЙ СУМАТРА НЕ ГЕНЕРИРАТ ЦУНАМИ?, Intl. Symp. “Geodesy 2012”, 8-9 November, 2012. Sofia. (on CD)
474
Chapter 35 The Study of Urban Form in Middle Eastern Cities Mert Nezih RİFAİOĞLU* INTRODUCTION Studies of urban form in Middle Eastern cities first appeared at the beginning of the twentieth century carried out by European (English, German and French) scholars. Their studies focused on understanding the impacts of religion on formation of urban forms; socio-economic structures and their relation with physical features; rules and regulations affecting the urban forms; relations with medieval towns and Islamic urban forms. This paper has a major challenge that considerate a wider framework of urban form studies in Middle Eastern cities. Therefore, it classifies the intentions of Middle Eastern urban form studies related to their main objectives, research methodologies and outcomes under two headings. The first covers Orientalism, the second is Regionalism. Orientalism is covered the studies of North-African cities, Syrian cities in particular to the Northern-Syria and Isfahan from 1920s to 1939 and criticism of Orientalism which is focused the studies after the Second World War until 1980s. Regionalism is concentrated on Anatolia, North Africa and Syria from 1980s onwards. ORIENTALISM Historians such as William and Georges Marçais, Roger Le Tourneau, Louis Massignon and Robert Brunschving were the first scholars to take an interest in Middle Eastern cities, focusing on both their socio-economic structures and the physical features of the urban form, particularly in North Africa. Their interpretive-historical methodological approaches concentrated on understanding the organization of Islamic urban form that then applied to all Middle Eastern cities. The French historian Jean Sauvaget’s studies (1941, 1949) focused on the historical-morphological nature of Syrian cities, in particular in the north of the country, and were an important addition to Islamic city research. His studies concentrated on the interpretation of medieval Syrian cities and their Islamic urban form structures, in which he attempted to define an integrated picture of urban form and its foundation up to the twentieth century. His methodological approach relied on French colonial cadastral surveys, as representing “the first precise instruments for representing the urban organisms of these regions, providing a knowledge and description of the premodern structure and form of Middle Eastern and North African cities, and laying the foundations for later urban studies” (Neglia, 2008, p. 7). Sauvaget’s studies opened a new perspective within Orientalist studies of Islamic urban form, which had previously focused on defining the urban forms through an epistemological approach. Additionally, Eugene E. Beaudoin, Arthur Upham Pope and Osman Nuri Ergin’s interpretive-historical researches on Isfahan and Turkey aim to define the socio-political *
Assist. Prof. Dr., Mustafa Kemal University, Faculty of Architecture, Department of Architecture
and urban features of the urban form and the historical developments of urbanism in Turkey. Studies of Islamic urban form were interrupted by the outbreak of the Second World War, until the early 1950s when a second Orientalism period was launched in Edmond Pauty’s (1951) observational-historical research of North-African cities. Pauty’s work was accepted as a revision of previous studies, and he highlighted the topographical, historical and socio-economic differences that had played a crucial role in the formation of Islamic cities. In this way, he opened a new route of research that steered away from accepting the generalized Orientalist theoretical urban form frameworks. He suggested “a distinction between spontaneous and planned cities, concluding that in most cases Islamic cities were founded by dynasties or monarchs and, thus, did not develop autonomously” (Neglia, 2008, p. 10). This revisionist perspective was continued by Gustav von Grunebaum (1955a, 1955b, 1961), who studied the origins of urban form– centralized around the Friday mosque – in his empirical methodological analysis of the streets and buildings, and made an attempt to define the social life in the surrounding neighbourhood. The analytical-empirical studies of Ira M. Lapidus (1967, 1969, 1973a, 1973b) stressed the importance of defining the Islamic urban forms in different regions, periods and religion sects in a rational way. He argued that traditional Muslim cities could be understood from an analysis of the “historical context in which they have developed, the nature of the society they embodied and their cultural significance” (Lapidus, 1973b, p. 49). He introduced the concept of the mosaic society, being an organic network of ethnic and religious groups that existed on a neighbourhood scale (Lapidus, 1967, pp. 85-7), but pointed out that “there is no evidence that the homogeneity of social classes was a basis of solidarity” (Lapidus, 1967, p. 87). The socio-political and economical aspects of cities were underlined by Xavier de Planhol (1968), Eliyahu Ashtor (1975) and Claude Cahen (1970)’s empirical-historical researches, who pointed out the effects of a lack of a civic administrative body and the impacts of the rais, muhtasib and qadi on urban form (Neglia, 2008). In contrast to the social perspectives, Schmuel Tamari and Nikita Elisséeff (1970, 1980) gave prominence to a morphological analysis and the physical structure of urban forms. Elisséeff stressed that “..in order to devise a physical portrait of the city and to recognize urban morphology, it is necessary to study the plan which transcribes the organization of the terrain and records the town’s topographical evolution. The processes of transforming town plans were, in the past, fairly gradual on the whole, but it has been possible to establish what is known as the ‘law of a plan’s persistence’, which allows us to perceive the successive stages in the composition of a city” (1980, p.90). Albert Hourani (1970) and Samule Stern (1970) brought a different way of thinking to studies of Islamic urban form Hourani criticized G. Marçais’s aplication of a generalized North African urban model to other Islamic cities, citing the geographies, societies and cultural differences, as Lapidus had stressed previously. Stern’s focus was on making a comparison of the medieval European and Islamic urban forms that had been considered previously by Massignon, Grunebaum, Ashtor and Cahen. By the 1980s, a series of conferences had been organized to look deeper into the subject of Islamic cities (conference proceedings being edited by Brown, 1973; Serjeant, 1980; Serageldin and El-Sadek, 1982; Germen, 1983; Brown et al., 1986, 476
1989). Robert B. Serjeant (1980) studied the social structure of the southern part of the Arabian Peninsula and its socio-economic, cultural and political aspects. On the other hand, Nikita Elisséeff (1980) studied the urban form of Damascus, deducing that the classification of the form of Islamic cities depended upon their origins, dividing them under headings of “new city”, “spontaneous towns”, and “medieval city” located on the shores of Mediterranean Sea. Similar to Elisséeff’s morphological studies, Eugen Wirth (1982, 1985) highlighted the importance of making separate morphological studies for different geographies. He suggested that only the suq structure was unique, and was an important aspect in the creation of the Islamic urban form, being dependent on the cul-de-sac system and an independent neighbourhood layout rather than religious aspects. André Raymond (1974, 1977, 1984, 2009) used archival waqf documents to clarify the socio-spatial and economic dynamics of Muslim urban forms. In his book The Great Arab Cities (1984) and his studies of different Islamic cities, Raymond stressed that the Orientalist urban form models defined by European scholars fell short in their efforts to provide an understanding of the dynamics of Islamic urban forms. Using the data obtain from the waqf archival documents, Raymond applied an integrated methodology that included historical interpretations and morphological investigations. He stressed clearly that the urban form of Islamic cities continued during the Ottoman Period, but that this was not the case under periods of European colonization of Islamic cities (Neglia, 2008). Jamel A. Akbar (1984, 1989) and Besim Selim Hakim (1986, 1994) both discussed the influence of Islamic law and the land tenure system on the formation process of Islamic cities, defining the general rules and regulations affecting the urban form of Islamic cities. According to their studies, Islamic ownership rules and rights are predominant factors for creation of the Islamic urban forms. Islamic cities are formed and controlled according to the rules of Islamic schools of law. There were different schools of laws, depending on the different rites of different Muslim sects that affected the property right mechanisms of Islamic cities. Janet Abu-Lughod (1987) claimed that the model of the Islamic city resulting from an Orientalist perspective was primarily based on generalized observations. In her essays “she warned of the dangers of generalizing specific morphological and geographical data that had led the so-called Orientalists to assimilate cities from widely differing geographical areas, and instead advanced an idea of the formation of the Islamic city through a morphological process based not only on legal, political, and religious systems but also on specific cultural factors” (Neglia, 2008, p. 16). She listed three themes that played a crucial role in the development process of Islamic urban forms: • Theme 1: The distinction between community of believers (Umma) and the State which led to juridical and spatial distinction by neighbourhoods • Theme 2: The segregation of the sexes, which gave rise to a particular solution to the question of spatial organization • Theme 3: The system of property laws that governed the rights, and obligations and general regulations for land uses of various types in various places
477
REGIONALISM: ANATOLIA, THE MIDDLE EAST AND NORTH AFRICA Urban form studies, in particular of Islamic and Ottoman cities, have been carried out by different scholars, schools and institutions in cities located in the broad area that stretches from North Africa to the Middle East; Central Asia to Anatolia; and Spain to the Mediterranean. By the 1980s, however, these studies had begun to focus on defining the regional differences and characteristics of cities. In this context, of particular significance are the mainly morphological, historical and typological investigations carried out by French and Italian scholars and institutions, largely drawing upon the works of André Raymond, Philippe Panerai, Aldo Rossi and Saverio Muratori. Robert Mantran (1962, 1965) was the first foreign scholar to focus on the structure of Turkish cities, in particular Istanbul, with the intention of clarifying the relations between the social life of different religious and ethnic groups and their inhabitation within Turkish cities (Mantran, 1982). Additionally, he studied archival documents to more fully understand the economic and administrative aspects of the cities. Doğan Kuban (1983) discussed the fundamental assumption that the homogeneity and unity in Islamic architecture was the creation of Western scholarships, called the notion ‘faulty’ (Kuban, 1983, p. 1): claiming rather that Turkish cities had been influenced by the Islamic Central Asian, Iranian and Byzantine cultures. Sevgi Aktüre’s (1973, 1978, 1984, 1987, 1989) studies focus on the late-Ottoman Anatolian cities, analysing and defining fundamental aspects of the transformations of their spatial structures in relation to their socio-economic structures. Mustafa Cezar (1977, 1987) defined the major aspects of Islamic cities and their role in the formation of Turkish cities. He stressed the impacts of the waqf institution and the construction activities of individuals that were important in the formation of Turkish cities in the Ottoman Period. The studies of Suraiya Faroqhi (1979-80, 1981, 1984, 1987), Özer Ergenç (1980a, 1980b, 1984, 1990, 1995) and Haim Gerber (1983, 1988) concentrated on archive documents, from which they tried to understand the common and individual characteristics of Anatolian cities. Their studies concerned mainly the relationship between the city and its socio-economic structures. Maurice Munir Cerasi (1985, 1999a, 199b) defined Ottoman cities in different geographies under the different cultural contexts, using morphological and spatial relational analyses to highlight their different and common fundamental aspects. He declared that Ottoman cities were developed under aspects that differed from region to region. According to Cerasi, the common morphological formation in Ottoman cities was derived mainly from functional zonings, residential preferences, trade and religious-cultural zones. Uğur Tanyeli (1984,1987) classified Anatolian-Turkish cities according to their developing physical structures between the eleventh and fifteenth centuries. He suggested that the development of Anatolian cities was influenced by Turko-Iranian urban models and the relations of the nomadic urban culture. He categorized Anatolian cities into three types: enclosed and open (without defensive walls or fortifications), both of which could mainly be found in Eastern Anatolia; and end (uç) cities, which existed mainly in the principality period in the South-west and Western Anatolian cities. He stressed that public and private functions within Anatolian cities were distributed throughout the city in a homogenous way (Tanyeli, 1987). He identified the salient features of Anatolian-Turkish cities as Inner citadel (Ahmedek); Street network and cul478
de-sacs; Districts; Squares; Palace; Friday Mosque, Mosque and Small Mosque (Mescit); and Foundation Institutions. The studies of Pierre Pinon (1989, 1991, 1999, 2004), Pionon et al. (1991) and Pinon and Stephen Yérasimos (1993) are based mainly on surveys of cartographic documents and historical data, aiming to identify the common aspects of urban forms and their various phases of urban development in Anatolia. They used cadastral maps and defined the morphological origins of the cities that had derived from the Hellenistic periods. According to Pinon (2004, p. 196), commonalities with the Hellenistic grid street pattern existed in Eastern Anatolian cities, with Antakya being an important example. This body of work stressed the division of plots according to the divisions in the ownership pattern, which had resulted in the characteristic organic urban form. Following a similar line, Italian architect and morphologist Attilio Petruccioli (2008) studied Mediterranean Islamic urban forms and defined the fundamental typologies and morphological aspects of Islamic cities using the Italian typomorphological investigative tradition. He considered the city as a living organism that could be analyzed using epistemological tools. As Neglia (2008, pp. 21-22) stressed, “Petruccioli’s research is based on the idea that the history of every city is inscribed in its urban fabric, so it is possible to decipher the various phases of its transformation through a structural reading of the building fabric”. These studies constituted an important source, not only for defining the morphological characteristics of Anatolian cities, but also typological definitions on an architectural scale. The work of Pinon and colleagues, and Petruccioli, is based mainly on readings of cadastral surveys, and correlating the data obtained from cadastral surveys with historical research. The Ottoman historian Halil İnalcık (1990) described Istanbul’s salient urban features in relation to the structure of the Islamic city. Using the term “Islamic Ottoman”, he referred to a social model based on the qadi and waqf system and the idea of privacy, describing an urban model divided spatially into residential districts with autonomous functions, and public and commercial zones, planned and controlled by a central power, serving to connect the residential districts. Likewise, Gülru Necipoğlu’s (1991) work is based on an analysis of archival documents, which were used to reconstruct the architectural history on an urban scale. By examining the Topkapı scrolls she has been able to elucidate the spatial structure of the Topkapı Palace in Istanbul in relation to the urban context and to Turkish and Islamic cultural traditions. Cânâ Bilsel (1996, 1999, 2001) studied the morphological evolution of LateOttoman and Early-Republican Izmir, mediating between urban culture and urban form, and highlighting the relationship between the two and their affect in transforming each other. Ataman Demir’s (1996) monographic study of the city of Antakya clarified the salient features of the architectural and urban characteristics of the city within a historical perspective. He explored the spirit of Roman Antioch and its features through the history through analyzing travellers’ accounts. Koray Özcan (2005) focused on Turkish settlement systems during the Seljuk Period, and attempted to define their urban models; while Çağla Yüksel (2009) concentrated on the urban forms in the western part of Turkey in the principality periods, where she analysed their primary socio-economic backgrounds in order to understand the role of trade activities, trade relations, trade routes and urban networks. She offered an explanation of the spatial formations and transformations in Western 479
Anatolian settlements after analysing the influences of the architectural formation of the settlement of Tire. The Middle East has been studied by many foreign scholars, many of which were French or German. Studies of Syrian cities have developed from the research of Aleppo by Heinz Gaube and Eugen Wirth (1984), in which a close examination of literary sources and inscriptions was combined with an extensive survey of specialized buildings in the ancient city, from which they were able to reconstruct the urban fabric from the early centuries of the Islamic conquest onwards. The different approaches of these two German scholars, being respectively historical and geographical, have been combined in the production of a series of thematic maps showing the urban structure of Aleppo in the pre-modern era, especially the route system and the religious, public and commercial structures. A further contribution to our knowledge of Aleppo has been made by Jean-Claude David (1977, 1982). Using a different methodology in his reading of the building fabric, especially the structure of the suq, pious foundations and courtyard dwellings, David has been able to make morphological and typological deductions that can be applied more generally to other cities in the same region. Numerous other scholars have considered the physical structure of Aleppo. Anette Gangler (1993) analysed the physical structure of the Bānqūsā district, based on an extensive architectural survey of residential buildings, which she then used in the compilation of descriptive maps of the urban aggregation. Using historical data, Yasser Tabbaa (1993, 1997) produced a reconstruction of the urban structure of Aleppo in the Ayyubid period. The work of André Raymond (1984) on Aleppo’s commercial and urban structure in the Ottoman period, through a study of waqf documents, travellers’ accounts and historical topography, has demonstrated its urban growth. He often compares Aleppo with Tunis and Cairo. Following his studies, other architectural historians have used waqf documents to reconstruct the urban fabric of Aleppo in the same period. In the 1980s the most exhaustive research on Damascus was carried out by Dorothée Sack (1985, 1989), whose approach combined historical and archival research with measured drawings of the urban fabric and principal monuments. She analysed the urban transformation of Damascus through a compilation of historical and thematic maps of the route systems, mosques, and suqs in different periods, and identifies in the streets, neighbourhoods, water systems and suqs the basic elements of the urban structure. In parallel with studies of the Middle East, since the mid-1980s there have been numerous urban studies of North African cities that have involved a reading of the city as a physical entity. These studies have used the cadastral surveys complied in the first decades of the twentieth century as their main documentary source, and have often complemented these records with detailed measured drawings of the urban fabric and architecture. CONCLUSION Studies of urban form have evolved out of the Orientalist perspectives derived from European scholars into a revisionist approach, and have continued with regional approaches. Studies have tended to concentrate on understanding and identifying the salient features of Middle Eastern urban forms under different socio-economic, cultural, 480
PHASES
OF
URBAN
Archaeolog ical Investigations
Waqf Documents
Typologic al Investigations Cadas tral
Meas ured
SocioSpatial
religious, geographical, administrative, morphological and typo-morphological aspects. Additionally, methodological approaches have been generally supported by different sources, such as cadastral surveys; waqf documents; typological, archaeological and socio-spatial investigations; and measured drawings. However, while the subject has been the analysis of the urban form in its different phases, their penetration has been evidently changeable (Figure 1). For example, data from cadastral surveys would give reliable information on previous phases of the urban form, while waqf archival documents may be used for defining the socio-spatial and economic dynamics of the following phases. Consequently, it is important to find common denominator sources when the aim is to understand the main aspects that lie behind the urban form.
Figure 1. The penetration effects of different investigation sources in different phases of urban form (Prepared by Rifaioğlu, M.N.).
In this context, the validity of methods and sources used in studies of urban form in Middle Eastern cities are still hotly debated, and whether they give reliable data for understanding the main aspects that lie behind the urban form. Acknowledgments: The author would like to give sincerely thanks to Prof. Dr. Neriman Şahin Güçhan, Prof. Dr. Sevgi Aktüre and Prof. Dr. Peter J. Larkham for their support throughout the research and preparation of this article. 481
REFERENCES Abu-Lughod, J. (1987). “The Islamic City: Historic Myth, Islamic Essence, and Contemporary Relevance”, International Journal of Middle East Studies, v.19, pp:155176. Akbar, J.A. (1984). Responsibilities and the Traditional Muslim Built Environment, unpublished PhD dissertation, Department of Architecture, M.I.T., Cambridge, Massachusetts. Akbar, J. (1989). “Khatta and the Territorial Structure of Early Muslim Towns,” Muqarnas 6 , pp: 22-32. Aktüre,S. (1973). ”17.Yüzyıl Başından 19.Yüzyıl Ortasına Kadarki Dönemde Anadolu Osmanlı Şehrinde Şehirsel Yapının Değişim Süreci”, METU - Journal of the Faculty of Architecture,1/1, pp. 101-128. Aktüre,S. (1978). 19.Yüzyılın Sonunda Anadolu Kenti Mekansal Yapı Çözümlemesi, Ankara, Orta Doğu Teknik Üniversitesi. Aktüre,S. (1984). “16. yy Öncesi Ankara’sı Üzerine Bilinenler”, Tarih İçinde Ankara, E.Yavuz and Ü.N.Uğurel (eds.), Ankara: ODTÜ Mimarlık Fakültesi, pp:1-47. Aktüre, S. (1987). “Anadolu Kentinde Türkleşme-İslamlaşma Süreci, Mekansal Yapı Değişimi ve İslam Mimari Mirası”, İslam Mimari Mirasını Koruma Konferansı Bildiriler, Seçil Ofset, İstanbul. Aktüre,S. (1989).”The Islamic Anatolian City”, Environmental Design, no. 1-2, pp: 68-79. Ashtor, E., (1975). “Républiques urbaines dans le Proche-Orient á l’époque des Croisades”, Cahiers de la Civilisation Médiévale, 18, pp. 117-131. Bilsel, F. C. (1996). “Cultures et Fonctionnalités: L’Evolution de la Morphologie Urbaine de la Ville d’Izmir aux XIXe et début XXe Siècles”, un-published Ph.D. at the Université de Paris X – Nanterre, Paris, France. Bilsel, F. C. (1999). “A specific urban form between sea and city: the ‘Frank quarter’ of İzmir”, in R. Corona, G. L. Maffei (eds.), Transformations of Urban Form from Interpretatıons to Methodologies in Practice, ISUF' 99 (International Seminars on Urban Form), Florence July 1999, ALINEA Editrice, Italy,pp. 8-12. Bilsel, F. C. (2001). "The Ottoman Port City of İzmir in the 19th Century: Cultures, Modes of Space Production and the Transformation of Urban Space", Afife Batur (ed.), 7 Centuries of Ottoman Architecture, A 'Supra-National Heritage', International Congress Papers, Turkish Chamber of Architects, Yapı Endüstri Merkezi, Istanbul, pp. 225-233. Cahen, C. (1970). “Y a-t-il eu des corporations professionelles dans le monde musulman classique?” in The Islamic City: A Colloquium, ed. A.H. Hourani and S.M. Stern, published under the auspices of the Near Eastern History Group, Oxford, and the Near East Centre, University of Pennsylvania, pp: 51-64. Cerasi, M.M., (1985). “Open Space, Water and Trees in Ottoman Urban Culture in the 18th19th Centuries, Environmental Design”, Journal of the Islamic Environmental Design Research Centre, no.2, pp. 36-49. Cerasi, M.M. (1999a). “The Problem of Specificity and Subordination to External Influences in Late Eighteenth Century Ottoman Architecture in Four Istanbul Buildings in the Age of Hassa Mimar Mehmed Tahir”, EJOS, IV, M Kiel, N Landman, H. Theunissen (eds.), Proceedings of the 11th International Congress of Turkish Art, Utrecht, The Netherlands, No:11,pp:1-23. Cerasi, M.M. (1999b). “Tarihselcilik ve Osmanlı Mimarisinde Yaratıcı Yenilikçilik / 17201820”, Osmanlı Mimarlığının 7 Yüzyılı, Uluslarüstü Bir Miras, Yapı Endüstri Merkezi Yayınları, İstanbul. Cezar, M. (1977). Anadolu Öncesi Türklerde Şehir ve Mimarlık, İstanbul. 482
Cezar,M., (1987).”Geçen Yüzyıllardaki Türk Şehri”, İslam Mimari Mirasını Koruma Konferansı-Bildiriler, İstanbul. David, J.C. (1977). “Alep, degradation et tentative acturelles de réadaptation des structures urbaines traditionnelles”, Bulletin d’Études Orientales de l’Institut Français d’Études Arabes de Damas, Tome 28. David, J.C. (1982). “Urbanisation spontanée et planification; le faubourg ancient nord d’Alep (XV ͤ -XVIII ͤ siècle)”, Les Cahiers de la recherché architectural 10-11. Demir, A. (1996). Through the Ages Antakya, Akbank Publications, İstanbul. Elisséeff, N. (1970). “Damas á la lumiére des théories de Jean Sauvaget”, in The Islamic City, ed. A.H. Hourani and S.M. Stern, Oxford, pp: 157-177. Elisséeff, N., (1980). “Physical lay-out”, in Serjeant, R.B., ed., The Islamic City, United Nations Educational, Scientific and Cultural Organization, Paris, pp. 90-103. Ergenç,Ö., (1980). “17.y.y.Başlarında Ankara’nın Yerleşim Durumu Üzerine Bazı Bilgiler”, Osmanlı Araştırmaları, v.1.,pp:85-108. Ergenç, Ö. (1980). “Osmanlı Şehrinde Esnaf Örgütlerinin Fiziki Yapıya Etkileri”, 1.Uluslararası Türkiye’nin Sosyal ve Ekonomik Tarihi Kongresi Tebliğleri (Ed. Okyar, O., İnalcık,H.), Ankara, pp:103-109. Ergenç, Ö. (1984). “16.Yüzyıl Ankara’sı: Ekonomik, Sosyal Yapısı ve Kentsel Özellikleri”, Tarih İçinde Ankara, (Ed.E.Yavuz, Ö.N. Yavuzel), Ankara, ODTÜ Press, pp:49-59. Ergenç, Ö. (1990). “Mimar Sinan’ın Yaşadığı Dönemdeki Osmanlı-Türk Kenti Hakkında Kısa Bilgiler”, Mimarlık, n.242, pp.22-25. Ergenç, Ö. (1995). Osmanlı Klasik Dönemi Kent Tarihçiliğine Katkı, 16. Yüzyılda Ankara ve Konya, Ankara. Faroqhi, S. (1979-1980). “Taxation and Urban Activities in Sixteenth Century Anatolia”, International Journal of Turkish Studies, v.1., n.1, pp.19-54. Faroqhi, S. (1981). “Urban Development in Ottoman Anatolia (16-17 centuries)”, METU Journal of the Faculty of Architecture, v.7., n.1 (Spring),pp.35-51. Faroqhi, S. (1984). Towns and Townsmen of Ottoman Anatolia-trade, Crafts and Food Production in an Urban Setting, 1520-1650, Cambridge University Press. Faroqhi, S. (1987). Men of Modest Substance House Owners and House Property in Seventeeth Century Ankara and Kayseri, Cambridge University Press. Gangler, A. (1993). Ein traditionelles Wohnviertel im Nordosten der Altstadt von Aleppo, Tubingen. Gaube, H., Wirth, E. (1984). Aleppo. Historische und geographische Beiträge zur baulichen Gestaltung, zur sozialen Organisation und zur wirtschaflichen Dynamic einer vonderasiatischen Fernhandelsmetropole, 2 vols., Beihefte zum TAVO, B, Nr. 58, Weisbaden. Gerber, H. (1983). “The Waqf Institution in Early Ottoman Edirme”, African and Asian Studies, 17. Hourani, A.H. (1970). “The Islamic City in the Light of Recent Research” in The Islamic City: A Colloquim, ed. A.H. Hourani and S.M. Stern, published under the auspices of the Near Eastern History Group, Oxford, and the Near East Centre, University of Pennsylvania, pp.1-24. İnalcık, H. (1990). “Istanbul: An Islamic City”, Journal of Islamic Studies 1, pp:1-23. Kuban,D. (1983). “The Geographical and Historical Bases of the Diversity of Muslim Architectural Styles: Summary of a Conceptual Approach”, Islamic Architecture and Urbanism, A. Germen (ed.), King Faisal University, Dammam. Lapidus, I.M. (1967). Muslim Cities in the Later Middle Ages, Harvard University Press, Cambridge. 483
Lapidus, I.M. (1969). “Muslim Cities and Islamic Societies”, Ira Lapidus, ed., Middle Eastern Cities A Symposium on Ancient, Islamic, and Contemporary Middle Eastern Urbanism, Los Angeles, pp.47-79. Lapidus, I.P. (1973a). “Traditional Muslim Cities: Structure and Change”, From Medina to Metropolis, L.C.Brown (ed.), Princeton: The Darwin Press, pp.51-69. Lapidus, Ira. (1973b). “The Evolution of Muslim Urban Society,” Comparative Studies In Society and History 15, pp: 21-50. Mantran, R. (1962). Istanbul dans la seconde moitié du XVII ͤ sİécle. Essai d’histoire institutionnelle, économique et sociale, Paris. Mantran, R. (1965). La vie quotidienne á Constantinople au temps de Soliman le magnifique et des ses successeurs (XVI ͤ et XVII ͤ siécles), Paris. Mantran, R. (1982). “Foreign Merchants and the Minorities in Istanbul during the Sixteenth and Seventeenth Century”, in Christian and Jews in the Ottoman Empire, vol.1, The Central lands, ed. B.Braude and B.Lewis, Holmes and Meier Publishers, New York, pp: 127-137. Necipoğlu, G. (1991). Architecture, Ceremonial and Power: The Topkapı Palace in the Fifteenth and Sixteenth Centuries, New York and Cambridge, MA. Neglia, G. A. (2008). “Some Historical Notes on the Islamic City With Particular Reference to the Visual Representation of the Built City”, The City in the Islamic World, ed. Jayyusi, S.K., et all., Brill Publication, Netherlands. Özcan, K. (2005). Anadolu’da Selçuklu Dönemi Yerleşme Sistemi ve Kent Model(ler)i, unpublished Phd dissertation, Department of Architecture, Selçuk University, Konya, Turkey. Pauty, E. (1951). “Villes spontanées et villes créés en Islam”, Annales de l’Institut d’Études Orientales, 9. Petruccioli A. (2008). Bellek Yitiminin Ardından, Akdeniz Đslam Kent Dokusunun Oğrettikleri,(B. Kutukcuoğlu trans.) İstanbul: Yapı endustri Merkezi Yayınları. Pinon, P. (1989). “Les tissus Urbains Ottomans entre Orient et Occident”, in Proceedings of the 2nd International Meeting on Modern Ottoman Studies and the Turkish Republic, Leiden, pp:15-45. Pinon, P. (1991). “Essai de definition morphologique de la ville Ottomane des XVIII ͤ XIX ͤ siécles”, in La culture urbaine des Balkans, vol.3, La ville des Balkans depıis la fin du Moyen Age jusqu’au début du XX ͤ siècle, Paris and Belgrade, pp:147-155. Pinon, P., (1999). “Anadolu ve Balkanlar’daki Osmanlı Kentlerinde Kentsel Dokular Tipolojisi Üzerine Bir Deneme”, Afife Batur (ed.), Osmanlı Mimarlığının 7 Yüzyılı, Uluslarüstü Bir Miras, Yapı Endüstri Merkezi Yayınları, İstanbul. Pinon, P. (2004). “Survivances Et Transformations Dans La Topographie D’Antioche Apres L’Antiquite”, Topoi, Suppl. 5, pp. 191-219. Pinon, P. and Yérasimos, S. (1993). “Relevés après incendie et plans d’assurances: les précurseurs de cadastre stambouliote”, in “Environmental Design: Urban Morphogenesis, Maps and Cadastral Plans”, ed. A. Petruccioli, Environmental Design: Journal of the Islamic Environmental Design Research Centre, 1-2, pp:112-129. Planhol, X. (1968). Les Fondements Géographiques de l’Historie de l’Islam, Paris. Raymond, A. (1974). "Signes urbains et étude de la population des grandes villes arabes á l'époque Ottomane", Bulletin d’Études Orientates de l’Institut Français d’Études Arabes de Damas ,27, pp:183-193. Raymond, A. (1977) "Le déplacement des tanneries á Alep, au Cairo et á Tunis á l’epoque Ottomane: Un 'indicateur' de croissance urbaine," Revue d'Histoire Maghrébine, nos. 7-8, pp: 192-200 484
Raymond, A. (1984). The Great Arab Cities in the 16th-18th Centuries: An Introduction, New York. Raymond, A. (2009). “The Spatial Organization of the City”, The City in the Islamic World, ed. Jayyusi, S.K., et all., Brill Publication, Netherlands, pp:47-70. Sack, D. (1985). “Damaskus, die Stadt intra muros”, Damaszener Mitteilungen, 2. Sack, D. (1989). Damascus: Entwicklung und Struktur einer orientalischen Stadt, Mainz. Sauvaget, J. (1941). Alep; essai sur le dévelopment d’une grande ville syrienne des origines au millieu xıxe siécle,Paris. Sauvaget, J., (1949). “Le plan antique de Damas”, Syria, 26. Serjeant, R.B. (1980).“Social Stratification in Arabia”, in Serjeant, R.B., ed. The Islamic City, United Nations Educational, Scientific and Cultural Organization, Paris, pp. 126147. Serjeant, R.B., ed., (1980). The Islamic City, United Nations Educational, Scientific and Cultural Organization, Paris. Stern, S.M., (1970). “The Constitution of the Islamic City”, in The Islamic City: A Colloquim, eds. A.H.Hourani and S.M.Stern, Oxford, pp.25-50. Tabbaa, Y. (1997). Constructions of Power and Pico in Medieval Aleppo, Philadelphia. Tamari, S. (1966). “Aspetti principali dell’urbanesimo musulmano”, Palladio, nos. 1-4, pp:45-82. Tanyeli, U. (1984). “Anadolu Yerleşme Tarihi”, Yurt Ansiklopedisi, vol.11, pp: 8792-8814. Tanyeli, U. (1987). Anadolu Türk Kentinde Fiziksel Yapının Evrim Süreci, (11-15 yüzyıllar), Istanbul. Wirth, E. (1982). ”Villes islamiques, villes arabes, villes orientales? Une problématique face au changement”, La ville arabe dans l’Islam,ed.A. Bouhdiba and G.Chevallier, Tunis and Paris, pp: 193-215. Wirth, E. (1985). “Zur Konzeption der islamischen Stadt: Privatheit im islamischen Orient versus Öffentlichkeit in Antike und Okzident”, Die Welt des Islams, 25, pp:50-92 Yüksel Caner, Ç. (2009). A Spatial Inquiry into Western Anatolian Urban Centres: Tire in the Making (14th and 16th Centuries),un-published Ph.D. dissertation, Department of Architecture, Middle East Technical Universtiy, Ankara, Turkey. Yüksel Caner, Ç. (2015). “The Making of the Commercial Center in Tire (14th – 16th Centuries)”, METU Journal of the Faculty of Architecture, v.32, n.1, pp.147-164.
485
Chapter 36 Structural Analysis of Kayseri’s Historical Bazaar During the Ottoman Period Suat ÇABUK INTRODUCTION Like those of living organisms, settlements of people are constructed, developed and disappear over time. In reality, the existence of settlements depends on a number of social, political, technological, economic and cultural factors. Among the settlement types, cities are the most prominent manifestation of a human culture (Jamalinezhad et al., 2012). Today, metropolitan areas are the main centers of global economic activity. Commercial centers, which were called bazaars during the Ottoman period, have long been the economic hearts of cities. Kayseri, which is the main city of the Cappadocia region in the heart of Anatolia, hosts a historical bazaar that dates back to the Ottoman period. Due to the city’s a low potential for the development of agriculture, it has relied on trade since the times of the Hittites. The location of Kayseri, which is found at the intersection of the Anatolian roads from north to south and from east to west, has provided the city with a major advantage in terms of commercial activities. During the Seljuk period, commercial buildings were located outside the city walls. With the start of the Ottoman Era, the Kayseri Bazaar was constructed around the Ulu Camii or Friday Mosque, which is the main mosque and the political center of the city; this pattern was similar to that of other Ottoman cities. As a reflection of urban policy, the Friday Mosque and the Kayseri Bazaar were integrated. The construction of the Bedesten (Bazzazistan or Qayseriyya as it was called in the Middle East) constituted the first phase in the development of the Kayseri Bazaar during the Ottoman period. Individuals or waqfs constructed new commercial buildings so that a larger city center developed over time. Kayseri, whose commercial center comprised 25 hectares at the beginning of the 20th century, has become the main Anatolian city with the biggest bazaar (Demir & Çabuk, 2013). This chapter will deal with the development of the Kayseri Bazaar from the Ottoman period to the Republican Era. The study used spatial analysis and observation techniques and dealt with the period between 1500 and 1900 in temporal terms and with the area around the walled city that hosted the bazaar in spatial terms. BAZAAR STRUCTURE OF OTTOMAN CITIES Commercial centers, which have been formed in the cities of various civilizations, have played important roles. Agoras, forums and bazaars were the main commercial centers of the cities that were founded by the Anatolian civilizations before Ottoman rule. The Turks, who were in close contact with the Muslim Persians and Arabs, adopted terms such as Bazaar, Cihar-souq or Souk to refer to trade areas, whereas they
Assoc. Prof. Dr., Karabuk University Safranbolu Fethi Toker Faculty of Fine Arts, Department of Architecture, Safranbolu / Karabük,
[email protected]
called commercial centers as Pazar or Çarşı. The area that hosted commercial buildings in Ottoman cities was called either the “traditional commercial zone” or the “bazaar (çarşı)”. The bazaar was more than a physical space where commercial activities took place; it was the prime center of the Ottoman city with its social, religious and cultural facilities (Cezar, 1985). The main component of the trade center was a mosque, which was generally called the Friday Mosque. The names ulu camii, sultan camii and camii kebir were also used to refer to the Friday Mosque. As the religious center of the Ottoman city, the Friday Mosque served for religious service. In fact, the Ottomans considered cities as places, “where the Friday prayer was performed and a bazaar was found at” (Ergenç, 1982). This Ottoman concept of cities indicates the importance of the mosque and the bazaar in the shaping of urban areas. Bazaars in various Ottoman cities, such as Kayseri, Bursa, Edirne, Diyarbakır, Tokat and Sivas, were located around the central Friday mosques. On the other hand, bazaars in some Ottoman cities, including İstanbul, Urfa and Konya, were founded around the Bedesten rather than the central Friday mosques. In any cases, the Ottoman bazaar shared a number of common points, which include the following (Ergenç, 2010): • All commercial activities were governed by laws that were sanctioned by the Sultan. • The norm was that goods should be delivered to everyone in a just manner. Measures to prevent shortages were taken. • The usage of scales and other measuring devices was regulated according to the orders of the Sultan. • The quality and price of goods were regulated by state officers. • Ottoman currency was used for commercial purposes. • The production and commercial activities conducted by artisans were regulated by the Ottoman constabulary (Muhtesip). The trading of goods imported from or exported to distant lands was regulated by the Damga Eminleri whereas the Kapan Eminleri were responsible for regulating goods imported from or exported to areas nearby. • Commercial activities could only be conducted at special places determined by the authorities. The classification of commercial buildings in Ottoman cities reveals a number of common points in every city. The main commercial buildings of the traditional Ottoman bazaar were the bedesten, kapan han (inn), other bazaar hans, shops, workshops, openair marketplaces and the bazaar baths (Demir & Çabuk, 2013). It may be argued that such a systemic structure was the result of a conscious spatial policy. Additionally, depending on the social, economic, political, historical and geographical factors, the constructions listed above were either organized in the form of a cluster or in a linear pattern along a main street. While some bazaars specialized in the production and sale of a particular product, others hosted various types of shops and workshops. Ottoman bazaars were cosmopolitan places in both cultural and religious terms. The shops were closed on Fridays, Saturdays and Sundays, the holy days of the Muslims, Jews and Christians, respectively. The Ahi Order, which was a legacy of the Seljuks, was replaced by the guild system (Lonca) in the 16th century. Muslim and nonMuslim craftsmen and artisans of the city were organized around the guilds (Mantran, 487
1962; Cerasi, 1999). In large cities, every profession had its own guilds. Depending on the ethnic and religious composition of the cities, the headmen (Kethüda) of the guilds could be elected from non-Muslims. The guild headman was determined by elections and appointed by the Kadı (Muslim judge and important official). The guilds had the authority to permit the opening of new shops. In case of shortages, first of all the number of workbenches was increased, and then new shops were permitted. On some occasions, such as when a tradesman got old or his/her children did not want to work in their parents’ shops, the shop was sold or rented. Craftsmen and merchants that worked in the same line of business were required to be located in the same street so that the state could regulate them and people could reach them easily. Since supply was restricted according to demand, export to European countries was forbidden from the end of the 16th century and tradesmen could not sell goods below the prices determined by the governors (Kal’a, 1998). FORMATION OF THE HISTORICAL BAZAAR OF KAYSERI Throughout urban history, Kayseri has been a center of commercial activities. The city of Nesa, which was one of the oldest trade centers in Anatolia, was founded in Kültepe Hoyuk, lying 20 km east of Kayseri. Excavations in the hoyuk found more than 15,000 documents, including commercial letters and bills of debts written on clay tablets. The documents reveal that goods brought from Mesopotamia and Persia (textiles, tin, etc.) and goods produced in Anatolia (cloths, gold, silver etc.) were exchanged in Kültepe-Kaneş (Özgüç, 2005). Together with Sivas, Kayseri, which maintained its military and commercial importance during the Roman and Byzantine periods, played a key role in the transfer of goods from Persia and Arabia to the West and North during the Seljuk period (Cantay, 2000). Starting with the Seljuks, Kayseri turned into a center for the textile and leather trade under the guidance of the Ahi and Baciyan-i Rum orders (Bayram, 2007). Most of the architectural monuments in today’s Kayseri date back to the reign of Danishmends, Seljuks and Principalities. The number of architectural monuments constructed by the Ottomans is limited. Examples of classical Ottoman urban architecture can be seen around Kayseri’s Friday Mosque and the historical Kayseri Bazaar. Among the bazaars in Turkey, Kayseri Bazaar is the second largest bazaar after the Istanbul Grand Bazaar in terms of the area occupied (Uysal, 2010). The bazaar, which was located outside the city walls during the Seljuk period (Akşit 1998; Eravşar, 1998), was moved to its current position during the Ottoman period. As a result of the spatial policies applied by the Ottomans, Kayseri Bazaar and the Friday Mosque became a whole and occupied the historical center of the city. During the Ottoman period, Kayseri’s commercial center started to be formed in 1497 with the construction of the Kayseri Bedesten, 50 meters north of the Kayseri Friday Mosque, and 35 shops at three sides of the Bedesten (Demir & Çabuk, 2013). The Bedesten and the shops, which were built by the governor of Kayseri Sanjak Mustafa, are among the real estate belonged to the Hançerli Sultan Waqf. Dressed stone and dry (yonu) stone were used in the construction of the Bedesten. The building is composed of three parts, a main square-shaped part and two rectangle-shaped Arasta at the north and south of the construction that are linked to the main part. During its early years, the middle main part of the Bedesten hosted a number of 488
shops selling precious cloths whereas the northern part, the Külhancılar Bazaar (Jewelers Bazaar), and the southern part, the Haffaflar Bazaar (Shoesellers Bazaar), were the parts where jewelry, leather and shoe shops were found (Öncel, 2007). According to its original plan, the Kayseri Bedesten had two main gates. The eastern gate opened to the closed bazaar, whereas the western gate opened to the Kapan Han. The Pembe Han, which was constructed at the beginning of the 15th century by the Karamanoğulları dynasty, became the Kapan Han during the Ottoman period (Figure 1). According to the waqf records, the Han belonged to the Şah Hatun Waqf (Demircan, 1992). The architectural plan of the Kayseri Kapan Han resembles those of traditional inner-city hans. The Han has two floors with a square-shaped yard in the middle and rooms behind the cloister.
Figure 1: Main Components of the Kayseri Bazaar.
The third component that had an impact on the shaping of the bazaar is the Gön Han (New Han), which was built by Grand Vizier Piri Mehmet Pasha in 1521. ‘Gön’ in Turkish means leather, and the name of the Gön Han comes from the leather trade conducted at the han. Originally, the Gön Han had two floors but only the first floor and the original entrance gate remain. The Waqf certificate charter written by the Kayseri Kadı Bedrettin Mahmut in 1558 provides important clues about the history of the Kayseri Bazaar. Kadı Bedrettin certificated the shops located on the two sides of the street lying from the Boyacı Gate to the Bazaar and the shops from the Meydan Gate to the Bedesten and İki Kapılı Mosque. In addition, the Kadı certificated the Kadı Hamamı (Judge Bath) and Kocabey Madrasa, which he built in 1542. The names of the marketplaces found in the charter include Gazzezler (silk salesmans), Muytablar (makers of felt), Demirciler (Ironsmiths), 489
Nalbantlar (Forges) and Uzun (Long) marketplaces. Information derived from the Waqf certificate charter of Kadı Bedrettin Mahmut may lead us to suggest that the Bedesten was at the heart of the Bazaar, which stretched towards the Meydan Gate at the north and the Boyacı Gate at the south. The Uzun Bazaar (also known as the Sipahi Bazaar), which formed the main axis of the Kayseri Bazaar, was constructed during the same period. The Waqf certificate charter of Nasrullahzade Hacı Mehmet Efendi, which was written in 1584, also provides insight into the traditional trade area of Kayseri. Habbazlar (Bakeries), Kürtüncüler (Saddlers), Bakkallar (Groceries), Eskiciler (Junk Dealers), Kuyumcular (Jewelers), Kazancılar (Boiler Smiths), Kürkçüler (Furriers), and Hallaçlar (Rope-Makers) are the names of the marketplaces that the charter dealt with. Therefore, the commercial buildings of the Kayseri Bazaar were located on a plain topography, which stretched from north to south and east throughout the streets, and their names were given in the Waqf certificate charters. Development towards the west was restricted by the Muslim neighborhoods and the Friday Mosque. In its early times, the names of the streets came from the goods sold or produced by the shops in each street. Moreover, shops from the same professional groups were located in the same street within the context of the guild system. Shops in the narrow streets of the Bazaar were mostly one-floored with plain roofs. In cases where the shop had more than one floor, upper floors were used for storage. Until 1840, the shops were made of wooden materials. Shops made of stone on three sides had wooden shutters on their front. One side of the wooden shutter opened outwards (exhibition stand) and the other opened upwards, acting as an eave. Additionally, the shops were kept small, leading to a concentration of shops in a limited area. Another building that carries the fingerprints of the Ottoman era is the Hacı Ahmet Pasha Islamic social complex (Külliye), which is the work of Mimar Sinan. Currently, only the mosque of the complex, which is also called the Kurşunlu Mosque, remains. According to the Waqf certificate charter of Doğancı Ahmet Pasha written in 1581, the social complex included hans, a bath, school and imaret in addition to the mosque. They were actually constructed in 1573 according to the instructions of Selim II (Çayırdağ, 2001). This complex built at the front of the Meydan Gate maintained the extension of the Bazaar to the east outside the city walls. KAYSERI BAZAAR IN 1650 ACCORDING TO EVLIYA ÇELEBI The Book of Travels (Seyahatname) written by Evliya Çelebi provides rich details about the Kayseri Bazaar during the Ottoman period. Çelebi first visited Kayseri under the protection of the governor Murtaza Pasha. In his book entitled “The Book of Travels”, Çelebi described the city and surroundings with a style unique to the author. The work of Evliya Çelebi shows that the author made detailed studies about the Bazaar and the area around the city walls (Çabuk, 2012). In the Book of Evliya Çelebi, 85% of the part about Kayseri gives a description of the city, primarily the Kayseri Bazaar. In his book, Çelebi states that the Friday Mosque was the largest and the oldest mosque in Kayseri and adds that the building was made of brick and had a long minaret. In addition, the author notes that the mosque was close to the Boyacı Gate and Kadı Bath, with a yard full of willow trees (Çabuk, 2012). Çelebi described the Kayseri Bazaar as the Bazaar of the Sultan (Sûk-ı Sultânî), 490
meaning that the bazaar was more than a typical one. The term refers to the areas, where the commercial rules were sanctioned directly by the Sultan (Ergenç, 2010). Under the heading of “The Characteristics of the Sultan Bazaar”, Çelebi stated that Kayseri had two beautiful stone bedestens, as in the examples of Bursa, Edirne and Istanbul. The oldest bedesten was in the Old Bedesten Neighborhood (Eski Bedesten Mahallesi) whereas the larger bedesten was at the Bazaar. Çelebi stated that gold and silver exchange was conducted in Kayseri and added that there were workshops for these precious metals (Evliya Çelebi, 2008). Evliya Çelebi provided the names of three impressive stone-made hans in his work: Kığlamazzade Han at the Boyacı Gate, Kapan Han and the Gön Han at the Uzun Bazaar (Evliya Çelebi, 2008). Although they were not mentioned by Çelebi, the other hans in Kayseri were as follows: • Baldöktü Han (constructed in the Baldöktü neighborhood in 1509) • Bedreddin Mahmut Han (constructed opposite the Kocabey Mosque in 1534) • Ahmet Pasha Han (constructed in the second half of the 16th century around the Kurşunlu Mosque: it had 13 rooms) • Abdi Bey Han (constructed in the Camii Kebir neighborhood in the first half of the 17th century with 50 rooms and 2 stables) • Ali Çelebi Han (outside the Boyacı Gate) • Mirza Bey Caravanserai (near the Kapan Han) • Çukur (Hole) Han • Gürcü (Georgian) Han • Kadı (Judge) Han Consequently, more than 12 large hans were constructed in the city of Kayseri. The part of Evliya Çelebi’s book entitled “Description of the Shops around the Main Street” deals with the bazaars and shops that Çelebi had visited regularly. These bazaars include the Uzun (Long) Bazaar, Kapamacılar (Confection) Bazaar, Un (Flour Inn) Kapan, Aktarlar (Herbalists) Bazaar, barber shops, Papuççular (Shoe seller) Bazaar, tailor shops, Karakeçili shops, grocery shops, butcher’s shop, cook’s shop, shops selling fruit stew, Bazaar of barley and saddle sellers and the boiler smiths’ Bazaar. In addition, Çelebi also dealt with trade areas such as the Uzun Bazaar of the Mevlevihane (Lodge used by Mevlevi Dervishes), Saraçhane (Saddlery), Haffafhane (Shoe maker and Sellers), Debbağlar (Tanners), Odun (Wood) and the Koyun (Sheep) bazaars. As such, Evliya Çelebi recorded the commercial zone, which is currently known as the Closed Bazaar, and the marketplaces and shops around this zone. This description provided by Çelebi shows that the Bazaar region was a lively place for commercial activities (Evliya Çelebi, 2008). Next, Çelebi states that due to lack of space, new commercial zones extended towards the neighborhoods occupied by non-Muslims, namely the zone eastward of the inner city. Furthermore, Çelebi reports that new commercial zones were formed around some of the Islamic social complexes and the gates of the walls. RE-SHAPING OF THE KAYSERI BAZAAR WITH THE CONSTRUCTION OF THE VIZIER HAN IN THE 18TH CENTURY An important commercial building that re-shaped the pattern of the Kayseri Bazaar is the Vizier Han. The two-floored stone han was constructed in 1724 by the famous vizier of the Tulip age Damat İbrahim Pasha of Nevşehir. Since the construction, which 491
was located at the south of the Bedesten and at the northeast of the Friday Mosque, did not have much space, its architectural planning was unlike that of classical hans. Due to the presence of the Friday Mosque at the southwest, the walls of the han on this site were arranged in line with the walls of the Mosque so that passage to the Mosque was possible. The southern side of the han was beveled. The northern side of the han was narrowed and the walls of the han and the Bedesten were separated by a passage. Although the Vizier Han was planned to have two yards, the changes for the area between the han and the Bedesten led to the construction of a third yard (Özbek and Arslan, 2008). Compared to the other two yards, the middle yard is more regular. The number of rooms in the first, the middle and the third yards are 33, 46 and 29, respectively. There is a shop at the outer side of the building. In addition, the Court (Mahkeme) Han at the north of the Friday Mosque was added to the properties of this waqf. Construction of the Vizier Han hindered the development of the Uzun Bazaar. The Uzun Bazaar, which was shortened by Vizier Han, was named the Sipahi Bazaar. As in the case of the Vizier Han, waqfs played a key role in the construction and development of the trade buildings in Kayseri. The first investments required for the traditional commercial activities of Kayseri were provided by the waqfs or the founders of these institutions. The Kapan Han, Kayseri Bedesten and other commercial buildings built by Kadı Bedrettin Mahmut, Nasrullahzade Hacı Mehmet Efendi and Vizier Damat İbrahim Pasha of Nevşehir were funded by waqfs. An important share of the commercial buildings was constructed on sites that would provide a high income to the waqfs (Figure 2).
Figure 2: Waqfs in Kayseri Bazaar (Demir & Çabuk, 2013).
LANDSCAPE OF THE TRADITIONAL TRADE CENTER OF KAYSERI AT THE END OF THE 19TH CENTURY Evaluation of the tax census of 1872 (Cömert, 2007) and the first urban map of Kayseri drawn in 1882 shows that 25 hectares of the total urban space of 315 hectares were allocated to commercial activities. While none of the Anatolian cities had a Bazaar area of more than 4% (Aktüre, 1978), the area of the Bazaar of Kayseri constituted 8% 492
of the total urban area, signifying the importance and share of the Kayseri Bazaar in the economic life of the city (Figure 3). The Bazaar, which held a considerable share of the urban area, hosted social and cultural places, such as mosques, masjids (small mosques), baths and fountains. Figure 3 shows that the residential and commercial zones in Kayseri were separated from each other during the Ottoman period. However, this division was blurred in areas in which the distance between the commercial and residential zones got closer. For example, when the Çilingirciler (Ironsmiths) Bazaar was extended, the houses in this area were sided by shops (Çapar, 2002). Furthermore, starting in the second quarter of the 19th century, the share of craftsmens’ shops decreased in the Kayseri Bazaar compared to the share of merchants’ shops.
Figure 3: Traditional Commercial Pattern in Kayseri at the end of the 19th Century.
The final form of the Kayseri Bazaar during the Ottoman period took shape in the middle of the 19th century. In 1844, Güpgüpzade Hacı Efendi built the stone-made Hacı Hanefi (Efendi) Bazaar which consisted of 302 shops and was parallel to the Urgancılar (Rope makers) Bazaar. The two fires that occurred in the Bazaar in 1849 and 1870 led to some minor revisions. The fire of 1849 resulted in the destruction of most of the shops, which were repaired and extended in 1859 by the people of Kayseri. The second fire occurred on 14 September 1870 and burned almost all the shops in the Bazaar since most of the buildings were made of wooden material. Only the Hacı Efendi and the Cıngıllıoğlu bazaars escaped the destruction caused by the fire (Çayırdağ, 2006). Following the fires, massive renewal works took place in the Kayseri Bazaar. In 1870, the municipality of Kayseri prepared a bazaar plan based on the original state of the Bazaar and constructed 1804 shops in a short period. The Bazaar was called the Kayseri Closed Bazaar since the upper parts of the streets consisted of vaults. According to the tax census conducted one year after the construction of the Bazaar in 1872 (Cömert, 2007), there were around 2900 active shops in Kayseri. Accordingly, 62% of all commercial units in Kayseri were re-built. 493
Today, the street of the Sipahi Bazaar is accessible from the eastern gate of the Bedesten by seven steps. From this, we know that the Bazaar was raised about one meter when it was re-constructed. Apart from the Closed Kayseri Bazaar, there were various other open-air bazaars in Kayseri. Ot (Herb) Bazaar Street constitutes an important example of these street bazaars. The street starts from the Gate of Vizier Han and extends towards the Boyacı Gate. Sugar sellers, ironsmiths, stove makers and painters were located in the street. Sword and knife makers were located at the shops close to the Meydan Gate at the north of the Bedesten. Marketplaces were founded in the Pembeciler Bazaar, Kiçi Gate of the city walls, Meydan Gate, Horse Bazaar, Car Bazaar, and the areas known as Dörtdükkanönü, Tekkeönü, Sarayönü and Hendek Kenarı. For example, the Horse Bazaar consisted of 18 shops in 1803. Figure 4 shows the bazaars according to the 1872 census.
Figure 4: Marketplaces according to the 1872 Census and the 1882 Urban Map.
The marketplaces of Ottoman period Kayseri were open areas, mostly near the Bazaar or outside the city walls, where goods brought by the townsmen and villagers were sold. Customers had direct contact with the producers at these places. The marketplaces mentioned in the Ottoman records were At (Horse), Un (Flour), Buğday (Wheat), Odun (Wood), Koyun (Sheep) and Esir (Slaves) marketplaces. The construction of hans for commercial purposes continued in the 18th and 19th centuries. The hans constructed in these centuries were the Vizier Han, Court Han (near the Friday Mosque), Halil Efendi Han (constructed in Horse Marketplace in 1729), and Boğazlıyanzade Han. Additionally, an official record dated 1789 lists the names of Sepetçiler, Yolgeçen, Tahta and Tomru Kadın hans (Anon, 1789). Figure 5 shows the places of 21 hans, 8 camel stables (Develik) and 2 hinny stables (Katırhane). 494
Figure 5: Hans, Camel Stables and Hinny Stables in Kayseri at the end of the 19th Century.
Some workshops in Kayseri were located around the Closed Bazaar whereas others were found at the borders of the city. The workshops were located either on an individual basis, as in the case of linseed oil shops (Bezirhane) or alongside the marketplaces, as in the case of tanners (Debbağ). Traditional workshops started to lose their place in the economy in the 19th century and were moved to industrial zones in the 20th century. Until the 19th century, it is impossible to analyze the place of non-Muslims in the traditional commercial activities of Kayseri. Based on the kadı court registers of Kayseri, it may be concluded that commercial activities were mostly conducted by the Muslim population until the Tanzimat (Reform) era. Starting with the Tanzimat era, production, marketing and commercial activities were faced with a great transformation so that the Armenians and the Greeks started to have a greater voice in the economic activities of the city. Due to the low custom duties on imported goods, Armenian and Greek tradesmen, who sold goods and materials imported from the West, got richer in a short period. The 1872 census records show the decrease in the role of Muslim entrepreneurs in Kayseri’s economy (Tuzcu, 2000). Accordingly, 1200 of the 2900 shops in Kayseri were owned by Armenian and Greek tradesmen. Besides, 2336 of 8119 residences in Kayseri were owned by non-Muslims. Therefore, more than half of all Armenian and Greek residents owned shops. Nearly all of the tradesmen in the Bedesten and the Vizier Han, the two important commercial centers of the city, were non-Muslims. During the Ottoman period, the baths nearby the commercial centers were called the “bazaar baths”. The bazaar baths were highly profitable enterprises. In his book, Evliya Çelebi lists Kadı (Gülük), Gürcü (Georgian) and Yeni Kadı (New Judge) baths 495
for the inner city and the Hundi Hanım, Hüseyin Pasha, Pasha, Meydan, Sultan, Salahaddin, Eski Pamukçular, Gerez Pasha, and Müftünün Yeni baths outside the walled city. There are three more baths that are not listed in the Book of Travels of Evliya Çelebi. The first and the oldest of these baths is the Birlik Bath that was constructed in 1183. The Deveci Bath that was constructed in 1730 in the Hasinli Neighborhood and the Caferbey Bath that was constructed at the end of the 16th century in the Caferbey Neighborhood are the other two baths. Among these baths, the Sultan, Hunat, Kadı, and Salahaddin baths constitute examples of the bazaar baths due to their locations near the Bazaar. CONCLUSIONS Kayseri, which was an important commercial center throughout urban history, maintained its position during the Ottoman period. Commercial buildings that were constructed outside the city walls during the Seljuk period were transferred to near the Friday Mosque starting at the end of the 15th century. The Kayseri Bazaar developed towards the north, south and east along the streets. Most of the commercial buildings in Kayseri were constructed by the waqfs. Kayseri Bazaar took its classical shape during the visits of Evliya Çelebi, and with the construction of a few buildings, such as the Vizier Han, the Bazaar maintained its shape until the 20th century. The main physical elements of the Kayseri Bazaar are the Friday Mosque, the Bedesten, Kapan Han, Closed Bazaar, streets with shops, other hans, workshops and baths. The 16th century street known as the Uzun Bazaar held a prominent place among the numerous streets of the Kayseri Bazaar. Uzun Bazaar Street, which stretched towards Sarayönü Square, connected the northern and southern parts of the Kayseri Bazaar. However, with the construction of the Vizier Han, the development of the Uzun Bazaar was restricted. Kayseri Bazaar, which is the second biggest Ottoman Closed Bazaar after the Istanbul Grand Bazaar, was reconstructed by using stone materials after the fires in 1849 and 1870. There are numerous marketplaces other than the Closed Bazaar in Kayseri. Marketplaces with the names of sugar sellers, ironsmiths, stove makers and painters were located on Herb Bazaar (Ot Pazarı) Street. Workshops of the sword-makers and knife-makers were located nearby the Meydan Gate at the north of the Bedesten. The Pembeciler Bazaar was located at the southeast of the Mevlevihane. Outside the city walls, there were various marketplaces located at the Kiçi Gate, Meydan Gate, Horse Bazaar, Car Bazaar, Dörtdükkanönü, Tekkeönü, Sarayönü and Hendek Kenarı. There were also open-air marketplaces that were separate from the Kayseri Bazaar. The names of the marketplaces that the Ottoman records dealt with were the Horse, Flour, Wheat, Wood, Sheep and Slaves marketplaces. Acknowledgement: Karabuk University Research Fund is gratefully acknowledged for supporting this study. (Project Number:KBÜ-BAP-16/1-KP-182). REFERENCES Akşit, A. (1998). Selçuklular Devrinde Kayseri Şehrinin Fiziki Yapısı. II. Kayseri ve Yöresi Tarih Sempozyumu Bildirileri (16-17 Nisan 1998), Erciyes Üniversitesi Kayseri ve Yöresi Tarih Arş. Mer. Yay. No:3, s.42, Kayseri. Aktüre, S. (1978). 19. Yüzyıl Sonunda Anadolu Kenti Mekansal Yapı Çözümlemesi. s.224,
496
ODTÜ Mimarlık Fakültesi Yayınları, Ankara. Anon, 168 Numaralı Kayseri Şer’iyye Sicili (H. 1204- M1789) Belge No: 14 ve 15, KAYTAM Arşivi, Kayseri. Bayram, M. (2007). Fatma Bacı ve Bacıyan-ı Rum. ss.21-23, Nüve Kültür Merkezi Yayınları, Konya. Cantay, G. (2000). Kayseri Kervanyolları II. Kayseri ve Yöresi Tarih Sempozyumu Bildirileri (06-07 Nisan 2000), ss.76-83, Erciyes Üniversitesi Kayseri ve Yöresi Tarih Araş. Mer. Yayınları, Kayseri. Cezar, M. (1985). Tipik Yapılarıyla Osmanlı Şehirciliğinde Çarşı ve Klasik Dönem İmar Sistemi. ss.6-8, Mimar Sinan Üniversitesi Yayınları, İstanbul. Cömert, H. (2007). 19. Yüzyılda Kayseri. Mazaka Yayıncılık, Kayseri. Çabuk, S. (2012). Evliya Çelebi’nin Gözünden Bir Kayseri Okuması. Belleten 76 (277), 817-847. Çapar, A. (2002) 66/1 Numaralı Kayseri Şer’iyye Sicili (H.061-M.1650) Transkriptasyon ve Değerlendirme. Yayınlanmamış YLS Tezi, Erciyes Üniv. Sosyal Bilimler Ens., Kayseri. Çayırdağ, M. (2001). Kayseri Araştırmaları Tarihi. ss.294-296, KBB Kültür Yayınları No:38, Kayseri. Çayırdağ, M. (2006). Kayseri Kapalı Çarşısı. Türk Dünyası Araşt. Mart-Nis. 2006, 219-226. Demir, K. & Çabuk, S. (2013). Türk Dönemi Kayseri Kenti ve Mahalleleri. Erciyes Üniversitesi Yayınları No,188, Kayseri. Demircan, Y. (1992). Tahrir ve Evkaf Defterine Göre Kayseri Vakıfları. Kayseri Vakıflar Bölge Müdürlüğü Yayınları, Kayseri. Eravşar, O. (1998). Ortaçağ'da Kayseri Kent Dokusu Gelişimi. Basılmamış Doktora Tezi, Selçuk Üniversitesi Sosyal Bilimler Enstitüsü, s.121, Konya. Ergenç, Ö. (1982). Mimar Sinan'ın Yaşadığı Dönemdeki Osmanlı-Türk Kenti Hakkında Kısa Bilgiler. Mimarlık, 179, s.22. Ergenç, Ö. (2010). Osmanlı Şehrinde Çarşı Sistemi: Bursa Örneğinde “Suk-ı Sultani”. Osmanlı Coğrafyasında Çarşı Kültürü Uluslararası Sempozyumu Bildiriler Kitabı, ss.31-34, Bursa Büyükşehir Belediyesi Yayınları, Bursa. Evliya Çelebi. (2008). Günümüz Türkçesiyle Evliya Çelebi Seyahatnamesi. (Haz. Seyit Ali Kahraman, Yücel Dağlı), Yapı Kredi Yayınları, 3. Cilt, 1. Kitap, ss.239-240, İstanbul. Jamalinezhad, M.; Talakesh, S. M.; Soltani, S. H. K., (2012). Islamic Principles and Culture Applied to Improve Life Quality in Islamic Cities. Procedia: Social and Behavioral Sciences 35, 330-334. Kal'a, Ahmet (1998). İstanbul Esnaf Birlikleri ve Nizamları-I, İstanbul Araştırmaları Merkezi, İstanbul. Öncel, F. (2007). Geleneksel Ticaret Dokusu İçinde "Kayseri Hançerli Sultan Vakfı Bedesteni’nin Koruma Sorunları ve Değerlendirilmesi. Basılmamış YLS Tezi, YTÜ Fen Bilimleri Enstitüsü, ss.91-115, İstanbul. Özbek, Y. & Arslan, C. (2008). Kayseri Taşınmaz Kültür Varlıkları Envanteri, ss.725-727, Kayseri Büyükşehir Belediyesi Yayınları, Kayseri. Özgüç, T. (2005). Kültepe: Kaniş-Neşa. ss.51-62, Yapı Kredi Yayınları, İstanbul. Tuzcu, A. (2000). 19. yy’ın Başlarından-20. yy’ın İlk Çeyreğine Seyyahların Gözüyle ve Konsolosluk Raporlarında Kayseri’nin İktisadi Yapısı. III. Kayseri ve Yöresi Tarih Sempozyumu Bildirileri, (06-07 Nisan 2000), Erciyes Üniversitesi Kayseri ve Yöresi Tarih Araş. Mer. Yayınları, ss.527-556, Kayseri. Uysal, M. (2010). Tarihi Süreçte Kayseri Çarşısı Mekansal Değişimi. Türk-İslam Medeniyeti Akademik Araştırmalar Dergisi, 9, 69-82.
497
Chapter 37 Comparative Bulgaria Houses and Traditional Ottoman Period Houses Within the Context of Common History, Culture and Identity in Bulgaria Aydanur YENEL INTRODUCTION Rumelia is a region through which the Ottoman Empire was opened to the West and it was effective during the cultural shift for nearly five hundred years. Historical heritage was created as a result of the coexistence and cultural exchange of the regional conditions in the Balkans with Ottoman culture. The establishment of a series of military and administrative centers by Ottomans in their first period in the Balkans, which constitutes the core of new towns, played a significant role in urbanization period. In the work of Prof. Dr. Nur Akın titled “Balkanlarda Osmanlı Dönemi Konutları Ottoman Residences in the Balkans” and also in the work of Prof. Dr. Doğan Kuban titled “Osmanlı Mimarisi/Ottoman Architecture” and its section titled “Konut Mimarisi/Residence Architecture”, the tradition of residence in the Balkan countries was examined holistically. This article aims to examine how the residences were formed turning of the physical environment created by the residence culture introduced to the region with Turkish tradition and domestic cultural combination to a functional structure. Similarities and differing points were comparatively examined on selected photographs and drawing examples with the epitomes either in Bulgaria or in Anatolia. These examples of civil architecture are dated back to the 18th. and the 19th.centuries. We feel as if we met the sincerity of typical Anatolian town when we are walking around in there. The Alleys give richer perspective to it (like Safranbolu, Kula, Odunpazarı etc). We observe that some traditions and habits, which are the basis of social forms observed in today’s Anatolia, are also identified in places in Balkan ethnography. The commonality ensuring easier adaptation between local peoples of Balkans and the people migrating from Anatolia creates a coexistence of local and cultural factors. Thus, the Balkans has played a significant role in the East-West cultural interaction, and the Balkan Peninsula has become a representative of this cultural exchange. OTTOMAN HISTORY IN BULGARIA Bulgarian architecture and associated Bulgarian culture have never lived isolatedly, without establishing communication with other architectures and cultures. This architectural culture belonged to the world created by the Byzantine culture in the Medieval Age. Later on, an intense cultural interaction occurred within the boundaries of Ottoman Empire. Influences of Western Europe and Russia got stronger after gaining
Assoc. Prof. Dr., Atılım Univrsity, Faculty of Arts Design and Architecture, Turkey
independence in 1878. The buildings then built by the architects from AustroHungarian Empire, France, Italy and Russia are today considered as a natural part of our national architecture and culture (Popov, 2004). The destiny of Bulgarians lasting throughout the history was to change from one culture to another and adapt the other cultures they faced to their own origin. In our millennial history, we have lived, several times, periods of exchange and dependence to primarily neighboring Byzantine, then as being a part of Ottoman and to Western Europe in nearly one and a half century. For the national historians, the indisputable precedence is cultural bond of Balkan created after spreading of Ottoman Empire in European lands. Are we ready to seek the results of the tension between the two civilizations based on ancient times in architectural truths? As a result of cultural exchange, new forms are introduced into construction practices, environmental designs get richer, and the style effects sweep towards the end; traditions change, skills improve, so many local diversity occurs in processing the strange one and adding something from yourself to it and selection of it. All of us contributed personally to the cultural phenomenon of the Balkans. The biggest change in the Medieval Bulgarian cities in the 15th.century is the transformation from the walled city to open bazaar/trade city. Standards, logic and lifestyle of Ottoman Empire were spread in the cities and they transformed into local centers. The intervention to the city life of the empery was felt definitely much more than to rural life and Islamic city type arose. However, in the southeast of Europe, it is predicted that the medieval residence tradition is protected with its primitive form which had been repeating for centuries and is expected to last for more than one and a half century. Recent historical researches compared so many data in the written depictions of the European travelers and those in the documents kept by kadi, which have been preserved until today, and revealed the view of the Bulgarian cities in the earliest period of the conquest: low-rise detached houses, blind facades seeing the street, incompetently-built wooden and clay masonry. In fact, as narrated by H. Dernşvam, the traveler, depicting the Sofia houses in the middle of the 16th century, even the residences belonging to wealthy people were built “as if it is like how everyone could build it”. Even the Istanbul residences of the 15th and 17th. century are composed of the same poor cottage for a European eye accustomed to a different city image in which social classification has already taken its place. In this period, Ottomans had neglected the form and ornaments of the house; this general attitude lasted up to the mid-17th.century. According to the European messengers passed through the “çapraz yol” (the road passing the Bulgaria diagonally), types of the houses inhabited by Muslims and Christians are the same. Similar opinion is seen in the writings of J.Bongars, a French scientist and diplomat, traveling the Bulgarian lands from Ruse to Edirne passing through Razgrad in 1585. But at the same time, there is no visible difference between the architectural standards of countryside and urban even if it is emphasized “being citizen” as a different social group, which is another phenomenon emerging in most of our lands, between the 15th and 17th centuries. In the Balkan example, the absence of the architectural vanity or the fact that the architectural quality was not improved conventionally were caused by the cultural regression and being under pressure as submissive side. Primitive and modest general construction practice was not able to trigger the production of masterly-built construction and traditional formations at the residence architecture in the cities, caused low quality architecture to last for a long time, and thus lost its greatness. Poor aesthetic appearance from the point 499
of European’s view had been overcome/surpassed in the Growth period of Ottoman Empire when then the selectivity and cultural meeting and deposition process started in contact region. After the mid-17th century, the visible change in the “showcase” of the Balkan city is regarded by the historians as the change of the social structure and logic of the Ottoman Empire. I can associate the emergence of the higher and more subtle residences especially with three nested cultural processes. Arabization of Ottomans, ever-growing Greek influence and appearance of the Western influences. According to historical sources, the change starting from the center is spreading to the Balkan cities: from Istanbul to Edirne and Selanik, then to Ohrid, Skopje and Plovdiv. The principles in tradition also change. A common visual taste the general criteria of which were established afterwards also develops: The urban house expanded, its plan became complicated, three-dimensional ornaments appeared and European styles were adopted step-by-step. In fact, being of European Medieval culturally and socially was got over with residence architecture even if it is late. Likewise, within the territories of the empire, architectural movements including typical residences of 19th century Bulgarian Renaissance we know well and appreciate arose and spread. The significance of Tsarigrad (the name we gave for Istanbul) which is the cultural center of the Empire and a meeting point for construction foreman-ship is great. At this very point, Ottoman architecture intertwines with the tradition of Byzantine supporting itself directly from the Eastern and Islamic culture. This is an architectural formation of cultural exchange of the new empire in the world arena. The traditions met after two hundred years later intermingled and began to become traditional by remaining less loyal to its origin (Ivanova, 2004). The Byzantine houses remained under the influence of Syria. These houses appeared in the north of Syria in the 5th and 6th centuries and still surviving (in Antakya, Gaziantep, Urfa, etc.) have 2 to 3 storeys and a large courtyard. In the residences of rich people, these can sometimes, although rare, be 8 to 9 storeys in Istanbul. The ground floor is haremlik (the section which belongs to women), and the upstairs selamlik (the section which belong to men). Now, there is no example of these houses in the capital city of Syria. However, we get this information from the miniatures and written documents belonging to the 11th and 12th centuries (Fig.1). The porticos in the yards draw the attention. The only example of civil building in Istanbul is the Palace of Tekfur in Edirnekapı. It belonged to the Emperor. We see that its outer surface was made from red brick and marble (in white). It has arched alcoves, oriels and windows. It is understood from its marks that once; it Figure 1. A miniature from had saddle roof covered with bricks. The floorings of the Tercüme-i Şakayık-ı th century rooms are covered with red bricks and marbles. The Numaniye, 17 walls are decorated with colorful pictures and mosaics. (Nakşî) (Kuban, 2007, 476) Due to the fact that the palace buildings were built with the addition of small parts or construction units side by side, they are not much featured in terms of construction style (Tuncer, 1980, 67). Arabic culture, which is more elegant started to infiltrate into Ottoman Empire just 500
after the caliphate had taken to it in 1550 year. Arabic culture has enriched with the taste, elegancy and nice artistic traditions of Late-Ancient Persians between the 8th and 9th centuries. The ships of Selim brought not only the caliph of Cairo but also nearly 2.000 master craftsmen, famous merchants and religious functionary to Istanbul; many well-educated Arabic bureaucrats were placed in government offices. Cultural level has risen so fast, because it was achieved with the people within Islam. In order to see the reflection of it onto the field of architecture, we have to look at the residences in Cairo, Damascus and Baghdad in caliphate period: Higher, multi-storey, lying beyond to the unplanned and narrow streets, strengthened with buttresses, whitewashed overhanging, wooden railing, which is a product of a fine workmanship and wooden doors decorated with large-headed nails. Large flamboyant saloons with niches and picturesque walls and ceilings decorate the houses of the wealthy people. Due to the fact that rare and expensive type of wood was used for these houses, wood carving was so perfect and subtle. As it is known from the literary sources and encyclopedic descriptions, a major part of these were transferred and adapted to the capital of Ottoman Empire by taking the Byzantine houses (overhanging upper floors with buttress) into consideration. The number of the Bulgarian merchants and builders in close relationship with the Arabic cities and architecture are not few. The residences having the same tectonic type (gradually supported overhanging) are also encountered in Bursa, in the Anatolian side of Empire. The architectural self-expression of Ottoman Turks is of Arabic origin; both interiors and exteriors of the houses can be clear examples of this. A limited Arabic influence takes place in urban residence analysis made within the context of the culture of the Balkans. Capital examples are the priority interaction sources for the rural areas. The most significant ones of these are the once sultan palaces (the last one of them is wooden Beylerbeyi Palace of Sultan Mahmut II in the beginning of 19th century) and summer houses owned by the rich in Bosporus as we know from gravures preserved up to the present. A. Protic recalls the similarity between the overhanging residences with buttress and semi-buttress, eaves, and pergola from the Bulgarian Renaissance and the residences in the large centers of endless empire. I can add to these the textile cities of Macedonia and Thessalia which gained economic importance by meeting textile needs of many European and Mediterranean customers in the region. The houses of Greek and Venetian merchants, which are wellpreserved up to the present, are located 17th and 18th centuries in Ambelakia, Kastoria, Kozani, Siyatis and Veria witnessed the bright growth period in the past. The earliest contacts with the urban cultures outside Bulgaria have been probably established by the Voynugans. They had lived in privileged sites of Rhodopes, in the flatland of Plovdiv, in the foothills of Balkan mountain range and in Pirenik. They constituted a group traveling a lot because of their responsibilities to the Sultan and carrying their impression about the world to homeland. Bulgarian merchants traveled first within the territories of the Empire, and then in the Europe. They also traveled to become a pilgrim. Chorbadzhiya (a title given to the person who merchandised in Bulgaria) developed self-confidence again and changed their statute in the public by traveling to the places important for Christians (first and foremost Jerusalem, and then Sinay and Aton - it is necessary to pass through Alexandria to arrive first two). “Pilgrim” had meant a nobleman title for Christian public in Ottoman Empire; and this title creates an identity for the accumulated wealth and welfare, and it necessitated to build a big and luxurious house. Pilgrims have significant contribution, which has not still considered 501
by historians, to the improvement of construction practice. But those who travel most, were a large number of hardworking and talented Bulgarian construction foremen striding through the whole empire with their subtle eyes and wit and skillful hands. These contacts and exchanges are definitely important for every cultural change. And these cultural changes find their literal expression in architecture. From the theoretical point of view, the typological “national” architecture formations between 18th and 19th centuries, and especially the culture and tradition meeting in Balkans are disputable. But, I am in the opinion that it would be appropriate to mention many alternatives of the architecture becoming public domain public as a productive result of their mutual cultural influence, changes and changeovers at the “contact zone”. Today, according to the substantial number of historians, direct influence of the East helped Balkans reveal their own synthesis. This synthesis is superficial, not holistic; it has not got a spiritual situation as in the Iberian Peninsula; it has been limited at first by the level of its lifestyle and customs. In the urban residence architecture and the residences of Bulgarian Renaissance, which is a product of late and brilliant emergence of this synthesis, an attractive combination of the new times with Medieval and orientalism with Europeanism is seen (Ivanova, 2004). OTTOMAN RESIDENCES IN BULGARIA Bulgarian territories were located in the center of the Balkans which was under the sovereignty of Ottoman Empire. Ottomans, on and after 1360s, annexed many Byzantine and Bulgarian cities in the eastern and central Thrace such as Sofia, Plovdiv (Philippoupolis), Stara Zagora, Yambol, and Karnobat (1362-89) for a period of about 500 years (Akın, 2001, 30). In Bulgarian cities, the process of emergence of a new culture in which the Ottoman component was also integrated was quite complicated and long-lasting (Akın, 2001, 32). The territories of today’s Bulgaria entered under the rule of Ottoman in the second half of 14th century. Upon its entrance under Turkish rule, the Muslim-Turkish population became majority in the region in a short period of time as a result of the Turkmen and Yoruk tribes forcedly moved from Anatolia to the various regions of Bulgaria. In the Balkans, Bulgaria is the region which first entered into and remained longest under Turkish rule. For this reason, in the Balkans, the most Turkish works were built in Bulgaria. According to Ekrem Hakkı Ayverdi, 3.339 Turkish architectural works were built in Bulgaria during the Turkish rule lasting for more than five centuries (Turan, İbrahimgil, 2004, 156-157). In the 15th century, Plovdiv was “a well-built city. It has a significant number of mosques, Turkish bathes, caravanserais”, as mentioned by B. de la Broquiere in his writings. H. Dernschwam, who visited the city in 16th century, mentions that this settlement surrounded by croplands and orchard, was well-maintained but no beautiful and magnificent Burgeois houses were encountered but he saw only small mosques and Turkish bathes as well as small craft shops and booths (Akın, 2001, 34). Especially the Bulgarian cities which were well-developed in trade relations and crafts gained importance in the 16th and 17th centuries and some of them played an active role as a center of Ottoman culture and architecture. There were some preOttoman settlements in Bulgaria which were revived with the Ottoman rule (such as Sofia, Plovdiv, Kyustendil) and some settlements which were newly-established (such as Tatar Pazardzhik, Nova Zagora, Kazanlik) or transformed from towns into cities by 502
Ottomans (such as Targovishte, Novi Pazar). With the promotion of crafts and trade in cities, the number of the commercial buildings such as the shops, workshops, inns, covered bazaars, etc. in the down town gradually increased. It is seen that the Bulgarian settlements were getting a new look. The cities such as Veliko Tarnovo (Fig.2) are good examples of this (Akın, 2001, 33). In Lom, which transformed into a city in the late 17th century and was a significant market city in the countryside in the 19th century, the kaleto Figure 2. Old urban fabric in Veliko (castle) neighborhood and down town constituted two significant cores of the city. Tarnovo (Akın, 2001, 33). In this century, C. Alexander, a traveler, depicted the settlements as a “settlement with more than 400 houses about 300 of which are Turkish houses and with a population of 1700 people 1300 of which are Muslim”. He also mentions that there are 4 mosques and 1 church in the city. The experienced Muslim-Turkish master builders, who were known in Bulgarian cities for centuries, significantly contributed to the formation of this urban look having common points. When it comes to the last period of Ottoman Empire in the Balkans and especially in the 19th century, these crafts and mastership were taken over and carried on by the Bulgarians. Sofia is a city known for its mosques, imarets, caravanserais, covered bazaars and Turkish baths. The merchants' house adds richness to the settlements as it is a large trading city. In the early 19th century, “houses nestled in big gardens” were mentioned when depicting Sofia. These urban characteristics are possible to be seen in the centers in the various regions of Bulgaria in the same century. For example, the examples preserving Ottoman look are encountered in Smolyan city and its surroundings while the same qualitative characteristics can be observed in Kızane Tekkesi and the urban texture in its surrounding near Tragoviste in the northeast or in Lom in the Northwest Bulgaria (Akın, 2001, 34). The cultural identity for the wealthy Bulgarians changed over time. Islamization of the Christians was greater in the cities having ethnic diversity relative to the rural regions. The preservation of the ethnicity in the cities was on individual basis, was not a social problem and this very freedom of choice required social activities in urban society. But in the economic and urban culture of the Ottoman Empire, the awareness of the Bulgarians was awaken and rose with the successful integration of the Bulgarians in the 19th century. They endeavored to develop identity as Bulgarian or even European under the Greek rule from the view of Ottoman religion, tried to define its own moral space and succeeded. In the multinational empire in which now everybody had equal rights, the Bulgarian merchant and chorbadji were demanding customers able to pay but the creative, smart and skillful Bulgarian construction foreman inherently and emotively looked for and found the synthesis of compelling and conflicting identity of Orthodox city-dweller in Tanzimat Era. This is proven by the residences in Plovdiv, Koprivshtitsa, Kotel, Melnik and Sozopol (Apolnia) and in short all around Bulgaria, each of which are perfect architectural wonder (İvanova, 2004) (Fig.3). The houses owned by Pachov and Tsintsarov in Melnik are important examples with their plastic 503
characteristics and rich details of picturesque ornament (Tsaneva, 1978:.46-47) (Fig. 4).
Figure 3. Mansions from Melnik (Akın, 2001, 47).
As in Anatolia, the civil architecture examples in Bulgaria, which could survive until today, date back to the 18th century at the earliest. Therefore, to draw an analogy between the Bulgarian residence architecture and Ottoman residence tradition, only the examples remaining from the 18th and 19th centuries can be discussed. As known, many houses remained from especially the period called as Bulgarian Renaissance (Akın, 2001, 37). This architectural movement caused complicated relationships which emerged in the late 17th century and lasted until 19th century. The ideas and emotions which then would lead the movement called as “Bulgarian National Revival” emerged in the early 18th century. The new Figure 4. Pashov's Bulgarian architecture (Bulgarian National Revival) emerged house in Melnik and evolves in economic and social conditions, and the (Akın, 2001, 47). monumental structures such as urban settlement systems were built in this period. The new structures architecturally feature urban houses of “National Revival Period”. Residences were concentrated on in “the Architecture of National Revival”. The plans, facade arrangements, architectural concepts, volume distribution of the houses and material selection vary richly. The housing clusters built in National Revival Period were preserved until today in Plovdiv, Veliko Tarnova, Melnik, Tryavna, Zheravna, Kotel, Nessebar, Sozopol, Koprivshtitsa etc. (Stamov, 1978, 44-45) (Fig. 5, 6).
Figure 5. A konak in Veliko Tarnovo (Akın, 2001, 46).
Figure 6. A konak in Koprivshtitsa (Akın, 2001, 45).
Mansions: The majority of the houses and mansions located in the region called Stari Grad or Old City are mostly 18th- and 19th-century Turkish houses. All mansions are located in the city. The fact that there are separate sections in the houses for men and women and construction of each room to accommodate a family are evidences that
504
they were built according to living habits of a Turkish family (Turan, İbrahimgil, 2004, 182). As already underlined, the dissociation of the central management and generation of influential local powers had their influences on the civil architectural features of the Bulgarian cities even if they were still under the hegemony of Ottoman Empire after 18th century and on. Assuming managerial authorities under the rank of “beg” and “pasha” during 18th and 19th centuries, local tradesman and notables had constructed mansions in Plovdiv and other cities of Bulgaria (Akın, 2001, 45) (Fig. 7). Being the richest region of the empire, the Balkans produced beautiful examples of Ottoman residence architecture in the last period (Kuban, 2007, 496). The geometric form specific to wooden carcass of the front façade of the house is dominant. The variations are limited (Kuban, 2007, 487) (Fig. 8).
Figure 7. Mansions in Plovdiv (Yenel, 2014)
Figure 8. Conventional street panorama of Plovdiv (Yenel, 2014)
The façade of Turkish house is a non-assertive expression of the social culture that was adopted by almost all builders. All houses, whether big or small, two-storey or seldom three-storey houses were all designed with similar ratios in regard to wellknown rules. Such rules are amazedly close to each other in Kütahya, Kula, Plovdiv, Thessaloniki, Amasya and Safranbolu (Kuban, 2007, 487) (Fig. 9, 10, 11, 12).
Figure 9. An old city configuration from Safranbolu (Yenel, 2014).
Figure 10. Street panorama of from historical street panorama, Manisa. Wooden houses Süleymaniye and Zeyrek, İstanbul
505
Figure 11. Mansion views from Safranbolu (Yenel, 2014).
Figure 12. Traditional Street views from Safranbolu (Yenel, 2014).
With such apparent typological features, whose final form was, I presume, given by the beginning of 16th century, this house is most popular within the region under absolute political and cultural domination of the Ottoman culture. It may be that the same house had drawn the final boundaries of its area of Ottoman domination, where Ottoman synthesis was in its purest form that may provide the criteria for its cultural originality. And by this way, we may as well determine the differences in the regional culture between Kütahya, Plovdiv and Diyarbakir (Kuban, 2007, 488). If we summarize the subject matter by also including the physical structure of the cities, we may conclude that the Turks generally settled in old cities were in general connected to the Iran’s Turkistan’s and Islam’s resettlement traditions rather than Anatolian sources (Sözen, 1980, 91). Having spread along Anatolian terrain after the second half of 11th century, Turks had generated a type of house that might be defined as Turkish House, by adopting existing houses that were formed by the experience that acquired in the course of hundreds of years in regard to their own perspectives, by introducing several modifications in response to the prevailing conditions, rather than creating new settlement centers. Having evolved in the course of time that last about five hundred years, the type of such house was also adopted by various nations within the vast boundaries of Ottoman Empire; however its specific features had emerged in Anatolia. While assuming dominant position upon influencing local residence architecture within several regions of today’s Yugoslavia, Bulgaria and Greece in the northeast after 15th and 16th centuries, it fell short in spreading within the regions beyond Anatolia as it was in the Balkans, because of the deep-rooted Arabian House 506
tradition in the east and south. Meanwhile 17th and 18th centuries had been in a way the period characterized by powerful Turkish house enough to widespread through and exert influences on Middle Eastern and East European architectures. The architecture in Hımış Technique that revived as a second generation with its main spreading area falling between shores of Anatolia and Orta Yayla, extending to the west from within Sivas vicinity, from Inner Aegean to north sides of Taurus, even encountered in the Balkans sloping over its defined belt. The houses constructed under this technique had been implemented in a vast area rather confining within specific area and formed common features of Turkish house. In fact the house formation of the capital Istanbulsetting some western influences aside-might is interpreted as developed further and elaborated stage of this tradition (Sözen, 1980, 92). The Anatolian house heritage is more diversified and rich than those in any other region of the world (Fig. 9) Local structural traditions and forms of residences continued their inner development also in Ottoman era in the course of settlement history starting from Çatalhöyük that emerged in Near east countries that performed their first agricultural revolution. In addition to all these old house styles, we see that the residence tradition based on the wood had emerged in Anatolia, which we at least determined the use of the similar architectural elements from rare descriptions from older era, even if we fell short in finding examples dating back to 17th century. Furthermore, we also know that such tradition had created extraordinary residence typology in Central and Western Anatolian Regions, Balkans and Istanbul in its course of contemporary formation, ranging from small houses through palace size, which was the most unique and dominant creation of residence architecture and Ottoman culture after 17th century. We also determine the coincidence of that style with the styles in other region geographically. We see that such wooden tradition had been influenced by Western styles particularly in 19th century, but always preserving its Ottoman identity. Such a residence tradition whose basic elements of its design included in Near east architectural tradition and named as “Türk Hayatlı Ev”i-‘Turkish House with Porch’-is considered as one of the most important revelation of Ottoman cultural synthesis after Anatolian Turkmen in addition to space structures complete with big domes. There are other structural typologies in addition to such residence type in all these regions. But “Hayatlı Ev” and its derivatives are an important contribution of Ottoman structural culture into world history of residence (Kuban, 2007, 469). Ottoman residence architecture completes with wooden carcass represents the roofed house. It reveals great deal of flexibility and plasticity thanks to the wooden structure. To that end, the Ottoman era created unique roofed residence style, so called “Hayatlı Ev” (Kuban, 2007, 470) (Fig.13).
a
b
c
d
Figure 13. Hayatlı ev. Conceptual analysis of basic plan types: (a) Geometric diagram (bcd) Samples (First floor layouts) (Kuban, 2007, 471), pattern design and unit functional to planning of Turkish House (Akın, 2001, 52). 507
When Hayatlı Ev typology is analyzed, it will be seen that it is generated via the synthesis of more than one architectural motive. The living and cultural conditions that reveal such synthesis are also known. Multi-originality can be seen in the layout of the structure, as well as included in complex structural system. The wooden structural carcass on top of the stone foundation, adobe stuffing and tile-covered wooden roof are stable construction elements of Hayatlı Ev. With all these general features, Hayatlı Ev can be seen as one of the phenomena that expresses best the synthesis the Ottoman culture formed onto its syncretic root. The core setup of Hayatlı Ev layout is consisted of more than one element and some of never changing principles direct the design of the layout. Built by using various complex materials with a construction system consisted of wooden carcass, the house has two-storeys. The layout typology is defined by the first floor. Two different rooms located around an iwan combined with an open gallery, called “Hayat” - Porch, Veranda - is the basic construct of the layout. “The iwan” is an Islamic architectural motif known since the Antiquity and gained prime importance in Islamic architecture in particular. Used since Sassanians, it is encountered in Sassanid palaces, Abbasid palaces, Ghaznavid palaces, Middle Asia houses and Fustat houses. It is one of the basic elements of Madrasah layout. The layout consisted of two rooms around an iwan and opening to outdoor area or gallery is known as “beyt” in Arabic since Abbasid palaces, in the meaning of “home” in Arabic. It might be concluded that this word had a root dating back to Late Bronze Age, as it is keen in Hittite Bit-hilani combination. In another word, “beyt” is the basic unit of a house design. Its evolution as a dominant element into Anatolian rural home is interesting but not surprising. It is, however, difficult to determine all stages of the transformation mechanism. Keeping long-lasting past within new settlement areas of rural society of Anatolia as a “relic” is an important cultural problem. First floor is the prestige i.e., “piano nobile” of the house. The most sublime of the room is called as “chief room”. The first floor is located a few steps higher than the ground. Garden façade of both floors forms two-storey stoa. The forms of inner stairs of the house aren’t worked out in detail. It is included in the hayat as a mean for combining the floors. The first floor layout doesn’t follow the form of the second floor. It is planned freely due to functional reasons. In some cases, low intermediate floors between first and second floors are included as a protection against cold in winter. In some cases, slight elevation of the first floor provides semi-basement floor serves inclusion of stable or highloft, suitable for requirements of the agricultural lifestyle. The service areas of such structures, i.e., toilet and kitchen might be located in the house garden or yard. In well-off houses, washing floor (bathing cubicle-gusülhane) is included within alcove. It is considered that such habit appeared at the later stages. It is difficult to conclude that such houses had evolved within urban settlement areas. “Hayatlı Ev” had been a residence design created by the agricultural society in the rural areas (Kuban, 2007, 471) (Fig. 14). Hayatlı Ev should be evolved in a rural environment of Anatolia. On the other hand, these parameters aren’t sufficient to describe such a residence type. This is because; Ottoman society is consisted of Muslim people in the course of the evolution of such a residence type. The status of women and self-endorsed type of living mandated planning suitable for an inward oriented daily life. This required that the living style inside the house to be reflected as an inner yard. In another word, hayat and yard or garden is integrated semi-enclosed and open living quarters. Such living style in 508
the open area is agricultural in essence and calls for the people used to lead such a life. It might be concluded that there is a functional relation between settlement of Turkmens within the villages or outskirts of the urban walls together with their animals and design of Hayatlı Ev.
Figure 14. Bandımzade House, Kütahya. The basic plot of an Hayatlı Ev belonging to 19th century. (a) Layout plan, (b) First floor plan, (c) Floor plan, (d) Basement floor plan, Street view (L. Eser) (Kuban, 2007, 472).
Those who witnessed and tested how such a residence type organically corresponded to the agricultural society that lived until first half of twentieth century with all their features may perceive the one-to-one symbiosis between living and structure, even if via analogy, since no single example remained from the centuries when such typology first emerged. It may be conclude that this existed within local traditions with their exclusive elements during previous periods; however the wooden carcass gained a different physiognomy in Turkmen living and in semi-rural areas. It is possible to consider, on the basis of these observations, there was perhaps two-hundredyear incubation period between nomadism and sedentation of Turkmens with “Hayatlı Ev”. Such a house tradition that assumed its final form in western regions of the empire might be considered as a revelation of settlement process of Turkish nomads. It is an historical phenomenon worth interpretation, in that line of development, to considering one-to-one correspondence between almost universal architectural and very old motive specific to Islam world and Turkmens rural living conditions. This is because, it is difficult to comment that the existing stylistic order present in Abbasid palaces or Fustat and Middle Asian houses are revelation of similar lifestyle. Although rudimentary social life falls short in contributing to the architecture in a significant level and single-space shelters appeared under primitive economies under any climate and conditions, it should be accepted that it is possible to use a stylistic order for diverse functions. In fact, a structure complete with a yard could be used for diverse functions including madrasah, hospital, caravansary, residence, quarters, etc. In this context, in can be concluded that the functionality is used as an exaggeration. Provided that the structural limits are not pushed, familiar/common or symbolic stylistic orders were selected on cultural arguments or may be living styles are adopted accordingly. In the context of Hayatlı Ev, there is an ongoing dispute to call such a house typology 509
either as “Ottoman” or “Turkish”. The “Ottoman” attribute is insufficient due to reasons as follows: Anything in Ottoman sovereignty might be considered as specific to Ottoman. Algeria House, Egypt House, Bagdad House, Belgrade House, Dobruca House, Mitilini House (Kuban, 2007, 473) or Rhodian House might be compiled under Ottoman House. But their historical presence didn’t begin with Ottoman. They are not identical to it. Meanwhile, wooden Hayatlı Ev didn’t exist before Ottoman era. It emerged under the social conditions of Anatolian Turkmen society in Ottoman era and its development had been within such regions which had explicit relations with Turks in Ottoman history. Interesting residence architecture developed in Istanbul between 18th and 19th centuries is extremely different version of Hayatlı Ev tradition modified under Western influences. Although it is difficult to call it a new language, it can be said that it was a strong dialect. “Hayatlı Ev” is differentiated with its open galleria and stable features of its rooms. It is an explicit representation of an agricultural past. But Istanbul city house complete with middle hall upon removal of hayat was different in terms of both function and style, leaving its fundamental basis aside. In the home typologies emerged under new living conditions, all components of the society’s past pursue their living in diverse ratios. The thesis about origin generally focuses on elements which are known or assumed to have existed in the past. When the authors match to late Ottoman residence with the term Hayatlı Ev, they establish relations with Asian tradition distinguished with a central layout. The good-old fashion of attaching anything to Nomad and Middle East also tried to connect the synthesis emerged in Anatolia to the Steppe, as if there was only one type of residence in Ottoman era. All components of Hayatlı Ev in fact were present in three-thousand-year of history of Near Asia (Kuban, 2007, 474). Considering the architecture focusing on the purpose of meeting real needs of the society, the social structure determining all these requirements would directly be influential to the architectural formation, let alone the houses. The lack of great differences in terms of the styles between the residences in Ottoman society when compared with European society distinguished with the palaces of European aristocracy and people residences, i.e., replication of the mansions of affluent people and modest people’s houses in terms of spatial organizations might be explained the readiness of transition between various strata of that society. When considered in terms of spatial organization and design form, the basic feature is that the room is taken as the main unit for the purpose of describing the most suitable style. When the replication, dimensioning, realizing an arrangement on behalf of multi-purpose utilization are considered, the room is able to conform to all necessary conditions. The room has been equipped as a space complete with various functions, like sitting, eating, sleeping and even washing in its furtherance, and therefore, it conforms to present Multi-Purpose Use specific to up-to-date architecture. Whether single-storey or multi-storey arrangement, Turkish house originally appears as a dominant planning approach consisted of an open iwan between two rooms, accompanied within the eaves in front of them. As the main unit of spatial organization of Turkish house, the room features following properties: The layout is in square or near-square form. Lack of right angle formed between parcel borders in general and therefore, the extensions were formed to prevent warps to reflect into the room and thus preserve the square plan. The extensions were introduced to let dwellers establish -street or garden- relations within the residence, as well as for intimacy with the nature. The reason why the room was 510
designed as square or close to square was that the reinforcements were made with static elements located to close or adjacent to the walls. The only deviation from the square form was that the corners where the entry was located were chamfered up to the dowry entry. Formed in forty-five degree angles, these chamfers were considered as an ornament surface, in addition to conformity to principle of Conforming to Way of Living; one of the main principles of Turkish house design, by forming inception sensation for inside of room (Sözen, 1980, 93). Of two important units of spatial organization of Turkish house, one was iwan and other is the so-called “Hayat” unit, which was also named as apron, yard, “sergah”, “hanay”, “divanhane”, “çağnışır”, etc. The iwan has been a motif frequently used from houses to religious buildings. Such semi-open areas bounded from three sides with a covering on the top opened to the hayat. In some cases they directly opened to the yard, depending on the local customs. One of the leading purposes of using iwan in houses was to introduce a design feature providing shadowy and cool living quarter in an open area. Although having various other names depending on the regions, it is commonly used as hayat or sofa, and it wasn’t only designed as a means of passage or a particular purpose. It can be described as connection area between indoor and outdoor spaces in general. It may also include the sections, so called throne, köşk (an alcove having a sofa to sit on and watch outside), etc., decorated according to the type of use. It formed principal area of use and focal point of the house depending on the climatic conditions. Household production activities as a whole were performed in line with Turkish society’s features with her dominant agricultural production (Sözen, 1980, 94). Setting the stylistic origin aside, however, it may be concluded that there are similarities between living in a Hayatlı Ev and Yurt (=living place, tent). Considering the independence and refurbishment of rooms of a house and Yurt it is possible to drive the relations in between. The people lived in Hayatlı Ev as lived in a Yurt, close to the nature meshed with it and that was quite natural for nomad Turkmen in his/her first settlement. Besides, there are other residential traditions in rural and agricultural lives, which combined human being with nature. Consisted of a single volume, a cottage might be included in the notion of tent. The best explanation in this regard is historical development of Türk Hayatlı Evi. Two elements played important role in formation of residence styles under diverse cultural ambient of the ancient world. One of them is stoa (portico, columnar gallery); the other is enclosed volume with one face close to outdoor (iwan in Iran, protas in Greece, tablinum in Rome). The architecture arrangements where iwan formed a gallery or yard with a stoa have introduced extraordinary microclimatic possibilities and aesthetic expansion for all Neareast and Mediterranean environment. Hitite’s Hilani, Tarma House of Mesopotamis complete with iwan or tarma around inner yard, i.e., houses with galleria, Lebanon and Syrian houses consisted of rooms arranged along a gallery with an access via ladders, Talar in Iranian architecture, Arabic-Hittite Beyt, stoa yards of churches, monasteries, masques, madrasahs, palacek…. All these widespread applications mark both functional excellences in addition to the figurativeness of status (Fig. 15). Achievement of all these within Türk Hayatlı Evi to a figurative and aesthetic status was realized in a symbiotic process. The elements of Hayatlı Ev shared by innumerable architecture tradition complete with its specific size and ratios have been acquired in the course of time within daily life. First floor gallerias encountered in Mesopotamia and Syria were narrow in the form of corridors. The hayat of Turkish house is a bigger living area than 511
the rooms where daily lives are spent. The house lacks stylistic yard we see in Arabic countries. It opens to the garden. The yard in Arabic house was removed in Turkish house and the word is used to tell the big hall in front of the rooms. That wasn’t a simple change in the word. The yard was an element of a city house. On the other hand, it was the towns and villages when of the Turkmen rural area where Hayatlı Ev was formed (Kuban, 2007, 474). Besides, Turkmen village settlements preferred the slopes. The slope wasn’t topography suitable for the yard. Therefore, the architecture type developed by Turkmens after their settlement was suitable to the general topographical structure of the settlement regions (Kuban, 2007, 475). While discussing the question of origin, the presence of the pre-Islam tradition of houses with iwan and middle hall in the Middle Asia should not be ignored. There, the iwan and the rooms on both sides of it open to a central hall covered with a dome. In Anatolia, this tradition of housing influenced zawiyah and madrasah plan more than residential buildings. Though, it can be said that the pattern consisting of an iwan with two rooms on both sides of it and belonging to Iranian world constitutes the origin of the typology of numerous buildings in a vast geography from the Central Asia to the Mediterranean as an element of prototype plan. The structure types created by the combinations of the covered room, yard and portico attached in front of this pattern and the sizes and coverings thereof constituted primary architectural design typologies for many periods of architectural style. It is obvious that Turks came to the Byzantine setting and met not only the native people of it but also its technique and structures.
Figure 15. Tarma Houses, Iraq (Reuther) (Kuban, 2007, 475).
However, our knowledge of the housing of Byzantine period is very limited and there is no archaeological data showing that these were influential in the development of the Türk Hayatlı Evi. However, it is difficult to say they were not although it is difficult to say that they were, too. This is because the example of house remained from Turkish period of 13th to 16th century is encountered only in the abandoned Peçin ruins. But it is impossible to forge a link between them and the mentioned Hayatlı Ev. The Turkish era has not re-discovered anything structurally and constructively in Anatolia other than the formal origin originated from this long-lasting tradition of house design. The local Anatolian architecture featured constructive elements such as rubble foundation, bonding timber and mud wall reinforced with studs as revealed by the excavation of Beycesultan digs from the 4th millennium B.C. The reconstructions of house of Hittite period by Naumann are not different from the adobe houses still currently encountered in Anatolia. In Amasya visited by Busbecq in 1554, the houses were adobe and had flat roof. Then again, adobe was a building material then being used in Istanbul of 16th century. The wooden-framed and mud-filled building construction on rubble foundation, which is used in the Hayatlı Ev should be considered 512
as a phase of the ancient Anatolian tradition (Kuban, 2007, 475). A very clear majority of Anatolian and Balkan houses remained from Ottoman era were built in the 19th century (Kuban, 2007, 476). The Hayatlı Ev scheme emerged in a cultural setting related to Syria and Iraq in the 15th or 16th century. Halil Ağa Evi (Fig. 16) dated back to 1640 as identified by Eldem in Mudanya is wooden-framed, mudfilled with an iwan. It is seen that rear front is also wooden here. Beginning from the mid-17th century or even maybe in older times, the facades of the porch evolved into their conventional forms. Here, the wooden portico of the two-floor porch, the handrail of the first floor, the two-floor windows on the facades of the rooms and the plaster interiors of the upper windows defines the architectural lines of the building. Doubtlessly, the spatial effect here is not on these elements but on the design of the two-floor portico. When having a look at the examples from the 17th century, it was not easy for the house to get rid of the stone frame surrounding it from three sides. The rise of the rubble walls up to the stoa differentiates these houses from the houses with outbuildings Figure 16. Halil Agha House, protruding on every side and with many vents, the Mudanya (Above). Beyoğlu development of which was observed in the houses House, Kula (Bottom) (S. H. we see in the 18th and 19th century. Eldem) (Kuban, 2007, 477) As a later example of them, the Beyoğlu Evi (Fig, 16) in Kula is a typical application of it with its mezzanine, and all rooms opening to the porch (Kuban, 2007, 477). Instead of the Hayatlı Ev that has been developed its own history for rural life in Anatolia, it is a central planning urban residence which has been arised from Central Asia and Iran (Kuban, 2007, 490) (Fig. 17-18) “Turkish House” which is described by S.H.Eldem settled, developed and lived about 500 years in Anatolia and Rumeli in old expression Ottoman Empire’s occupied borders, in the south and the east, Turkish house hasn't gone far away from Anatolia to Caucasus and Iraq. Arabic house which has been extended from Caucasus and Iraq to Iran affected Syria, has demarcated to affected area of Turkish house (Eldem, 1968, 10) Turkish house firstly had found its own special character and it had been developed with a process in Anatolia. After that, it had taken hold in several European areas with Ottoman borders' extension. In Bulgaria, Greece, former Yugoslavia and Albania, an architecture has been composed which shows big similarities with traditional houses of Anatolia and Anatolian town in terms of both single construction and towns from 15th century (Akın, 2001, 127). If we re dating the oldest versions of the house which has been composed with similar chart of process but also has been constructed with different areas, different construction methods and different materials, as Celal Esad Arseven said “Anywhere in Turkey, nobody could fall with a three centuries old house”. So, it is obviously hard to explore our dwelling history dating one or two centuries ago (Çobancaoğlu, 1998, 10). The locals' all day pass in outside 513
because of the production conditions. This life style affected establishment places. In the future plan types, in the big houses, there is any changing of plan process, there is just a variety in carpentry.
Figure 18. Mansion of Güpgüoglu, Kayseri. Plan (Necibe Çakıroğlu) (Kuban, 2007, 494)
Figure 17. (Above) İzgördü House, Urfa (G. Akın), (Middle) Tüteklikli house plan, Harran (G. Akın), (Bottom)Baghdad House(Reuther) (Kuban, 2007, 492)
Existing of the closed economy system and limited transportation opportunities had required using local construction materials; both employer and employee had constructed the house with life conditions and their close relationship between each other (Çobancaoğlu, 1998, 44)If we classify Turkish house's plan design that we mentioned its general principles, we can see their four master plan types and enriched or different type architectural factors like mansion, iwan and stairs (Sözen, 1980, 95). Although there are rooms which fulfill the requirement of each family member who live in the house, “the sofa” is the place that often brings people together. At the beginning, the sofa which appeared to provide circulation of passing between rooms turned into a key factor for plan chart of Turkish house because special corners shows itself like sitting, resting, meeting room in time. According to the sofa’s position, shape and connection between other rooms, developmental stages of Turkish house (Eruzun, 1989, 69) can be analyzed.
1. Stage of Plan Type without Sofa: Houses without sofa have composes the first stage of Turkish house after its tent process. These plan charts emerge/appear as templates to connect the rooms with each other (Eruzun, 89, 69). This type is the simplest type and room or rooms had been settled together and composed the house. The corridor which provide the connection of the rooms, acquired the function of balcony to upstairs. Mostly it had been used in hot climate areas (Eldem 1968, 25) (Sözen, 1980, 95). 2. Stage of Plan Type with Outer Sofa: Houses with outer (open) sofa follows stage of houses without sofa. According to plan chart’s type in the covered common 514
area of utilization, as one side should stay open, it is covered with rooms, or either two or three sides can stay open. When we come to this stage/in this stage, houses with outer sofas had yield their place to houses with inner sofas especially in north and south regions, although they had been very common in almost all regions of Anatolia regardless of weather conditions (Eruzun, 1989, 69). The room orders have been connected to each other with a sofa. The first pattern, the rooms were aligned to only one side of the sofa. Next, a köşk had been added to a corner of the sofa and after that köşk turned into a room and plan type had developed in a form of “L” and “U” with additions to the corners of the sofa (Eldem, 1968, 25). Houses with outer sofa the rooms of which were lined side by side can be divided into three categories: 1. Houses with corner sofa having two lines of rooms, 2. Houses with rooms which are lined in u-shape and 3. Houses with outer sofa surrounding 3 sides of the rooms (Sözen, 1980, 95) (Fig.19).
Figure 19. Progress chart which is connected to outer sofa of Turkish house plan type (Akın, 2001, 38)
According to the chart, there are examples of semi-open places in the first group which is divided into two. The other group includes examples which are formed by adding closed place/places in front of or both in front of or behind the main closed place. In this outer sofa type, the semi-open place of a new places added in front of the single room has the qualities of a veranda and is generally called “çardak (arbour)”. Arbour is an important element in almost all country despite of the regional variation in Bulgarian civil architecture in this type. The chart is in figure 20, and S.H.Eldem’s chart of outer room examples of Turkish house, shares similarities with Çardaklı type in terms of development (Fig. 19, Eldem, 1984, 26). Researchers gather the Bulgarian civil architecture examples in two main groups. One of them is earlier asymmetric open/outer sofa and the other is symmetric middle sofa types which had been designed in the second half of 19th century with great examples. These two groups’ progress chart shows a big difference. For example, R. Aguelova, develops open/outer sofa group’s chart with added closed or semi open places to this place which got Figure 20. Open symmetric and asymmetric inspired from undifferentiated/ house’s progress chart in several regions of Bulgaria (Akın, 2001, 38) multifunctional single place (Fig. 20). There is an important difference, Iwan factor which enriched the outer sofa examples of 515
Turkish house couldn’t be encountered (Fig. 21-Eldem, 1984, 26) in Bulgarian House type with arbour. However, usage of iwan is an important feature in the Near East’s both monumental architecture and civil architecture of pre-islamic period which continues its existence since then D. Kuban underlines the significance iwan of in traditional Turkish civil architecture and says “two rooms and one iwan” emphasize main unit of plan typology of Turkish house. In Bulgarian houses, the place among the two rooms opened to arbour, turns into another third room, or stair place instead of iwan (Fig. 22) (Akın, 2001, 37). In this open house type, Arbour’s location indicates its proportion, place organization of house, shape and façade. The arbour is located to face the view in the parcel on which the building is constructed. As known, outer sofa is the most important place in Turkish house. Both spacious and covered, it is a place of the house which brightens and connects the house to the outside.
Figure 21. Progress chart of Turkish house plan types’outer sofa-iwan examples (Akın, 2001, 38)
Figure 22. Stairs among two rooms opened to çardak (Akın, 2001, 38)
Figure 23. House with Arbour in Koprivstitsa (Akın, 2001, 39)
Figure 24.House with Çardak/outer sofa (Akın, 2001, 39)
The arbour’s size and place in agricultural composition can show differences. The arbour has a characteristic of an open veranda which lies across the main façade in some examples (Fig. 23, 24). In some cases, arbour takes part in just a small part of the façade (Fig. 25, 26).
Thus, changes in this type of sofa are located generally in the long side of the façade facing the yard. West Anatolia has recently saved many structure examples of 18th-19th centuries which has shown different types of Hayatlı Ev typology. Many territories like Hacı Ömer House in Tire, Güllüoğlu House in Uşak, Şemaki House in Yenişehir, Mansion of Mehmet Ali Aga in Datça and Bucak, Antalya, Alanya, Sivrihisar; are the towns in which these beautiful examples are created. This tradition may be the most important dwelling type in 17th and 18th centuries which had been commonly protected in Bursa, Edirne and Istanbul. In Balkans, especially in areas which are more influenced than Turkey, Rodop area in Bulgaria, Karaferia and 516
Ambelikia in Greece, Shkodra in Albenia has good examples of Hayatlı Ev variations. House charts in order to correspond to the civic conditions, as in Safranbolu for example, when many stylistic properties became developed to more closed forms, in Balkan territories, they proved the same structural cultural existence (Kuban, 2007, 481).
Figure 25, 26. House with arbour in Koprivstitsa (Akın, 2001, 39)
The writers who work on domestic architecture of Bulgarian Renaissance Period, in early period of asymmetric plan type, the rooms which have been added arbour’s both sides caused to they conclude arbour turned into an inner and then middle sofa type. E. Momirov has mentioned that between the first asymmetric examples and the last examples of symmetric examples, a passage which had been included contracted frontage half open Hayat example (Fig. 27, 28).
Figure 27. Progress from Early period of Asymmetric Plan chart to late period of Symmetric plan chart in Bulgaria (Akın, 2001, 48)
Figure 28. Upstairs plan of Raikov House in Triavna (Akın, 2001, 48)
The other step of this example is middle sofa type. Instead of the outer sofa located in long front, it becomes closer to middle which is an area turned into the plan. The outer sofa becomes closer middle sofa plan type’s features (Fig. 29). In front of this sofa can be thought as a minimized arbour and as a balcony which is directly supplied a connection with nature in upstairs (Fig. 30), or köşk which is 517
squeezed from plan in a steeply way (Fig. 31), or similar with utilization of middle sofa iwan which back wall open to yard (Fig. 31), or it can be finished with oriel (Fig. 32, 33). At least one room open to arbour and generally it took a reception room function which was ordered at the back of arbour and as the room numbers increase in plan order.
Figure 30. House with a balcony has a pergola in its backyard, in Melnik (Akın, 2001, 49).
Figure 29. Progress of inner and outer sofa plan type in Bulgaria traditional domestic architecture (Akın, 2001, 49)
Figure 31. Dr. Mirkovis’House in Sliven and floor plan of Pritomanova House in Ruse (Akın, 2001, 50)
This room is guestroom function of traditional Turkish house. And also, as seen in the chart in page 20, it is emphasized with its location and oven almost every examples. D. Kuban writes if there is only one oven in Turkish house, it is obviously settled in the guestroom (Akın, 2001, 39) (Fig. 33). Plan chart of arbour with added köşk or köşks becomes enriched (Fig. 34). This Situation is prevalent for traditional Turkish House. Köşks which are separated from sofa’s floor with one or several steps in outer sofa, as the focal point of sofa is 518
important. As in Çardaklı Bulgarian house, rooms are ordered along the outer sofa in traditional Anatolian house with outer sofa and sometimes rooms come both sides and make the central sofa in the middle. The rooms, in traditional Turkish houses, compose units which are opened to outer sofa directly. So that, the sofa becomes a most colorful place which opened to view of upstairs and it takes a connection of all rooms function. Also, as said above, iwan motif which takes the place of room in the line, sofa is tried to enrich and change for more living area, in addition to köşk or köşks at times (Akın, 2001, 40)
Figure 32. Floor plan of Pulev House in Karlovo (Akın, 2001, 50)
Figure 33. Floor plan of Pasov House (Akın, 2001, 51) House Plan with arbour/outer sofa köşk in Koprivstitsa (Akın, 2001, 40)
Figure 34. House with outer sofa and köşk in Koprivstitsa (Akın, 2001, 40) House with outer sofa in Plovdiv (Yenel, 2014)
But there is another order in rooms which is opened to sofa in Bulgarian house. At least, the room which takes guestroom function in response to connection with directly, other rooms connects with each other in other examples, opened to pergola with one or two rooms. Aforesaid features all can be observed with E.Momirov’s another improved chart (Fig. 35) (Akın, 2001, 40). This type of house with outer sofa which has common features such as asymmetric and front division, wide eaves, the light/shadow contrasts between soundproof walls and the pergola, spread over every region of the country from the Black Sea to Middle 519
to the Central and Southern Bulgaria and to the western borders. The variations of this type of house vary depending on the natural data and materials as well as on socioeconomic factors. As seen in pictures 20 and 36, differences of the organization of plan can be seen in the organization, size and equipment of the place and thus in the massive and frontal appearance of the structure appearance with organization of plan, dimension and equipment of place while the main scheme remains unchanged (Akın, 2001, 41).
Figure 35. Development plan of house with outer sofa in Bulgaria (Akın, 2001, 40)
To give an example for this type of plan from the various regions of the country, two houses in Teteven city in the Central Bulgaria, show big similarities with the Turkish house with outer sofa, consisting of an upper floor consisting of the rooms opening directly or indirectly to a pergola equipped with köşks above a blind stone ground floor formed by two or three service areas (Fig. 36).
Figure 36. House with two arbour in Middle Bulgario, Teteven (Akın, 2001, 42)
Figure 37. Plan of upper floor of House with arbour in Central Bulgaria (Akın, 2001, 42)
In another example from the Central Bulgaria, these common features can be seen (Akın, 2001, 41) (Fig. 37, 38). The House of Pangalov family in Smolyan is an authentic example of Rhodope Architecture. The house of Kyorpecv can be enlisted as an important example for its silhouette overlooking the historical neighborhood in Kotel. The economic development experienced in Bulgaria in the second quarter of 19th century created the conditions necessary for certain layers of population to become wealthy. The results of this phenomenon were observed, most clearly, in Plovdiv, which is a buoyant trade center (Tsaneva, 1978, 46-47). 520
In Koprivstitsa, which is located in the same region, the outer sofa and the enriched examples of it are densely seen. A similar type of spatial organization can be seen at a typical Rhodope house in South Bulgaria (Akın, 2001, 41). The ground floor, which opens to the yard, includes service areas such as storeroom, animal shelter etc., while the upper floor reflects the plan scheme of the traditional Turkish house with its pergola enriched with two small köşks, hearths, closets and rooms opening directly to the pergola (Fig. 37). The most important feature of Rhodope House is the emphasis of köşks (Fig. 38).
Figure 38. Plans of upper floors with köşks of Rhodope Houses (Akın, 2001, 42)
In Turkey, the houses with open hayat and with iwan even in the urban fabric, which are generally of rural characteristic, are the products of a more intense urban environment than Anatolia in the residence architecture of Rumelia influenced by Istanbul and Anatolia. Most of them date back to the second half of the 19th century. As a result, it is under the domination of the plans which are less open to the outside, as in Istanbul. Besides, the climates of these regions are harsher than that of the West Anatolia. Iwan motif is used less in these regions. There are many examples of Hayatlı Ev in Rumelia. In highlands of Rhodope, there is a köşk room upon the hayat, which is called as “çardak” (pergola) (Akın, 1984, 42). Birgi Çakırağa Mansion and these houses are the products of the same typological design. In Ambelekia, Schwartz House belonged to a rich Australian merchant. It has a Hayat and Iwan. Above the hayat, there is a köşk room (Moutsopoulos, 1975) (Kuban, 2007, 495). Even if there are not many examples remained, 18th century is a time in which Hayatlı ev reaches typologically to its climax and shows its great examples. With the schematic approach coming to an end and the free usage of architectural terminology the end of schematic approach and the free usage of architectural terminology took place in the same period. Çakırağa Mansion in Birgi is the most important typological example which remained from that period. The Basement and mezzanine floor, as in the previous century, are surrounded by blind walls on its three sides. But, in main floor at the room side, the entire floor effused a little. Among all these houses Çakırağa Mansion in Birgi (Fig. 39, 40, 41) is a splendid example presented by Hayatlı Ev as a spatial design and under its own conditions, has such great aesthetic qualities that it can compete with the greatest architectural buildings created in Ottoman period (Kuban, 2007, 477). Çakırağa Mansion in Birgi represents the stage in which a house’s rural qualities have not been destroyed yet and the motif of “Hayat” has been shaped with its most developed spatial characteristics. Most cities of West Anatolia most of which are of ancient origin and have the architetural memoirs of the first Turkish beyliks, such as Bergama, Tire, Kula, Birgi, Kütahya are the historical focal points describing the first cultural relations of Migrant Turks. Most important building from Ottoman Period is the 521
Çakırağa Mansion, which was built in the late 18th century and the early 19th century (Kuban, 2007, 478). Construction Year: the late 18th century, Plan Order: With outer sofa and three-storey. Service units located in the lower floor are connected with garden and stony ground. The winter rooms in the mezzanines which are not much high, open to outer sofa. There are two summer rooms, the largest room, the small room, and iwan and small iwans in the upstairs. In the middle of the U-shaped sofa there is a köşk protruding towards the garden (Çobancıoğlu, 1998, 156) (Fig. 39).
Figure 39. Çakırağa Mansion, Birgi, Plan (out sofa), Ödemiş-İzmir. Plan: 1. Summer room, 2. Open iwan, 3. Winter room (main room), 4. İwan, 5. Sofa, 6. Sofa terrace, 7. Room, 8. Köşk, 9. Toilet (Kuban, 2007, 478).
Figure 40. Çakırağa Mansion, Birgi, Section-Façade, Ödemiş-İzmir (M.S.Ü. Restoration A.B.D. Archive-EXAM. 18) Çobancaoğlu, 1998, 158).
Figure 41. Çakırağa Mansion, Birgi, views of interior space (Kuban, 2007, 478-480)
This mansion is one of the most authentic and educatory example of the house style called Turkish Hayatlı Ev. It is possible to see all life aspects, aesthetic trends, and limits of expectations from architecture of a society’s culture in such kind of building. The pattern of the Hayatlı Ev formed by two rooms with an iwan in between and a porch in front of them has been preserved. The requirement of a new room was met by two rooms attached to the outside of the porch and a ‘U’ plan was obtained (Fig. 39). With the new rooms added, new iwans formed between the rooms. Some of them have sofas, like main iwan, built during the construction. The building does not extend but expands toward the yard. The new rooms are accessed from the porch. But the porch extends to the yard by an annex and a toilet is added to the end of this sofa. The staircase was attached to the outer edge of the porch as in the houses with simpler plan (Kuban, Doğan, 2007, 478) and an open kiosk was added to the porch. All service areas of the building are on the ground floor. There is a mezzanine between the ground floor and first floor. The porch facade of Çakırağa Konağı has an exciting spatial richness which no other tradition of housing has. In the entrance façade in which a massive stone wall is emphasized with a single entrance door, the rooms and iwan are protruding in three corbels towards the street on the upper floor (Fig. 40). A wall of each hearth room 522
was covered by stone due to the need of chimney. Wooden eaved roof is a characteristic of these buildings. Eighteenth century is a period in which painting ornament was popular. Çakırağa Konağı has painting ornament embellished with the characteristic motives of the period both within the building and on entrance façade (Fig. 41). It is out of question to address this house in terms of construction excellence, material richness and fineness. This is because these are not a product of a developed urban environment but the rural environment buildings of agricultural culture. Neither there is an axis shift nor a symmetry study of architectural design. But they exhibit the rural origin, resilience, infinite possibilities of addition and expansion, structural quality and picturesque as well as the spatial and texture richness of the concept of housing from which they originate (Kuban, 2007, 481). The architecture of the Turkish house has common characteristics in terms of function and usage even though it varies depending on the regions. The simplest form of the house is the buildings most of which are formed by one-storey and two rooms with an open front space with columns in front of it. The houses in the towns and cities were commonly built as two-storey. The elements such as room, iwan (space between the rooms), yard or a gallery opening to the garden, or a sofa were used in all plans from the simplest to the most complex ones to meet the different needs of function in various arrangements (Çobancaoğlu, 1998, 9). In these houses, the lower floors were arranged as animal shelters or storage areas; human life takes place in upper floors. Accordingly, circulation sustained outdoors and service areas were covered and became a part of the building. With the introduction of the space which is open in the front and on the sides and usually called as ‘Hayat/Porch’, ‘Çardak/Pergola’ into the structure of the building, the first examples of the houses with sofa emerged (Eruzun, 1989, 69). The lower floor of a house was mainly formed by service areas serving to the daily life, such as hayloft, storeroom and kitchen. The rooms on the upper floors were the units in which people live, dine and sleep etc. The room required a service area in its close proximity and these two elements proliferated and ended up with the “authentic” plan solutions. The class distinction between the houses was not overdone and no big mass or function difference were created even though the number of the rooms increased (Çobancaoğlu, 1998, 10). Another thing common in the Bulgarian houses with an outdoor sofa and the traditional Turkish house is the importance attached to yard in both. The ground floors of the houses open directly to the yard surrounded by high stone walls rather than opening to the street (Fig. 42-45). The yard which constitutes an interface between the ground floor and street is an important space to which the pergola also looks. It is seen that on occasion, the service areas such as stable, barn etc. are located here independent from the main building. Almost all kind of activity was mostly carried out in the yard and the annexed buildings opening to it. These yards usually having an irregular shape and small size were developed to meet all needs. As in the yards of the traditional Turkish houses, these areas are the integral part of the house with their fountains and wells particularly in summer (Akın, 2001, 43). 3. The Phase of Inner Sofa Plan Type: The houses with inner sofa is the phase during which a common use area secured by covering the open face of the outer sofa by windows and being placed between the rooms so that maximum two sides of it can receive sunlight. These are mostly encountered in Marmara Region although it was 523
applied in all parts of the Northern Anatolia from the East to the West (Eruzun, 1989, 69).
Figure 42, 43. Houses with high stone wall, Koprivshtitsa (Akın, 2001, 43)
Figure 44, 45. High yard walls, Koprivshtitsa (Akın, 2001, 44)
Figure 46. Upper floor plan of a tower type house in the mountainous regions of Bulgaria (Akın, 2001, 52)
The plan schemes of upper floor of the tower type house called Konak/mansion and seen in the Rhodopes reminds of inner sofa plan type with its four rooms developed around a central space in which the stairway is located, as well, and protruding through corbels (Fig. 46). The said plan scheme is actually simple and readable. The symmetric repetition of the unit consisting of two rooms with an iwan in between and one room in each corner are essential (Fig. 13) (Kuban, 1982, 199) (Kuban, 2007, 471).
Both sides of the sofa are surrounded by rows of room. Inner sofa is expanded from place to place with the addition of the side sofa, iwan or stairway sofa. In the 19th century, stairway sent to the far end of the sofa and three-flight of stairs were built, which fully covered there. The interaction between the rooms got easier and the proximity to the garden decreased (Eldem, 1968, 25). Inner Sofa Houses can be divided into the following groups: two-sided inner sofa houses; two-sided, inner sofahouse with iwan; one-sided inner sofa houses (Sözen, 1980, 95) (Fig. 47).
524
Figure 47. Floor plans of Netkovich House in Plovdiv (Akın, 2001, 51) Figure 48. Interior of Netkovich House in Plovdiv (Serdar Uzun) (URL 1).
In this cultural area, the concept of house emerged in a functional status in which the urban remained to have rural characteristics with the level of agricultural production and the woman and family gained recognition within the social structure of Islam. It can be said that in its emergence, the image of a house didn’t appear out of the blue, rather it way a product of a long-lasting period of development (Kuban, 2007, 488). In these types of plans, the number of the rooms on the living floor and the functional differentiation increase relative to the outer sofa examples. It is possible to see asymmetrical examples in the types with inner sofa, which can be described as the phase previous from the type with central sofa (Akın, 2001, 48) (Fig. 49-51).
Figure 49. Amcazade Hüseyin Paşa Waterside, Istanbul
Central plan typology found a vast usage in the divanhane (large living room / audience sofa) of the great buildings. The oldest dated example of it is the divanhane of Amcazade Hüseyin Paşa Waterside in Anadoluhisarı. The central sofa with iwan, which defines the geometry here, did not develope in the tradition of Hayatlı Ev. It should be addressed within many palace traditions such as Bağdat and Revan köşks of Topkapi Palace. Moreover, Kavafyan House from the 18th century in Istanbul can be considered 525
as one of the early examples of the transformation from the Hayatlı Ev (Kuban, 2007, 488).
Figure 50. Amcazade Hüseyin Paşa Waterside, Istanbul Divanhane (Restituted by: Orhan Çakmakçıoğlu) (Kuban, 2007, 488489)
Figure 51. Amcazade Hüseyin Paşa Waterside, Istanbul (Restituted by: Doğan Kuban, Drawn by: Abdullah Sırt, MİM Design) (Kuban, 2007, 489)
4. The Phase of Central Sofa Plan Type: Houses with central sofa is the last phase of the evolution of the Turkish house. It is a solution created by leaving the shared space in the middle of the rooms with no link to the outer facade. Houses with central sofa became widespread in the north of the Anatolia, particularly in Istanbul (Eruzun, 1989, 69). The sofa is central to the house with the rows of room surrounding it. An empty space in the form of iwan was left between the rows of room to ensure that the sofa is bright. The vast number of the iwans opening to the sofa enriched this type of building. This type of plan was used commonly in large cities, particularly in Istanbul (Eldem, 1968, 25). This group can be examined under three categories: The verticaledged central sofa; houses with central sofa with beveled corners; houses with oval central sofa (Sözen, 1980, 95). Ottomans, in its relations starting with Western Europe, produced, at all hands, a house architecture which can compete with the centers such as Istanbul and Edirne particularly from 1840s. The scheme used in these examples is the central sofa plan (Akın, 2001, 45). While the Hayatlı Ev with open porch continued to be built (as can be seen in the houses of Bursa Cumalıkazık village), an introversion which, in general, started or became popular in the 19th century and cleared off the continuity of the half-open porch throughout the house, and a resulting centralization, or rather a trend of biaxiality, emerged. One of the reasons for it is the natural consequence of the phenomenon of urbanization. In an intensifying urban environment, gardens and yards became smaller, houses started to come side by side and the freedom of women to use the yard within the porch, high walls or garden was restricted. The entry, which was from the yard in the rural setting, is now from the street with the houses arranged in rows on the street. This caused relocation of the stairways of the porch, which are typically on yard front of the porch in the traditional Hayatlı Ev plan. The large half-open spaces have lost their function since some practices of rural setting disappeared in urban setting. In the beginning, the core plan of the Hayatlı Ev was a development which indicates centralization with the rooms added to the porch. It was not difficult for it to transform into a symmetric plan developed on two perpendicular axes. The second reason is that the house plans were influenced by Europe. Axiality, symmetry and central sofa are the 526
principles guiding to the central design. Besides, within the tradition of Asian-based houses with central hall, there are many applications of central planned mansions and köşks beginning with Çinili Köşk of Ottoman palace. It can be said that this created a trend of centralization in the large residences particularly in Istanbul. As can be seen below, it may be more appropriate to define it a trend of axiality rather than a total centralization (Kuban, 2007, 482). We see a characteristic example of the evolution into a covered porch in the plan of Sipahi Ömer Ağa House in Izmit, which dates back to the 18th century (Fig. 52). From a formal point of view, this plan scheme is not different from a four-iwan Central Asian house with a central sofa. It is possible to consider this as two Hayatlı Evs positioned face to face. In a last abstraction, it can be said to consist of the rooms filling the corners of a cruciform sofa. If only the formal observations would be sufficient, it is possible to find a church of a cruciform plan drawn in a square here. However, the original feature of this house is that the two large hearth rooms on the main floor (piano nobile), which protrude over the lower floor, and the iwan in-between are opening to a sofa, which serves as a porch. In this plan, the porch changes into a covered sofal with two rooms put on the open sides of it. The house plans which had not yet become a cliché and typologically definite has emerged in the beginning of the 19th century (Kuban, 2007, 483). Figure 52. Sipahi Ömer Ağa House, Izmit. Plan (S.H.Eldem) (Kuban, 2007, 483) It has been seen after the second half of the 19th century that the classical Hayatlı Ev has undergone planimetric changes even if the basic elements of appearance in the tradition of the urban wooden buildings were preserved. Such a local tradition is kept alive in Safranbolu houses (Fig. 53) (Kuban, 2007, 483). In the Safranbolu houses, which are the best-preserved examples of the urban landscape created by the Anatolian Turkish wooden house tradition, the change undergone by the house design is a mezzanine introduced in-between the blind stone ground floor and the upper floor, or ‘piano nobile’. In Safranbolu houses, this mezzanine is not composed of a sofa and winter room but planned in a fairly detailed way although it is very lower. The porch, which was planned as a central sofa on the upper floors, (which is called as ‘çardak’ in Safranbolu), is two-storey (Fig. 54) and a köşk looking to the garden is built on a higher level generally over the stairway when the stairway starting from the ground floor reaches up to the upper floor. In these houses, a stony space through which the ground floor is entered is named as ‘hayat’. The iwan, which opens to the pergola, may not exist in all plans. Safranbolu houses gain an authentic physiognomy particularly with their corbels through which the upper floors gradually overhang on the lower floors. In Ankara houses, it can be said that the porch has transformed into a more covered sofa. The same is observed in Bursa, as well.
527
Figure 53. Plans of House with outer sofa from Safranbolu Houses, Safranbolu-Karabük (Günay, 1981, 70, 72, 73)
Figure 54. Plans of House with central sofa from Safranbolu Houses, Safranbolu-Karabük (Günay, 1981, 74, 75) 528
In Eskisehir, the Hayatlı Ev continued to be built but the central sofa has become a basic element in designing the house plan. In the 19th century, one of the cities proving that the urban houses did not change much in the regions preserving its rural character is Kütahya. The ‘hayat’ continues its existence in the plan of a great majority of the houses examined by L. Eser (Kuban, 2007, 483). Certain features as mentioned by some authors to emerge with the houses with inner sofa add a more urban touch to this type of house as distinct from the house with outer sofa. For example, significant differences of use are seen in the ground floors of such houses compared to the ground floors of plans with pergola and these spaces change into workshops or storerooms for the goods manufactured. If the house is on the way to the downtown, one of these spaces may be used as a shop. Thus, these houses integrated with trade bring innovation to the traditional character of street while it introduces a new type of house, which is rare in Anatolia, to the Ottoman housing architecture. This closed type of house exhibits a scheme which reflects the increasing cultural requirements of Bulgarian bourgeoisie, which forms the new social class of the period. S. H. Eldem emphasizes that the fact that the type of plan with central sofa permits suitable distribution of spaces and rich compositions of plans played an important role in the development of the type of plan with central sofa in the cities and the choice of it for use in the large mansions (Akın, 2001, 52). As mentioned above, these houses Figure 55. Development scheme of Plovdiv- were designed based on the principle of type closed symmetric houses (Akın, 2001, two vertical symmetry axes (Fig. 55) 58) (Akın, 2001, 55).
Figure 56. Development scheme of the examples of the types with central sofa of Turkish house plans (Akın, 2001, 59) 529
The number, size, ornaments of the rooms surrounding the central sofa, which is in the nature of a reception room, vary depending on the presence and taste of the owners and the situation of the parcel on which the house is located. A similar type of plan scheme is also observed in the typology developed by S. H. Eldem for the examples with central sofa of the Turkish house plan types. In the examples of this type of houses in Istanbul and Anatolia which remained from the same period it is seen that the rooms are arranged in an order so as to create different alternatives in the sofa and around it in the center (Fig. 56-Eldem, 1968, 9) (Akın, 2001, 59). The great diversity of the personal interpretation and description of this main scheme provided numerous different possibilities of solution. D. Kuban emphasized that these axial compositions seen in the köşks, waterfront residences, mansions, summer palaces and palaces in Istanbul are not characteristic to the tradition of old Turkish house with asymmetrical plan. He points out that the symmetry axis does not play a guiding role in the design of the traditional houses, for example, the stairway or the most important room of the house should not necessarily be on the axis, and therefore, not only the Ottoman housing tradition but also the axial (which means relating to a axis) compositions of the European palaces may be influential on these plans (Akın, 2001, 60). In this type of plan, it is possible to observe in many examples in both Bulgaria and Istanbul in the same period that the central hall has taken various shapes from square; round to elliptic over time and the upper floor was emphasized as the main space of the house enriched by iwans. While, in the beginning, the hall took an irregular octagonal shape with their corners beveled (Fig. 57, 58), or roundness was tried to express only with the ceiling (Fig. 59), beveled corners were ensured to be fully round or elliptical by being gradually rounded. E. Momirov mentions that two definite symmetry axes were created in the houses with central sofa built after 1846 and these axes intersect just in the middle of sofa (Fig. 60) (Akın, 2001, 53).
Figure 57. The floor plans of the Muskoya’s House in Nessebar and Küçüğün House (Akın, 2001, 53)
Figure 58. A house with central sofa in Bulgaria (Akın, 2001, 53)
Figure 59. Kablekov House, Koprivshtitsa (Akın, 2001, 54)
530
The large and rich-looking Plovdiv house which was designed to respond to the increasing cultural and spiritual needs of the city’s people was formed under these circumstances. Symmetric plan scheme, an elaborate distribution of spaces, rich ornaments in walls, ceiling and facades are the most distinct features of a Plovdiv house. The best examples of symmetrically-designed Plovdiv Fig. 60. Examples of central sofas of the houses House are the houses owned by and Lyoutov in dated back to the second half of the 19th century Oslckov Koprivshtitsa. in Plovdiv (Akın, 2001, 54) The house owned by Oslekov has a two-column door and a rich decoration consisting of frescos and woodworking. And the house of Lyoutov family was decorated with a facade of baroque style and with ‘frescos’ in the ‘European style’ niches, walls and ceilings. A definite symmetry, the way of working on plastic shapes outside the building, the interior richness of colour and detail were expressly exhibited in the houses owned by Ivan Koyoumdjioglou or Lamartine (Fig. 61) (Tsaneva, 1978, 46-47). S. H. Eldem indicates that the elliptic sofas started to be applied particularly in Istanbul as from about 1800s and commonly used by the mid-19th century. Numerous houses may be mentioned as the examples of the rich examples of this type in Bulgaria: Lamartine House in Plovdiv (Fig. 61);
Figure 61. The House of G. Mawridi or Lamartine in Plovdiv (Akın, 2001, 55) (Photo: Yenel, 2014).
In addition, the most developed examples of the symmetric Plovdiv house are the houses of Koyoumdjiogyou (Figure 62) and Gueorguiadi (Fig. 63), which were built by lladji Gucorgui, the master builder, in Plovdiv during the “Bulgarian Renaissance”. The house of Koyoumdjioglou is one of the best examples of not only the Plovdiv house but also the architecture of “National Revival Period”. The floor plan is one of the most developed examples of Plovdiv house and has a dual symmetry axis. In this building, the mastership in the arrangement of the interiors cannot be ignored.
531
Figure 62. Kuyumcuoğlu House in Plovdiv (Akın, 2001, 56) (Photo: Yenel, 2014)
But the most important features of the building are, doubtlessly, the dynamism expressed as “saw tooth” on the facade looking towards the east and the triple baroque pediment on the portico on the facade looking towards the west. This building is a real masterpiece of the Bulgarian Renaissance Architecture. The architecture of “National Revival” created two hundred years ago is very close to the spirit of the Bulgarian people. This style which is still liked today is an inexhaustible source of inspiration for the contemporary creators (Tsaneva, 1978, 46-47).
Figure 63. Georgiyadi House in Plovdiv (Akın, 2001, 57) (Photo: Yenel, 2014)
The most important characteristic of these houses is their central sofa surrounded by rooms and enriched with two or three iwans and the distinct symmetry axes emphasized by the stairway going up to this floor (Fig. 64, 65).
Figure 64. Gidikov House in Plovdiv (Akın, 2001, 58)
Figure 65. The symmetry axis emphasized in the houses with central sofa in Bulgaria (Akın, 2001, 58)
Two basic types are seen in the urban houses of Istanbul and the region influenced by it. The first and most common one is the houses with central sofa, called “karnıyarık”. In these houses, a rectangular sofa parallel to the long axis of this building opens to two sides all along the house between the room groups on both sides. But this 532
opening is not a half-open gallery anymore. This typology is one of the most common housing typologies in all regions from the Balkans to the Central Anatolia in the second half of the 19th century and in the early 20th century.
Figure 66. Köçeoğlu Waterside, Istanbul. Plan (S. H. Eldem) (Kuban, 2007, 484)
The waterfront houses of the Bosphorus that we consider to carry on the traditional wooden architecture consist of elements exhibiting the “karnıyarık” typology in larger compositions. The waterfront houses built in the Bosphorus, which is a settlement most preferred by the wealthy and the cream of the society, are the influential architectural compositions of the Turkish house, which evolved in the large city environment of the 19th century but ending the house tradition by owning many traditional features and motives. One of the most famous waterfront houses built in the 18th century was Köçeoğlu Yalısı in Bebek (Fig. 66).
This waterfront house plan has interesting characteristics: In the plan basically formed by two karnıyarık scheme put side by side, a central volume was created from the central sofa of one of the karnıyarıks by putting two columns in front of each iwans like a central planned volume. In this section, apart from the rooms on the corners of the sofa, another two-room flat with a hall is passed from the landing through a passage. This application exhibits the great resilience in Turkish House planning. Another example of the masonry bathrooms added to the harem sections can be seen in this waterfront house. The elliptic skylights seen in the buildings of the 18th century disappeared in the repaired or renovated buildings in the second half of the 19th century (Kuban, 2007, 484). The two-sofa house construct the harem (the portion of a house reserved for women) and selamlik (the portion of a house reserved for men) sections of which are separated, as can be seen in the plans of Yasinci Waterside (Fig. 67) built in the late 18th century is one of the karnıyarık typology applications most commonly seen Figure 67. Yasinci Waterside, Istanbul. in the large waterfront houses of the late 18th century and the early 19th century. The features such as the entrance from the side of the large bedding closets with the broken corners of the rooms and the head windows in the rooms of upper floor are the arrangements evidencing the lasting tradition of Hayatlı Ev. The fact that the rooms were designed as independent units is obvious from the presence of the many similar 533
size rooms in the same location (Kuban, 2007, 484). Saffet Paşa Waterside (Fig. 68) which was built in Kanlica in the last quarter of the 19th century is another example of the karniyarik typology in large residences. One side of the plan formed by the combination of the two karniyarik type houses, in which the service areas were relocated to the ground floor and to the center, is harem and the other side of it is selamlik. There are many large rooms opening to the garden and sea in the corners of the large sofas and on the corridors connecting both sides. Again, the rooms are independent. There is no pass from one to another. All have couches/divans. They have large bedding closets but no hearth (Kuban, 2007, 484). This is because heating is ensured by stoves. The house fully opens to the sea and garden. Selamlik is entered from the ground floor under a corbel. The upper floor is gone up by a stairway larger than its stony ground. Particularly the sea front is very lively with the large corbels on the mutules and the rooms protruding on the edges (Kuban, 2007, 485). The second house typology applied rather in the large mansions and residences is called With Central Sofa or Cruciform Planned. These plans can be defined as transforming the core Hayatlı Ev with central sofa to a cruciform, sometimes elliptic or rarely round central volume by putting it on both sides of an axis. Nisbetiye Köşkü (Fig. 69) remained from the period of Selim III is one of the purest examples of the central planned applications with elliptic central sofa.
Figure 68. Saffet Paşa Waterside, Istanbul
Figure 69. Nispetiye Köşk, Istanbul (S. H. Eldem) (Kuban, 2007, 485)
There are applications enabling different variations generally between the central plan and karniyarık. Büyük Hasip Paşa Waterside (Fig. 70) in Beylerbey, Sadullah Paşa Waterside (Fig. 71) in Çengelköy are the known examples (Kuban, 2007, 485). Within the Ambelekia, Figure 70. Hasip Paşa Waterside, Beylerbeyi. Karaferye houses, some examples Central sofa, 19th century style (MİM Design) sometimes having a köşk room are (Kuban, 2007, 485) encountered. It is seen that these houses the stairways of which are on the garden side of the porch have the same plans with the houses in the Western Anatolia. The houses we see in Safranbolu are also found Bulgaria as well (Akın, 2001, pg.47). There are many examples of “karniyarik”, which is the most important house typology of Istanbul and Anatolia after the second half of the 19th century, in Plovdiv and Karlovo, Bulgaria and 534
in Thessaly, Siyatista, Kastoria, Veria and Ambelakia. We see that the houses with elliptic central sofa as seen in the large buildings such as Hasip Paşa Waterside (Fig. 70) in the first half of the 19th century in Istanbul, were carried to the Balkans and commonly used in Plovdiv houses (Akın, 2001, 55) (Kuban, 2007, 495).
Figure 71. Sadullah Paşa Waterside, Çengelköy, İstanbul
Wooden Turkish housing tradition underwent major changes in the recent large urban residences in the 19th century. But it has not forgotten its formal origin. Wooden materials, framework or shutters, corbels, bay windows in the exterior architecture and sofas, large bedding cabinets, engraved ceilings, the sofas which are isolated from the air and light from the outer world in the interiors are used all the way as the elements adding character to the design (Kuban, 2007, 485) (Fig. 72)
Figure 72. Hadi Bey Waterside, Kandilli, Üsküdar, Istanbul
There are very different variations of Hayatlı Ev typology in Bosnia and Albania. Porch continues to be an important planning element under the name of “çardak”. For example, in Shkoder, there are houses in which the typical elements such as iwan, porch and outer stairway are used (Strazimiri, Nallbani, Ceka, 1973, figure 120). The elements of exterior architecture such as proportions, the long bracket supports carrying the eaves may make the cities such as Berat and Argiri look like an Anatolian city (Kuban, 2007, 496). 535
Creating a very dynamic composition with their corbels, whether their facades are symmetrical or not, protruding on one or two floors and giving the street a very impressive look with this feature, these houses (Fig. 73,74) present axial (Fig. 75,76) and rhythmic connections and gradation, which is completely a rule of Baroque architecture. There is also Baroque tendency in massive formation (Akın, 2001, 61)
Figure 73. A house from Koprivshtitsa (Akın, 2001, 60)
Figure 74. A group of houses from Melnik (Akın, 2001, 61)
Figure 75, 76. A museum house and its details in Koprivshtitsa (Akın, 2001, 61)
For example, it is typical that the entrance is designed as portico being moved up with a few stairs on both sides (Fig. 77) (Akın, 2001, 61).
Figure 77. Entrance facade of Kablekov House, Koprivshtitsa (Akın, 2001, pg.61)
Fig. 78. Kablekov House in Koprivshtitsa (Akın, 2001, 60)
Besides, undulation of overhanging in the horizontal axis and eaves in the vertical axis is a Baroque feature making the facade to gain new characteristic (Fig. 63-76, 77, 78). S.H. Eldem touches on this by saying that the eaves’ action is a feature being encountered mostly in Istanbul in Turkey and said but, although this eave action held restrained in Istanbul, this motive caused loose moulding actions and gave a great feature to this type of house. This motif was very popular in Thrace and particularly in Eastern Rumelia and became an identification mark for the most Bulgarian houses built in the 19th century (Akın, 2001, 61). Indeed, curvilinear formation was densely used even in the patio doors of the lateperiod Bulgarian houses (Fig. 79, 80, 81, 82) (Akın, 2001, 62).
536
Figure 79. Sofa doors in Plovdiv (Yenel, 2014)
Figure 81. A street in Plovdiv. Curvilinear pediment in patio door (Yenel, 2014)
Figure 80. A house in Plovdiv. Enterence of Patio and barok undulation in eaves of middle sofa (Akun, 2001, 64)
Figure 82. Plovdiv. Curvilinear pediment in patio door (Yenel, 2014)
However, this formal richness conveyed from the interiors to the facade and street in the late-period wealthy houses in Bulgaria is a reflection of the intensifying relationships with the Europe and is in harmony with the spatial and massive pursuit of movement in the Ottoman tradition in terms of residence architecture. Hence, many other examples continuing the traditional formation in Bulgaria in the same period has a plastic effect which is not second to the Baroque featured facade motions (Fig.83, 84, 85) (Akın, 2001, 62).
Figure 83. A street in Plovdiv (Akın, 2001, 65)
Fig. 84. Traditional massive formation in a mansion in Melnik (Akın, 2001, 65).
The residence architecture of the Rumelia regions the effect of which is directly seen on Istanbul and Edirne is not different from that in Anatolia in terms of not only the plan construct but also in the interior and exterior details of the building except for the contents of the pictures of the masters of painted decoration particularly in the houses of Christians. Moreover, were probably Christian the masters of painted decoration in Anatolia were probably christian as well. The head windows, corbels, 537
mutules, eaves in exterior architecture, the large closets for bedding, hearths, terraces, stairways and handrails in the interior architecture, and Baroque door arches, bellied ceilings, studdings, shortly all elements of a shared culture of residence are similar in certain regions of Anatolia and Rumelia. However, in spite of all its similarities, there are local differences in plans. There is no conception of independent room in Bulgarian houses. Rooms are not connected with each other because no iwan is used (Fig. 86). Usage of sofa is more limited. Porch turned into a gallery substituting for a large place. House architecture in the cities where the influence of Istanbul is mostly seen such as Skopje, Bitola and Ohrid make different residence profile in spite of the ongoing existence of many elements originated from Anatolia (Kuban, 2007, 496).
Figure 85. A house having an effective massive formation in Plovdiv (Akın, 2001, pg.65)
Figure 86. Kuyumcuoğlu House View of Inner Place in Plovdiv (Photo: Yenel, 2014)
The influence of Istanbul and Anatolian Hayatlı Ev tradition is seen in the dictionary of residence structure used in Rumelia. In Greek, “Hayati” for the hayat porch, “sahnissi” for şahnişin-a word of Persian origin, which means oriel, “fouroussia” for furuş, a word of Arabic origin, which means mutule, “satsaki” for eaves, çatma (tsatma) in Veria houses, direk (derekia) -column, kuşaklama (koussaklama) -bonding, and taban (tanbania) -bottom, payanda (payantes -buttress in terms of structure, in short all words used in wooden construction technology were originated from Turkish. In Bulgaria, there are words such as yüklük (ukluk), köşk, tırabzan (tarbazon), başlık (baaşlak) yasmak (yoşmak), minder (minderia) (56-Stamov, 1971). In Bosnia, the words such as sergen (sergeni), ocak (ocaklıca), divanhane (divanhane) were used(Kuban, 2007, 496). Inner decorations of houses in Bulgaria are intense. Intense geometrical shapes add dynamism to places (Akın, 2001, 66) (Fig. 87, 88).
Figure 87. Ceiling of ground and upper floor, Banker Arie House in Samokov (Akın, 2001) 538
Figure 88. Ceiling with intense decoration, Kardopoulo House in Melnik (Akın, 2001, 66). Decorated ceilings in Plovdiv (Photo: Yenel, 2014)
As in traditional Ottoman house, ceilings also contain intense and demanding decorations (Akın, 2001, 66) (Fig. 89, 90, 91).
Figure 89. Ceiling plans of basement, ground and normal floor, Safranbolu House
Figure 90. Interior of Safranbolu House
Figure 91. Decorated ceilings, Safranbolu House (Photo: Yenel, 2014)
539
The major ornaments in the rooms other than the ones in the ceilings are observed in the plaster decorations of the hearths(Fig. 92, 93), the doors of the wooden closets/large closets for bedding surrounding them, in the engravings of the niches called alafanga, and sometimes in the separating wooden fences in the room and the plaster-decorated skylights. The furniture in the rooms was generally designed locally and the sofas called minder were arranged so that they surround the room by one, two or three edges. However, imaginary nature views existed in the rooms of some big mansions reflecting the influence of Istanbul of the period. These wall paintings in the Bulgarian mansions, which depict the examples taken from the Turkish monumental architecture or containing Istanbul or Anatolia landscapes, gave place to the landscapes reflecting the more local and Western monumental examples such as churches and castles particularly in the second half of and late 19th century(Akın, 2001, 66).
Figure 92. Kuyumcuoglu House, Plovdiv (Photo: Yenel, 2014)
Figure 93. Sadullah Paşa Yalısı, Cengelköy, Istanbul
In the houses built after the 18th century, the ceiling decorations with lathes and roses, plaster hearths, the windows with Rococo ornaments show that the Ottoman residence culture extended up to there and used by being interpreted according to the local traditions (Kuban, 2007, 496). CONCLUSION There are three-volume works for Plovdiv houses. 1. Gertrude Rudloff-Hille und Otto Rudloff, Bulletin de del’İnstitut Bulgar, VIII., 1934. 2. H.D. Peef’Alte Haser in Plovdiv, Berlin 1943. 3. H.D. Peef, Plovdivkata Kuca Pres Epokata na Vrazdaneto, Teknika, Sofija 1960 (Uyanış Devrinde Filibe Evleri) (Ayverdi, 44). “All the works indicated in these three researches belong to Ottoman Empire in 18th and first half of the 19th century. They are in the style of either Ottoman Baroque or Empire. Because the attitude of our books gather only works of charity well-known to benefit of the public. We take the houses as an example from the product of art generated from monument chain at people. And all houses of Plovdiv are city houses. The differences of them from each other are very rare. And we told that the styles of construction were less different from each other and they were close to each other historically (Ayverdi, pg.44)”. Dwelling architecture seen in the mansions of Rhodopian Bulgarian merchants in the little towns such as Verie, Ambelakia, Sianista where the Thessalonians merchants had the trade with Austria in the period when the Empire is economically pressurized, is 540
interestingly closer to Anatolia than to Istanbul. However, these dwellings couldn’t achieve the design richness or the sizes of the wooden mansions or yalı (waterside residence) in Istanbul of the last period, they remained as rural building (Kuban, 2007, 496). Discoursed hypothesis were suggested about these mansion buildings which are open to continuity with Anatolian tradition and are regional genuine creations within national chauvinism at the beginning of the century. For instance, Moutsopoulos enhances the houses of Verria (Karaferye) to houses of old Macedonia and Olintos. However, even one example couldn’t be given to relating the chain showing the relationship between these houses and the new houses. But, there is no historical and scientific basis in these theses not only for the dwellings in the Medieval Islamic Middle East and the dwellings the origins of which extended to Iran and Central Asia, but also in the architectural pattern taking place in monumental buildings because it wouldn’t be a matter of forgetting them by considering the dwellings in 19th century Macedonia and Thessaly. The wooden roofed Hayatlı Ev improved in an Ottomanİslam cultural atmosphere and extended from the Central Anatolia to Sarajevo in the geography centered with Istanbul dominated by Ottoman-Islam culture. In this geography; Romania, Northern Bulgaria, Southern Greece, in some extent Albania, Montenegro, Serbia, Hungary and Aegean coast held their own stone building tradition as Southeastern Anatolia, Cappadocia, Eastern Anatolia. But, the variations of Hayatlı Ev were built in Plovdiv, Thessaloniki and its surrounding area, in Skopje, in the settlement extending west. The construction foremen didn't come from Anatolia. And also, the constructions foremen of Istanbul weren’t from Anatolia. The people built these houses weren’t classified as Turks, Muslims, Rums or Armenian. House designs have the features adopted in all regions of an extensive building atmosphere. And also the foremen weren't classified as community in Safranbolu, Veria (30 km away from Thessaloniki) and Plovdiv. Turkish, Rum, Armenian, Bulgarian, Albanian, Bosnian construction foremen were building the examples of dwelling architecture similar to each other and changeable according to local conditions in Safranbolu, Kütahya, Thessaloniki, Plovdiv, Kastoria or Skopje without their being Muslim or Christian was a matter in question. The wooden dwellings built by rich merchants in Veria were bigger and more flamboyant than the dwellings in Kula. But, waterside residences in Bosporus were bigger and more flamboyant than Veria. It can be said that by adding East Rumelia to Anatolia an extensive dwelling tradition was created in 17th and 19th centuries in extension geography when such zealotry passed over (Kuban, 2007, 496). • The cultural effectiveness of Ottomans ruling the territory was determinative in Balkan urban identity formation in the period of improving urbanization in Balkans simultaneously with parallel dynamics in European countries. As a result of the centralized order and regime, it is inevitable that the existence of institutions, the hierarchical order in all spheres and rules affected the physical structure of the cities. • Ottoman rule in Bulgaria in the Balkans are the results of the process of the combination of local cultures, as shown in the visuals in this article. • The fact that Rumelia was one of the most important states in Ottoman Empire for five hundred years since the early periods resulted in some of the current urban settlement to gain importance. • Reflection of current local culture to civil architecture by communing with Ottomans formed the Ottoman House which also gives name to this article. 541
• As examined in the examples, it is clear that especially the dwelling with semiopen site shows similar features with many traditional dwellings as seen in the examples of West, Middle and Central Anatolia. • Planning types of Ottoman Houses: It is clear that houses with open the sofa affected asymmetric and close-sofa/symmetric the Bulgarian cities and also were adopted. Besides, indoor design, accessories, decorations, standardized motifs also show almost same features by impressions from Anatolia to Bulgaria. • In this region, planning types show important similarities. We also now have the opportunity to observe the data related with the usage of some characteristic elements either indoor or outdoor. The blindness and massiveness of the ground floors with stone walls in the facades of the mansions as well as the upper floor corbels consoled to the outside in line with the street are the same frequent features of the Anatolian house. In Anatolia, upstairs creates a different chart not matching up with basement as well as in the Plovdiv houses. Basements usually contain warehouse, cellar, barn etc. The relationship between the house and the street is provided with a large patio door. Behind this high stone courtyard wall, the patio is located in living part of the house. Upstairs outer sofas of the house are important dimensions with the name of çardak, divanhana and hagiat. Not having eyvan - iwan in the houses with open sofa is an important difference. Besides, in this type chart, the difference according to open sofa hall houses in Anatolia is that; parts are arranged in an order during porch axis are not opened to Hayat directly; they are opened among them or to some distribution parts and then they connect to Hayat. These common parts are opened to all parts of upstairs, living feature enriched with köşks is mention as well as being in the Anatolian examples. Location of the sofa is one of the most significant elements determining the plan chart typology. Main room of Bulgarian houses are the most, magnificent parts by being separated from other parts because of elements like their sizes, decorations, furnace, overhanging. • As in the Anatolian house; parts of recess, cabinet, cupboard etc. have many functions and sitting, eating, sleeping actions are performed in there. Inner decorations, closet and ceiling become intense and room function is enriched with top windows made by plaster and colorful glasses. Though the inner decorations in the house, outer facades are supported with plainness, basements with dead walls, wooden bracket support upstairs or buttress. Large eaves wooden hipped roof is encased in Turkish style tile, and its perspective view is incredible. • Another feature in Bulgarian houses is that back sides at upstairs don’t open to hall. Mostly a kitchen part takes place among the rooms. As mentioned in the book of Nur Akın (220), Turkish researchers of Ottoman house in the Balkans share the opinion that the examples showing long established association with Anatolian traditional residence type was developed with Ottoman effect. • At the core of dwelling tradition between Bulgaria and Anatolia; we see that it has an architectural inheritance showing great similarities between Anatolian city and Anatolian traditional houses with regard to urban and single building. Providing sociocultural integration with public gave opportunity to intensely Ottoman effect for urban creation and civil architecture in Bulgaria. Today, it is certain to prove this association based on data taken from resources. There was a fully global interaction between the two cultures.
542
REFERENCES Ahunbay, Z. (1996). Tarihi Çevre Koruma ve Restorasyon, Yem Yayınevi, İstanbul. Akın, N. (2001). Balkanlarda Osmanlı Dönemi Konutları, Stil Matbaacılık Akın, N. (1967). Balkanlarda Osmanlı Evi, İ.T.Ü. Mim Fak.,Basılmamış Doktora Tezi, 127. Ayverdi, Dr. E. H. (2000). Avrupa’da Osmanlı Mimari Eserleri-Bulgaristan, Yunanistan, Arnavudluk IV (4., 5., 6. Kitap), İstanbul Fetih Cemiyeti, 2. Baskı, İst., 43-44, 160-163. Çobancaoğlu, T. (1998). Türkiye’ de Ahşap Ev’in Bölgelere Göre Yapısal Olarak İncelenmesi ve Restorasyonlarında Yöntem Önerileri, Doktora Tezi, Mimar Sinan Üniversitesi, Fen Bilimleri Enstitüsü, İstanbul, 9-10, 44. Eldem, S. H. (1968). Türk Ev Plan Tipleri, İTÜ Mim. Fak., II. Baskı, İstanbul, 25. Eldem, S. H. (1984). Türk Evi Osmanlı Dönemi/Turkish Houses Ottoman Period I, İstanbul. Eldem, S. H. (1968). Türk Evi Plan Tipleri, İ.T.Ü. Mim Fak., 10. Eruzun, C. (1989). Kültürel süreklilik içinde Türk evi, Mimarlık 89, Yıl 27, Sayı 4, 69. Filibe-Bulgaristan’ın güney kesiminde Bugünkü adı Plovdiv olan eski bir Osmanlı şehri (1996). Türkiye Diyanet Vakfı, İslam Ansiklopedisi, Türkiye Diyanet Vakfı Yay., c. 13, İstanbul, 79-82. Günay, R. (1981). Geleneksel Safranbolu Evleri ve Oluşumu, Kültür Bakanlığı Yayınları, Ankara, 70-75. Günay, R. (2002). Geleneksel Ahşap Yapılar, Sorunları ve Çözüm Yolları, Birsen Yay. Ivanova, E. Dr.. Mimar (2004). Balkanlarda Mimarlık, Temas Bölgesi’nde Mimarlık, Bulgarca’dan çeviren: Esin Osmanoğlu, Mimarlık Dergisi (Mart-Nisan)(MİM 316). Konuk, N. (2010). Yunanistan’ da Osmanlı Mimarisi I, Stratejik Araştırmalar Merkezi (SAM), Merkez Repro, Ankara. Kuban, D. (1982). Türk Ev Geleneği Üzerine Gözlemler-Türk ve İslam Sanatı Üzerine Denemeler, İstanbul, 195-209. Kuban, D. (2000). Tarihi Çevre Korumanın Mimarlık Boyutu: Kuram ve Uygulama, Yem Yayınevi, İstanbul. Kuban, D. (2007). Osmanlı Mimarisi, Yem Yayın, İstanbul, 469-496. Ögel, S. (1981). Hayat (Sofa)Köşkü ve Tahtseki, Sanat Tarihi Yıllığı IX-X, 227-239. Popov, L.. Y. Mimar (2004). Balkanlarda Mimarlık-Küreselleşme ve Mimari Kimlik, Bulgaristan Mimarlar Birliği, ARCHITECTI Dergisi Editör Yardımcısı, Mimarlık Dergisi (Mart-Nisan) (MİM 316). Sözen, M. (1980). Türk Mimarisinin Tarihsel Gelişimi, İ.T.Ü. Mimarlık Fakültesi, Mimarlık Baskı Atölyesi, Tarihi ve Restorasyon Kürsüsü, Baskı Atölyesi, İstanbul, 87-95. Stamov, S. (1978). Bulgaristan’ın Mimari Mirası, Bulgar Ulusal Uyanış Dönemi Mimarisi, Çeviren: Sibel AKAY, Mimarlık Dergisi (MİM 157) 1978 Yıl: 16, s:4, 42-46. Trankova, D.; Georgieff, A.; Matanov, H. (2011). A Guide to Ottoman BulgariaPlovdiv, Vagabond Media,Ltd., 89-96. Tsaneva, B. (1978). Bulgaristan’ da Konut Yapımı, Mimarlık Dergisi (MİM 157) 1978,Yıl: 16, Sayı: 4, 46-47. Tuncer, O. C. (1980). Mimarlık Tarihi-I, A.D.M.M.A., Mimarlık Fakültesi, Geliştirme Derneği Yayınları: I. Turan, Ö.; İbrahimgil, M. Z. (2004). Balkanlardaki Türk Mimari Eserlerinden Örnekler, TBMM. Kültür, Sanat ve Yayın Kurulu Yayınları No: 97, Ankara, 156-157, 182. Yenişehirlioğlu, F. (1989). Türkiye Dışındaki Osmanlı Mimari Yapıtları. Yenel, A. (2014). Fotoğraflar. URL 1: (http://tr.scribd.com/doc/141357115/Balkanlarda-biTurk%C5%9EehriFilibe) (25. 04.2014).
543
Chapter 38 Design With Flexible Functions: A Trial in Kayseri Kemal DEMİR INTRODUCTION Rapid changes in economic, social, political and technological conditions that have taken place in Turkey and all around the world alter people’s expectations of urban space and architectural structure. Consequently, the need for dynamic solutions that can harmonize with the changes already experienced and those to be experienced increases with each passing day. Today, the demolition of structures which have not reached even half of their economic lives does not result solely from structural ageing, but also from the fact that they were designed in a way such that they are only suitable for a single function. The designer is supposed to make trials on projects that they will meet any functional change that may occur in consequence of a change in the needs of the contractor and the user. In this study, the phenomenon of design with a flexible function is discussed. Then, the development of the design approach which includes a flexible function is examined. Finally, solutions which can be developed by the designer that are consistent with the uncertainty and variability of the needs of the contractor and users are examined and implemented with reference to a building designed by the author. CONCEPT OF FLEXIBLE FUNCTION IN ARCHITECTURE The concept of flexibility, which is one of the most applicable tools in architecture, is closely related to the functionalist architectural movement which has left its mark on the 20th century. Today, one aspect of functionalism focuses on stability, and the other focuses on the discourse and application of flexibility. Consequently, both functional stability and functional flexibility are viewed as expansions of functionalism. Particularly after the 1950s, strategies of flexibility were intended to purify functionalism from determinist extremeness (Kepekcioğlu, 2007). By establishing the concepts of ‘time’ and ‘uncertainty’ (Forty, 2000). Although it may seem as though there is a common opinion concerning the concept of flexibility in contemporary architecture, researchers usually have different, and sometimes conflicting, interpretations. According to Gropius, who offered one of the first definitions concerning flexibility in architecture, he architect should not consider buildings as monuments or works of art, but structures serving the flow of life should create a flexible basis capable of covering the dynamic features of the modern life’ (Ak, 2006). It is quite striking that Gropius, an architect who maintains the functionalist attitude in his projects, considers flexibility as a natural and unquestionable method which leads to better architecture (Gropius, 1993). On the other
Assoc. Prof. Dr., Erciyes University Faculty of Architecture, Department of Architecture, Melikgazi, Kayseri;
[email protected]
hand, according to Oxman, flexibility is the ability to adapt to changing conditions (Ozkan, 1998). Most often, designers face two different types of flexibility. The first is the design with flexible functions, which is the focus of this article. Flexible function design takes the possibility that needs which may change over time and that uncertainties may occur into consideration during the project planning stage. The second is flexibility in applied buildings. DEVELOPMENT OF DESIGN WITH FLEXIBLE FUNCTIONS It has been observed (Colquhoun, 1985). That they have both wide and numerous spaces when public buildings constructed prior to the 20th century are examined and because these buildings have not been designed with functional determinism. For example, buildings which were originally designed as barracks later functioned as university faculties after the proclamation of the Republic of Turkey in 1923. Ludwig Mies van der Rohe was one of the first and most effective users of the flexibility concept in modern architecture. Mies exhibited the first attempts to create a flexible space as early as 1927 while designing a housing unit in Weissenhof. He did not have an opportunity to fully implement functional flexibility strategies until 1945 with the design of the Farnsworth House in the U.S.A. and in 1956 with the design of Crown Hall, the architecture school of the IIT (Carter, 1974). Beginning with the Farnsworth House and Crown Hall, Mies started to apply the concept of ‘undivided free space’ to his buildings (Cohen, 1996). According to Mies, functional stability and specialization is neither economic nor convenient as asserted, because they do not consider change. Mies suggested a very simple and uncomplicated solution: a single main area defined solely by geometries (Blundell, 2002). In the 1970s, when technology began to rapidly develop and gain importance in human life, users found the opportunity to utilize space more freely by applying technological advances and new building materials. The most typical example which exhibits this development together with flexibility is the Pompidou Cultural Centre located in central Paris. Building as part of an international contest held in 1971, the designers of the cultural centre included a space which was not in the contest specifications and presented a very simple and clear scheme, rather than considering the building as separate masses and dividing it. Also, the structural system of building as well as the exposed external mechanical services systems brought a unique expression to the building’s face (Colquhoun, 1985). Designs with flexible functions have been criticized since the 1960s. For example, the Dutch members of Team X, Van Eyck and Herman Hertzberger state that flexible spaces are neutral and assert that neutrality lacks identity (Forty, 2000). Hertzberger further asserts that ‘a solution stemming from change cannot be the best or the most convenient solution’ and that ‘flexibility cannot create a real solution to any problem’ (Hertzberger, 1991). On the other hand, Van Eyck considers constantly changing flexible premises to be as dangerous as stable premises and states that flexibility is overrated. He uses the glove metaphor; by associating flexible space with a glove which can be worn by all hands, he points out that the glove is in fact not designed particularly well for anybody’s hand (Van Eyck, 1993). He implies that the search for a space which can adapt to all functions is a vain effort (Kepekcioğlu, 2007). On the other hand, Koolhaas has criticized the concept by stating that ‘Flexibility is not to cover all 545
foreseen possible cases by trying to foresee all changes to come, because the future is usually unpredictable’ (Koolhaas, et al, 1995). Despite the criticisms of the essence of design with flexible functions, this approach is still widely used all around the world.
FORM TRIAL IN KAYSERI The trial design was implemented on land in the Kiçiköy neighbourhood of Talas Municipality, which is part of the Kayseri Metropolitan Municipality. The parcel located at the intersection of Kerkuk Boulevard, a main arterial road, and Çimenli Street (Figure 1a and 1b) is surrounded by the Erciyes University campus to both the North and the West, by a park and the Religious Specialization Training Centre to the South and houses to the East, respectively. This corner parcel is characterized by mostly flat topography. The long sides of the rectangular parcel face the North and South, and its short sides face the East and West. In terms of scenery, the parcel has a view of Erciyes Mt. to the south, Mt. Ali to the southeast and Erciyes University and a cityscape to the West and North, respectively.
Figure 1a: Building location
In terms of its zoning status, the parcel has a surface area of 3620 m² and a total building construction area of 11900 m². The parcel is designated as (M) in the zoning plan. According to the Kayseri Metropolitan Municipality zoning regulations, commercial buildings, such as theatres, hotels, restaurants, banks and offices and cultural facilities, public facilities and multi-storey houses, can be built on areas designated as (M). In addition, the inclusion of a mezzanine on ground floors is also permitted. On the other hand, according to the 65th Article of the zoning regulations (Zoning Regulation and Legend of Kayseri Metropolitan Municipality, 2001). After 2 storeys, buildings up to 15 storeys can be constructed provided that the total building area (store area ratio) remains the same.
546
Figure 2b: Building location The Talas Municipality requested the contractor and the architect to ensure that the building design should conform to provisions of the zoning regulations and the zoning status of the parcel and that the design should give priority to a health facility when determining the function of the building. In addition, it was requested that the architectural form contributes to the image of Talas. On the other hand, the developer’s expectations of the designers were as follows: The building can respond to different functions The entire building density provided by zoning is utilized That the process of construction will be shared by both user and contractor in future should be considered before construction start. The building should be analysed as a mixed-use commercial facility (general store, wedding reception hall, supermarket) to obtain a building license from the municipality, Licensing should be in line with the new function with modification project when there is no functional uncertainty, The external walls should be in line with flexible functionality The bearing structure must be long lasting and economical The building’s form and facade should be notable. The functions and frame are determined by considering factors which affect the form of the building (location, topography, direction, scenery, zoning status, municipal requests, developer expectations, among others), the probable immediate uses (shopping, accommodation, education, health, among others) and indefinite functions which may occur in the future. These factors are presented in Table 1. The main principles of the project can be specified as follows: forming a rational structural setup having a flexible function and simplicity; ensuring the congruency of interiors and the building envelope; ensuring that light, climate and vista contribute to building integrity; ensuring that the building will be readable from both the exterior to the interior and from the interior to the exterior; and ensuring that the building forms a new focus in Talas.
Functional setup: The southern and northern faces of the building (long sides) were designed as room units and total spaces in line with flexible use. Considering the most intense uses, vertical cores and wet areas were featured together on the eastern and western faces (short sides). Horizontal circulations were analysed for flexibility suitable 547
for various functions. Considering the commercial use, sufficient areas were reserved for possible escalators, conveyor belts, human or cargo elevators in the basement and ground and mezzanine floors (Figure 2). Table 1: Possible Functions and Frame Program of the Project Frame Program
Possible Functions Whole Shopping Sectional Or Mixed Management Office
Whole Sectional
Multi-Purpose Halls
Hotel Accommodation Apartment Hotel
Education
Health
Primary– Secondary Education Training Centre Hospital Housing
Accommodation
Dormitory
The entire building to be a multi-storey store; showroom, furniture, home textile, foodstuff, electronics and other selling spaces. Multi-storey market, various sales units of different sizes, store, food & beverage areas, training centres, ballroom, meeting, conference, wedding reception halls, fitness and spa centres, etc. Management and service centre for public, legal and private organizations. Rentable city offices of varying sizes. Spaces of different sizes and purposes for meeting, course, training, promotion, seminar, ballroom, conference, wedding and other functions and constituted of food & beverage, recreation, entertainment and rehabilitation units. Accommodation units, meeting, food & beverage, recreation, entertainment and similar spaces which comply with regulation of tourism qualifications. Accommodation, food & beverage and recreation facilities for Erciyes University Hospital, where patients and their relatives can stay together. Education institution including classes, gymnasium and culture units for private, primary and secondary education. Private secondary and higher education preparation units General or specific hospital capable of serving the whole Kayseri city Houses for rent of varying sizes and for different users. Private student hostel for females or apartment hotel houses for male students, singles, childless married couples.
Figure 2: Functional setup. 548
In addition, the extensions of the main building (parking lot, shelter, technical volumes, etc.) were planned at the northeastern face, outside the primary space of the building and below the garden code. By considering the related regulations (Zoning Regulation of Kayseri Metropolitan Municipality and the provisions of legislations concerning health, tourism and education) collectively with the used total spaces and the technical reinforcement required for the suspended roofs, the storey heights and clear interior heights were determined to be 4.80 m and 3.70 m, respectively. Bearer System: In the horizontal structural setup of the building, a 6.80 m axis range (i.e. the total width of the two room units for accommodation and health functions) was taken as the basis. The same axis range was also selected for the education, shopping, meeting and indoor parking lot functions. In the vertical structural setup, the building was planned with two wide openings of 14.10 m. In addition, a steel bearing system was utilized to form a single open space in the attic, (Figure 3a and 3b).
Figure 3a: Bearing system design
Figure 3b: Interior structure (ground floor structure)
549
Figure 3b: Interior structure (second floor structure)
Figure 3b: Interior structure (penthouse structure) External Wall: Arrangements which have flexibility to adapt to the bearing axis system, room units and the total spaces were included by considering interior uses and the data of the premises. Therefore, minimum window bays on the eastern face vertical cores (service ladders and elevators), partially continuous vertical and horizontal window bays on the western face general staircase and service area volumes, minimum window bays on the northern face to minimize heat loss and for scenery and heat gaining purposes and continuous vertical and horizontal window bays on the southern face were preferred (Figure 4a and 4b). Modern materials and approaches were employed when arranging the external appearance of the building, and particular attention was given to the southern and western faces which overlook the streets. A simplified approach was used for the eastern and northern faces. The external faces of the building enabled readability and helped define the identity of the building.
550
Figure 4a: 3D faces1
Figure 4a: 3D faces2
Figure 4b: Faces1
Figure 4a: 3D faces3
Figure 4b: Faces2
Figure 4b: Faces3
551
The plan schemes established with the functions and frame programs foreseen are in line with design principles and components and are presented in Figure 5.
Figure 5: Planning chart of flexible function 552
FINDINGS Examining the planning schemes (Table 1) together with the flexible functions (Figure 5) provides the following findings: The planning schemes concerning the various functions are applicable. Flexible buildings should be designed as wide as possible and single places. From a functional analysis of the flexibility of the building, the following were identified as the primary factors which determine flexibility: zoning status, size of the land, relationships with immediate surroundings, expectations of the developer and the municipality, total construction and floor area, vertical access cores, wet areas, geometry of the building and the connection the building establishes with the city. Not dividing the space when selecting the vertical service cores is an important design decision. When determining the capacity of the horizontal cores, the most intense use scenarios must be considered; when use is less intense, these areas can be added to the total space. Circulation areas and other service units can be located in interior areas in between the units facing one another on the faces of floor plans (rooms, classes, sales units, etc.); these areas can be included within the space of the total uses. The lower limit of flexibility is set by the spatial organization of the room units, and the upper limit is set by the total use of the space. The bearing system setup must be determined in accordance with the upper and lower limits of flexibility. However, the fact that the main objective of this setup is to maximize total space should not be ignored. The provisions of the related regulations, the total spaces and the suspended floor covering the technical installations determine the floor heights. The building can contribute to the image of the city and can become an urban focal point by considering a flexible function design and building identity together. These findings demonstrate that the building has adequate flexibility for both current and future functions. CONCLUSION In general, zoning regulations and plans do not include functional flexibility. Consequently, buildings are commonly designed in radical forms for a single function. This results in the cities and neighbourhoods we live in resembling worksites, and the demolition of buildings often occurs even before they complete half their economic lives. However, meeting all expectations of both the developer and the user in a building design produced from the same planning scheme for different functions in a preferential location is a significant design challenge. This is where flexibility can help the designer determine the geometry of the building, the area it will cover and its structure. In addition, flexibility facilitates producing alternatives which are suitable to the expectations of the user and the developer. During the design phase, the architect who wants to ensure that the structure will be last should test projects to ensure they will meet any functional changes which may occur due to changes in developer or user needs. In this study, an approach similar to design with flexible functions, the history of 553
which dates back to Gropius and Mies, was applied to material design and implementation. The real purpose in sharing this experience was to provide a different viewpoint and a possible solution for designers and developers who may face similar problems. During the study, two key questions arose: (1) what kind of course flexible use limits will follow according to time and low-scale functional changes? And (2) how can the concept of high-scale flexibility be incorporated in the zoning system? In future, these questions should be addressed using new data obtained from future studies. REFERENCES Ak, N. (2006). Determination of the Concepts Emerging in the Design of Tomorrow’s House, (Unpublished Postgraduate Thesis) Istanbul Technical University, Institute of Sciences, 44 pp., Istanbul. ANON, (2001). Zoning Regulation and Legend of the Metropolitan Municipality of Kayseri, 85-86 pp., Kayseri. Blundell, P. J. (2002). Modern Architecture Through Case Studies, 211 pp., Architectural Press, Oxford. Carter, P. (1974). Mies at Work, 87 pp., Phaidon Press, New York. Cohen, J. (1996). Mies van der Rohe, Trans. Rosengarten, M. Chapman & Hall, 84-96 pp., Hong Kong. Colquhoun, A. (1985). Essays in Architectural Criticism: Modern Architecture and Historical Change, 111-112 pp., MIT Press, New York. Forty, A. (2000). Words and Buildings, Thames & Hudson, 142 pp., London. Gropius, W. (1993). Eight Steps toward a Solid Architecture, in Architecture Culture, 19431968: A Documentary Anthology, Ed. By Ockman, J. with the collaboration of Eigen, E., 178 pp., Columbia University, New York. Hertzberger, H. (1991). Lessons for Students, 146 pp., 010 Publishers, Rotterdam. Kepekcioglu, M., B. (2007). A Conceptual Evaluation on Functional Flexibility, (Unpublished Postgraduate Thesis) 2 pp., Istanbul Technical University, Institute of Sciences, Istanbul. Koolhaas, R. et al. (1995). SMLXL: Office for Metropolitan Architecture, 240 pp., Monacelli Press, New York. Özkan, N. G. (1998). Examination of Housing Estates in Terms of Flexibility (Unpublished Postgraduate Thesis), 18 pp., Istanbul Technical University, Institute of Sciences, Istanbul. Van Eyck, A. (1993). Steps toward a configurative discipline, in: Architecture Culture, 1943-1968: A Documentary Anthology, Ed. By Ockman, J. with the collaboration of Eigen, E., Colum, 348-360 pp., New York.
554
Chapter 39 Adaptive Building Shells Ahmet Vefa ORHON* 1. INTRODUCTION
“Adaptation is the evolutionary process whereby a population becomes better suited to its habitat.” – On the Origin of Species (1859), Charles Darwin As Darwin said, adaptation is the key to survival of the fittest. In this context, the word ‘fittest’ means ‘better adapted for local environment’. It is easy to push an analogy to apply the term ‘adaptation’ to architecture; a building can be likened to a living being which has to resist to changing natural and environmental forces. Within this analogy, building shell is the vital component to resolve the issues of environmental adaptation of the building. A building shell (aka building skin) is the structural enclosure of the building which consists of facades and roofs. With respect to their response to environmental factors, there are mainly two types of building shell: 1. Traditional (non-adaptive; conventional) building shell 2. Adaptive building shell Within the aforementioned architectural analogy of adaptation, the main flaw of a traditional building shell is its stability. Even though it protects the interiors from direct environmental factors (sunlight, rain, wind, etc.) and manually regulates air pressure with its fenestrations, the response of a traditional building shell to environment is in a static way – simply it just obeys the environment but does not adapt to it (Orhon, 2012). Traditional building shells are ‘rigid systems’ with fixed properties, and hence cannot adapt to variability of changing conditions. On the other hand, adaptive building shells interact with the change in its surroundings in a dynamic way. 2. Adaptive Building Shells In a broad sense, the term ‘adaptation’ is used in architecture in relation to the changing morphologies of the architectural artefact. These changing morphologies have been a result of timely changes and evolution of architecture as a social entity, technological product and as a practice (Verma & Devadass, 2013). This kind of adaptation in architecture is a long-term process that occurs with time and generations. In the sense in which this study takes the term ‘adaptation’ in consideration, analogy is simple and straightforward. It considers the adaptation of building component (building shell/skin) not the architecture as a whole. Within this analogy, adaptive building shell (ABS) is a term that describes the group of facades and roofs that interact with the variability in their environment in a dynamic way by adapting.
*
Assoc. Prof. Dr., Dokuz Eylül Universty, Faculty of Architecture, Depart. of Architercture
2.1. In response to what a building shell designed to be adaptive? A question that can be raised at this point is: in response to what a building shell designed to be adaptive? Three main categories can be identified. An adaptive building shell responds to (1) environment, (2) users, and (3) objects (Schnädelbach, 2010). Adaptiveness to environment: A building shell can respond to environmental factors (daylight, rain, wind, etc.). This type of climate adaptive shells improves overall building performance in terms of primary energy consumption while maintaining acceptable indoor environmental quality. Environmental sustainability concerns are the key driver of this type of adaptiveness. Adaptiveness to users: A building shell can respond to the activities and needs of the building users. For example, the users can change architectural layout manually or the building can respond to them in a particular way automatically. A good case in point is the Allianz Arena (2005, Munich, Germany, Herzog & de Meuron). This football stadium has a full color changing skin constructed of ETFE-foil air panels. Each panel can be independently lit with white, red, or blue light. So, the façade changes color for each game depending on the colors of the respective home team. Adaptiveness to objects: A building shell can respond to the objects within the building or surrounding the building. For example, a media façade can interact with people passing by via their mobile phones. It can even respond to objects passing overhead. For example, a domestic device called ‘plane tracker’ decodes radio signals from passing aircraft and informs users about what goes on over their heads (Beaver, Boucher& Pennington, 2007). Extending this idea, by responding to similar data streams about the object, a shell which is enabled to change its acoustic properties can mitigate the effect of unwanted noise coming from the object. In general, this type of adaptiveness in building shells is comparatively much less common or at least less discussed (Schnädelbach, 2010). 2.2. Responsive Character of Adaptive Architecture In 1970s, Nicholas Negroponte proposed that advances in artificial intelligence and the miniaturization of components would soon give rise to buildings capable of intelligently recognizing the activities of their users and responding to their needs, as well as changes in the external and internal environment (Meagher, 2015). The term "responsive architecture", which is largely based on Negroponte’s ideas, is defined by many authors by looking at it from various angles. For example, it is defined as “any architecture that has the ability to respond to user’s needs” (Sherbini & Krawczyk, 2004) or as “a type of architecture that has the ability to alter its form in response to changing conditions” (d’Estrée Sterk, 2005) or as “a system which reacts on given stimulus in predefined way” (Kolodziej & Rak, 2013) or as “a dynamic shape-shifting building system that is susceptible to alter its shape and physical properties in response to environmental conditions, user activities, and social contexts” (Pan & Jeng, 2008). Within this context, the term “responsive” suggests demonstrating an ability to alter its physical properties to continually reflect the environmental conditions that surround it. This ability is simply called as “adaptation”. According to Schnädelbach (2010) ‘adaptive architecture’ is an umbrella term that incorporates a variety of approaches, such as those labeled flexible, interactive, responsive, smart, intelligent, cooperative, media, hybrid and mixed reality architecture. 556
In the sense proposed by this study, the term “adaptive architecture” is defined as follows: “Adaptive architecture is a type of architecture that has the ability to alter its physical properties (form, shape, color, texture, acoustic, porosity etc.) in a predefined/programmed/designed way to adapt to changing external and internal environmental stimuli (temperature, relative humidity, precipitation, wind, sound, solar radiation, CO2-level etc.), user activities and needs, and social contexts.” 3. Types of Adaptive Building Shells According to Loonen, Trčka, Cóstola & Hensen (2013), adaptive shells can be categorized in two main groups by the behavior of their adaptation mechanism as (1) Micro-level, and (2) Macro-level. According to this categorization, adaptive behavior of the shell is either based on a change in properties or behavior at the micro-level, or at the macro-level; although combinations are also possible. The distinction between both mechanisms is raised by the spatial resolution at which the adaptive actions take place. Micro-level adaptation simply occurs within the material itself, changing the energy state or properties of the material. Macro-level adaptation can be seen with the naked eye. Adaptive shells with macro-level adaptation are often referred to as ‘kinetic envelopes’ since they are usually associated with various kinds of motion like folding, sliding, rolling, hinging, etc. (Loonen et al., 2013). There are two types of control mechanism that drive the adaptive behavior of the shell: (1) Intrinsic control, and (2) Extrinsic control. Adaptive shells with intrinsic control are self-adjusting, since their adaptive behavior, which is an inherent feature of their subsystems, is automatically triggered by environmental stimuli. This type of control is usually associated with smart materials. Adaptive shells with extrinsic control consist of three basic elements: sensors, processors and actuators (Loonen et al., 2013). For Negroponte (1975), responsiveness is a function of intelligence. For a building shell to be termed as “adaptive”, a smart/intelligent system/mechanism of response is to be embedded in architecture. The term “responsiveness” is simply used to describe “how the system/mechanism can interact and adapt”. The responsiveness, which is the outcome of adaptive behavior, can occur on multiple levels and frequently involves mechanical/digital sensing, control and actuation technology (sensors, actuators, component controllers, etc.). It’s not important whether responsiveness occurs automatically or through human intervention. For adaptive shells, two types of responsiveness can be distinguished by system/mechanism of response: 1. Active responsiveness (responsiveness by the system) 2. Passive responsiveness (responsiveness by the material mechanism) Active responsiveness: This type of responsiveness is typically conceived as a technical function enabled by sensing, actuating and regulating devices. Mechanical and electronic equipment is employed to receive, process and translate a stimulus into a response. Adaptive shells with extrinsic control demonstrate active responsiveness by their nature. Passive responsiveness: This type of responsiveness is achieved by embedding sensing, control and actuation within the material itself. Since the responsive capacity of the system is intrinsic to the material’s behavior, it does not require any sensory system or motor function. Therefore, it is passive. “Autonomous, passive and materially 557
embedded responsiveness” is simply called as ‘embedded responsiveness’ by some authors (Menges, Reichert & Krieg, 2014). Micro-level adaptive shells with intrinsic control demonstrate passive responsiveness by their nature.
4. Examples of Adaptive Building Shells 4.1. Active Adaptive Buildings Shells Within this study, Adaptive shells demonstrating active responsiveness are simply called as ‘Active Adaptive Buildings Shells’. 4.1.1. Sharifi-ha House (2013, Tehran, Iran, NextOffice) Sharifi-ha House has a façade which features motorized rooms that pivot up to 90 degrees to face entirely in or out to adapt to changing seasons or functional scenarios (Figure 1). Since the building has a noticeably narrow façade-width, this mechanism allows the inhabitants to adapt effectively to fluctuating temperatures by opening up rooms in summer, or turning them inwards during winter. In summertime, shape changing façade offers an open /transparent /perforated volume with wide, large terraces. In contrast, during Tehran’s cold, snowy winters the volume closes down, offering minimal openings and a total absence of those wide summer terraces (Taghaboni, 2014) (Figure 2). The façade can also adapt to the mood of its inhabitants, simply by leading the building’s volume to become open or closed, introverted or extroverted.
Figure 1: Shape changing façade of Sharifi-ha House (Image: Nextoffice - Alireza Taghaboni)
4.1.2. The Prairie House (2010, Illinois, U.S.A, ORAMBRA) The Prairie House is a small residence project designed by ORAMBRA (The Office for Robotic Architectural Media & The Bureau for Responsive Architecture) in Illinois with the aim of producing a house that uses active systems to improve the shell performance and reduce carbon emissions to 40 percent of those made by a typical home (Figure 3). The project proposes a ‘color and shape changing shell’ that uses actuated tensegrity systems, in conjunction with new cladding systems. Through the use of thermo or photo-chromatic inks, the color of the interior membrane of the building becomes lighter on warmer days and darker on colder days. The building shell derives most of its environmental performance via its shape-changing structure; it expands to 558
reduce the impact of internal heat loss on heat days and shrinks to reduce the heating requirements on cold days. The building is estimated to consume 2.137 ton CO2 in a non-responsive state; with shape change responses, the house consumes only 1.623 ton CO2. This compares to the average house in Illinois that consumes 4.008 ton CO2 (d’Estrée Sterk, 2012).
Figure 2: Seasonal modes of the façade of Sharifi-ha House (Image: Nextoffice - Alireza Taghaboni)
Figure 3: The Prairie House (Image: ORAMBRA – Tristan d’Estrée Sterk)
4.2. Passive Adaptive Buildings Shells Within this study, adaptive shells demonstrating passive responsiveness are simply called as ‘Passive Adaptive Buildings Shells’. 4.2.1. The HygroSkin Meteorosensitive Pavilion (2013, Orléans, France, Achim Menges & Oliver David Krieg & Steffen Reichert) HygroSkin Meteorosensitive Pavilion is an architectural prototype that demonstrates the integration of a responsive material system into a functional, modular and highly adaptable building shell (Figure 4) (Reichert, Menges & Correa, 2015). The main feature of the shell is the utilization of the hygroscopic qualities of wooden veneer to adapt naturally to changes in relative humidity and temperature; that is why it is 559
called as ‘HygroSkin’ and is defined as ‘meteorosensitive’. The metereosensitive shell autonomously opens and closes its pores in response to weather changes but neither requires the supply of operational energy nor any kind of mechanical or electronic control. Here, by directly embedding sensing, control and actuation within the material itself, the material acts as a machine.
Figure 4: The HygroSkin Pavilion in a temporary outdoor exhibit
Computationally derived and robotically fabricated shell of the building, which is at the same time load-bearing structure and metereosensitive skin, is composed of 28 conical panels produced through the elastic bending of planar sheets of 4mm plywood (Figure 5). Each panel is a sandwich component enclosing a layer of foam in between two plywood layers (Reichert et al.,2013). A lightweight vacuum moulding process normalizes any irregularities in the foam while a 7-axis robotic cutting and milling process ensures dimensional accuracy. Panels produce self-forming conical shapes by interlocking CNC milled puzzle type joints along their edges. This architectural assembly ensures structural rigidity and adaptability while minimizing weight of the shell. Within the deep concave surface of each panel a weather–responsive aperture is placed. The apertures respond to relative humidity changes within a range from 30 to 90 percent, which equals the humidity range from sunny to rainy weather in a moderate climate (Figure 6). In direct feedback with the local microclimate, the pavilion constantly adjusts its degree of openness and porosity, modulating the light transmission and visual permeability of the envelope (Menges, Reichert & Krieg, 2014). The accuracy of robotic prefabrication process of the shell is another salient feature of the project. Comprehensive laser scans of the structure revealed an average deviation of less than 0.5mm between the computationally derived design model and the actual physical geometry that the material computed in full scale.
4.2.2. Alterswohnen (2005, Domat-Ems, Switzerland, Dietrich Schwarz) Alterswohnen building is one of the first applications of GlassX windows (Figure 7). GlassX is a PCM (Phase Change Material) glazing system (GlassX, 2005). The core 560
of the system is thermal storage module, which is a thin layer of translucent PCM encapsulated in a polycarbonate container. At room temperature, 16 mm of this PCM, which is salt hydrate, can absorb as much heat as a 250 mm concrete wall. A prismatic polycarbonate plane is added in front of thermal storage module.
Figure 5: The HygroSkin Pavilion: Modular assembly of the shell.
Figure 6: HygroSkin Pavilion: Open and close condition of weather-responsive apertures according to relative humidity (RH)
Figure 7: PCM glazing façade of Alterswohnen (GlassX, 2005)
This prismatic plane deflects high-angle sunlight in the summertime, rather than transmitting it, to keep the building cool. Lower-angle winter light is transmitted 561
through this layer. The PCM material stores heat by melting, and then radiates it back into inner space at night, as the material cools and resolidifies (Figure 8).
Figure 8: Working principle of GlassX system (GlassX, 2005)
4.2.3. Bloom (2012, Los Angeles, U.S.A., DO|SU Studio Architecture) ‘Bloom’ is an architectural research installation displayed at the Materials and Application Gallery in Los Angeles (Figure 9). It is designed by biologist-turned-architect Doris Kim Sung to demonstrate her “Breathing Metals” concept (Anderson, 2012). The skin of the installation, which is made up of approximately 14,000 lasercut thermobimetal pieces, acts as a sun tracking system that indexes time and temperature (Furuto, 2012). A thermo-bimetal is a laminated sheet metal, which is constructed from two different metals with different thermal expansion coefficients by attaching them together by welding, brazing or riveting, so it can expand and contract at different temperatures.
Figure 9: Thermo-bimetal based self-regulating ventilation concept in Bloom architectural installation (Images: DO|SU Studio Architecture). 562
The skin of the installation is responsive to the difference in temperature. When the temperature rises above 22°C, the metal sheets curl up and when it gets cooler, the sheets flatten out. Skin simply shades and ventilates specific areas of the shell as the sun heats up its surface. 5. Current and Future Sources of Inspiration for Adaptive Shells It can be clearly seen that many concepts of adaptive building shells find their inspirations in Biomimicry, smart materials and nanotechnology. Today, one of the most prominent inspiration sources for adaptive shells undoubtedly is Biomimicry, which is a nature based approach that seeks clever solutions by emulating nature’s timetested patterns and strategies. Within this approach, natural adaptation, which is pervasive in nature, has proven to be a valuable source for concepts. For example, tropism which is a biological phenomenon related to natural adaptation. Tropism is simply defined as growth or turning movement of a biological organism, usually a plant, in response to an environmental stimulus. Both phototropism (i.e. changing in response to light) and heliotropism (i.e. changing in response to the sun) have been effectively transformed to buildings in climate adaptive building shell concepts enabling to actively collect or reject solar energy (Loonen et al., 2013). Kinematics of plant movements (such as valvular pollination mechanism of the Bird-of Paradise flower, rapid trap closure mechanism of the carnivorous waterwheel plant etc.) is currently investigated to conceptualize basic mechanics for exterior façade shading systems (Schleicher et al., 2011). The hygroscopic shape changing adaptation, which can be observed in a variety of plants, is also investigated and was even implemented in some cases as seen in The HygroSkin Pavilion. Smart materials are another source of inspiration for adaptive building shells due to their dynamic and adaptive nature. In recent two decades, the use of smart material based concepts in adaptive building shells has generally resulted in significant progress, i.e. photochromic glazing, thermochromic glazing, PCM glazing and coatings, selfcleaning and air-purifying photocatalyst surfaces, anti-microbial coatings etc. Until today, 11 types of smart materials have been used in adaptive building shells: electrochromic, photochromic, thermochromic, electroluminescent, hygroactive, piezoelectric, thermoelectric and thermostrictive materials, thermo-bimetals, shape memory alloys and phase change materials. It goes without saying that in the future, this number will increase sharply with the invention and implementation of new smart materials. CO2 reactive materials is a good case in point, i.e. CO2 responsive polymers which use carbon dioxide as a green or eco-trigger (Lopez, Rubio, Martín, Croxford & Jackson, 2015). In the Open Columns project (Fig.10), composite urethane elastomers are used for constructing CO2 responsive structures at an architectural scale. This project investigates the underlying material research and design criteria for constructing deployable columns that are responsive to CO2 emissions (Khan, 2010). Today, nanotechnology is a promising interest for adaptive building shells, i.e. programmable matter. Programmable matter is a general classification for a matter that can change its physical attributes (shape, density, conductivity, color, texture, optical properties, index of refraction, etc.) in a programmable fashion, based upon user input or by environmental stimulus, through some kind of internal information processing. The term was first used in 1991 by Tommaso and Margolus. They referred to a cluster of tiny computing elements, cooperating by using nearest-neighbor interactions to 563
create a system that could mimic the physics of real matter. Claytronics is an example of programmable matter currently being investigated by Carnegie Mellon University and Intel Research (Boillot, Dhoutaut & Bourgeois, 2015). The goal of the Claytronics project is to create a programmable material from millions of cooperating individual sub-millimeter particles. Each particle, or catom (short for ‘claytronic atom’) is a tiny robotic cylinder made of MEMS (micro-electromechanical systems) just microns in size, slightly larger than the width of a human hair.
Figure 10: Open Columns: CO2 Responsive Architecture (Khan, 2012)
Catoms use electrostatics to communicate, transfer energy to one another and perform computation to move about neighboring catoms to create new shapes under program control. Although the current state of Claytronics, and programmable matter in general, is still a long way from being able to be used in real world applications, it suggests a bright potential for architectural applications. For example, the “Living Kitchen” (Harboun, 2012) is a future concept project inspired by Claytronics (Fig. 11). It is based on an imaginary, shape-shifting, programmable matter, which is able to transform into whatever shape desired. The matter being reactive to exterior stimuli, people would just have to touch the walls to make faucets, sinks or cutting-boards appear. The surfaces could be stretched, twisted and bend by the user to perfectly fit his needs (Parthenopoulou & Malindretos, 2016).
Figure 11: The “Living Kitchen”is a concept project based on programmable matter (Harboun, 2012).
Hernandez, Hu, Kung, Hartl, & Akleman (2013) proposed a method to develop complex and reconfigurable 3D surfaces and structures that are assembled from 564
‘programmable’ 2D planar shapes made of self- folding active materials which they call ‘smart multi-use reconfigurable forms’ (Fig. 12). It is also demonstrated in this study that it is possible to form desired shapes by appropriately heating self- folding active materials made from SMA (shape memory alloy) based laminates. The combination of smart materials and origami research to create a self folding sheet has been also investigated by Hawkes et al. (2010).
Figure 12: A constructed model to demonstrate the feasibility of programmable self-folding active materials (Hernandez, Hu, Kung, Hartl, & Akleman, 2013)
CONCLUSION “A house is a machine for living in.” – Vers une Architecture (1923), Le Corbusier Since machines have been the symbol of mankind's mastery over nature for the last hundred years, it is not surprising that our buildings are becoming more and more machine-like, as pioneering modernist architect Le Corbusier said in his famous statement. This statement, which originally means that a house is simply a tool that we use to live, eventually morphs its meaning to fit the rapidly growing and evolving technologies of today. The buildings of today as “machines for living in” are indeed becoming increasingly complex, involving technologically advanced building materials, and mechanical systems for controlling thermal, visual, aural, and even olfactory comfort, interior air quality, lighting and acoustics. These systems, whose utilization largely relies on non-renewable energy, are often expensive to install and energyintensive in operation. While increasing the complexity of buildings is becoming the emerging trend, as stated by many authors, putting more and more machines into our buildings cannot be seen as a good way to solve our problems. Within this sense, introducing adaptivity to building shells can be at first sight considered as being a contradiction, since it usually undeniably increases complexity; but it is not. An adaptive shell does not need to be a state-of-the-art piece of architecture with complex mechanical, electronic systems. The efficiency of adaptive responsiveness does not come from the complexity; on the contrary, it comes from the simplicity based on a clever design of a process. Passive adaptive shells are a good example in point. Today, adaptive shells are radically changing and transforming the traditional way in which buildings are designed. An adaptive shell, 565
– can modify energy flows through the building by regulation, enhancement, attenuation, rejection or entrapment to contribute to energy-saving for heating, cooling, ventilation while maintaining a positive impact on the indoor environmental quality of the building, – can harness natural energies, – can be responsive to our occupation, our needs and even our moods, – can interact with users via their façade, – can be a container for technology, feeding our desire for information, – etc. That is why adaptive shells are sometimes associated with other labels such as ‘responsive’, ‘climate adaptive’, ‘energy efficient’, ‘smart’, ‘intelligent’, ‘media’, ‘kinetic’, ‘interactive’, ‘informative’, ‘cooperative’ etc. Investigating the existing concepts of adaptive building shells whether realized or only conceptual, it is clearly seen that many of them are inspired from nature. Systems found in nature offer a large gamut of strategies and mechanisms that can be implemented in architecture. For example, hygroscopic shape changing adaptation, which is implemented in HygroSkin Meteorosensitive Pavilion, is a fundamentally different, no-tech strategy for passive responsiveness. This type of materially embedded responsiveness strategies is the most promising way to create autonomous, zero energy adaptive shells of the future. In nature, there are still many undiscovered examples of responsive biological systems that can provide potential for novel applications of adaptive shells. REFERENCES Anderson, L. (2012). Biologist-Turned-Architect Invents "Breathing" Metal Building Skin, http://architizer.com/blog/doris-kim-sung-thermo-bimetal/ Beaver, J.; Boucher, A. & Pennington, S. (2007). The Curious Home, Goldsmiths, University of London/Interaction Research Studio. Boillot, N.; Dhoutaut, D. & Bourgeois, J. (2015). Large scale mems robots cooperative map building based on realistic simulation of nano-wireless communications. Nano Communication Networks, 6(2), 51-73. d’Estrée Sterk, T. (2012). Beneficial Change: The Case for Robotics in Architecture. In: Phil Ayres (Ed.) Persistent Modeling: Extending the Role of Architectural Representation. Chapter 13, p.155-169, Routledge: New York. d’Estrée Sterk, T. (2005). Building upon Negroponte: a hybridized model of control suitable for responsive architecture. Automation in construction, 14(2), 225-232. Furuto, A. (2012). Bloom / DO|SU Studio Architecture, http://www.archdaily.com/215280/bloom-dosu-studio-architecture GlassX (2005). Speichern, Wärmen, Kuhlen. http://www.glassx.ch Harboun, M. (2012). Living Kitchen, http://www.michaelharboun.com/livingkitchen.html Hawkes, E.; An, B.; Benbernou, N. M.; Tanaka, H.; Kim, S.; Demaine, E. D.; Rus, D. & Wood, R. J. (2010). Programmable matter by folding. Proceedings of the National Academy of Sciences, 107(28), 12441-12445. Hernandez, E. A. P.; Hu, S.; Kung, H. W.; Hartl, D. & Akleman, E. (2013). Towards building smart self-folding structures. Computers & Graphics, 37(6), 730-742. Khan, O. (2010). Open Columns:A Carbon Dioxide (CO2) Responsive Architecture, In: Mynatt, E., Schoner, D., Fitzpatrick, G., Hudson, S., Edwards, K., and Rodden,T., eds., CHI EA 2010, Association for Computing and Machinery, New York, 4789-4792. 566
Kolodziej P. & Rak J. (2013). Responsive building envelope as a material system of autonomous agents, In Open Systems: Proceedings of the 18th International Conference on Computer-Aided Architectural Design Research in Asia, CAADRIA. Singapore: The Association for Computer-Aided Architectural Design Research in Asia, pp. 945-954 Loonen, R.; Trčka, M.; Cóstola, D. & Hensen, J. L. M. (2013). Climate adaptive building shells: State-of-the-art and future challenges. Renewable and Sustainable Energy Reviews, 25, 483–493. Lopez, M.; Rubio, R.; Martín, S.; Croxford, B. & Jackson, R. (2015). Active materials for adaptive architectural envelopes based on plant adaptation principles. Journal of Facade Design and Engineering, 3(1), 27-38. Meagher, M. (2015). Designing for change: The poetic potential of responsive architecture, Frontiers of Architectural Research, 4: (2), 159-165. Menges, A.; Reichert, S. & Krieg, O. D. (2014). Meteorosensitive Architectures. In: Manuel Kretzer & Ludger Hovestadt (Eds.) ALIVE: Advancements in Adaptive Architecture (Vol. 8). Chapter 3, p.39-42, Birkhäuser: Basel. Negroponte, N. (1975). Soft Architecture Machines. MIT Press, Cambridge. Orhon, A. V. (2012). Akıllı Malzemelerin Mimarlıkta Kullanımı, Ege Mimarlık, 82, p. 1821. Pan, C. & Jeng, T. (2008). Exploring sensing-based kinetic design for responsive architecture. In Conference of Computer-Aided Architectural Design Research in Asia (CAADRIA). Parthenopoulou, N. K. & Malindretos, M. (2016). The Use of Innovative Materials in Innovative Architectural Applications. Combining Forces for High Performance Structures. Materials Today: Proceedings, 3(3), 898-912. Reichert, S.; Menges, A. & Correa, D. (2015). Meteorosensitive Architecture: Biomimetic Building Skins Based on Materially Embedded and Hygroscopically Enabled Responsiveness. Computer-Aided Design, 60, 50-69. Schleicher, S.; Lienhard, J.; Poppinga, S.; Masselter, T.; Speck, T. & Knippers, J. (2011). Adaptive façade shading systems inspired by natural elastic kinematics. In Proceedings of the International Conference on Adaptive Architecture, London. Schnädelbach, H. (2010). Adaptive Architecture-A Conceptual Framework, proceedings of Media City: Interaction of Architecture, Media and Social Phenomena,523-555. Sherbini, K. & Krawczyk, R. (2004). Overview of intelligent architecture. In 1st ASCAAD International Conference, e-Design in Architecture Dhahran, Saudi Arabia, pp. 137-152. Taghaboni, A. (2014) Sharifi-ha House / Nextoffice - Alireza Taghaboni, http://www.archdaily.com/522344/sharifi-ha-house-nextoffice Toffoli, T. & Margolus, N. (1991). Programmable matter: concepts and realization. Physica D: Nonlinear Phenomena, 47(1), 263-272. Verma, S. &Devadass, P. (2013). adaptive[skins]: Responsive building skin systems based on tensegrity principles, Future Traditions: 1steCAADe Regional International Workshop, April 4-5, 2013, Porto, Proceedings p. 155-170.
567
Chapter 40 Planning for Livable Cities Ümmügülsüm TER, Sevde DERMAN, Mete ADIGÜZEL** 1. INTRODUCTION
“The city must guarantee everybody the best possible development under conditions of freedom and safety and thus it becomes a specific goal to fit the city to man. We always have to think how the city can best be built to fit human needs.” C. A. Doxiadis, (cited in Pressman, N., 1981.) Today, more than half of the world’s population lives in cities. In the face of rapidly increasing population and uncontrolled growth, social and environmental problems encountered in cities reduce quality of life significantly. As the natural outcome of changing dynamics, urban space is transformed swiftly. Following the negative impacts experienced in the biggest cities in the world after the Industrial Revolution, residential areas with high numbers of population had been started to be placed outside the cities as part of the search for seeking alternative settlement areas. The phenomenon of sprawling outside the city in order to have a better quality of life brought with it increased dependency on cars, dawn of problems from the relation between workplace and residential areas, emergence of decaying urban areas, social segregation, loss of unique identity. Through the physical interventions, the urban space has started to be seen through a consumption focused perspective. Cities, whose scale have changed in quantity and quality through urban growth and development especially in the recent years, have become unable to answer to the needs of today’s urban society in terms of social amenities and infrastructure. In this context, cities, which have been left to unqualified urban plans-designs and societal alienation, have been left unattended. Urban spaces also constitute the sources of environmental problems due to the mobility, internal dynamics and activities they accomodate. While the beginning of the 21st century has been a turning point in which technological and industrial development were peaked, disruption of ecological balance and depletion of natural resources were the costs of these developments. These developments, that negatively affect the quality of urban life, led to the emergence and increased significance of the term livability which approaches urban space in a holistic manner. 2.SUSTAINABILITY, QUALITY OF LIFE, LIVABILITY Started to be used within the second half of the 20th century, terms “livability”, “quality of life”, “livable environment”, “quality of space” and “sustainability” have
Assoc. Prof. Dr., Necmettin Erbakan University, Faculty of Engineering and Architecture, Department of City and Regional Planning Res. Assist., Necmettin Erbakan University, Faculty of Engineering and Architecture, Department of City and Regional Planning
been used simultaneously and synonymously most of the time (Van Kamp, Leidelmeijer, Marsman & Hollander, 2003). The concept of livability, which has no exact and universal definition, is described by Pacione (1990) as “livability is a quality that is not an attribute inherent in the environment but is behaviour-related function of the intersection between environmental characteristics and personal characteristics”. On the other hand, Newman (1999) states that livability is a requirement for social peace, comfort and health and encompasses both individual and societal wealth. In this context, livability can be described as a concept that defines the relation and the unity among human-environment-society-settlement (Ayataç, 2014). Jane Jacobs, who pointed out the livability concept with her book “The Death and Life of Great American Cities” that released in 1961, narrates how the living environment is perceived by its inhabitants, through her observations and experiences. Jacobs, who highlights the importance of societal relations in formation of physical, social and economic environments of cities, states that cities are not simply a built environment and, thus, to also manifest their social and economic livability, there is a need for a revision of cities’ existing planning principles. Many researchers who study subjects on space and society, reveal how concept of livability is related to the way society uses social environment and physical space, and highlight societal demand as the first and foremost among the indicators for livability. Livability is defined by success criteria, which are agreed upon by societies, to be met by a settlement for it to be defined as good/high quality/healthy. Being safe and comfortable, having easy accessibility opportunities within the city and absence of negative environmental factors such as air and noise pollution can be counted as success criteria for urban areas. These criteria were described at the United Nations Human Settlements Conference Habitat II that was held in Istanbul in 1996. Following the 1950s, the concept of livability has started to be used simultaneously or synonymously with concepts of “livable city”, “quality of life”, “sustainability”. These terms have taken their place both as a key concept of governments’ approach to planning system in most of the advanced countries in the world and as a worldview that aims to meet the economic, environmental and societal needs without harming the living conditions of next generations. Among these concepts, sustainability came to the fore for the first time with the Brundtland Report prepared by World Commission on Environment and Development in 1987. In the report, sustainability is defined as “Humanity has the ability to make development sustainable to ensure that it meets the needs of the present without compromising the ability of future generations to meet their own needs.” Sustainability is a requirement to be realized in order to reach the aims of an developed environment. As for urban sustainability, the idea of increasing the livability of cities is the dominant vision to be focused on for settlements (Oktay, 2007). Sustainability is a key concept that aims high efficiency and foresees the undisrupted continuity of functions of any existing societal, economic and ecological system without harming and depleting the resources used (Atıl et al., 2005). In the achievement of development in sustainable cities, the main motive is to increase quality of life, while developing envrironmental policies at the same time, to reach the projected socioeconomical level. The concept has reached to a stage in which decisions on a large scale are also being taken in the fields of planning, economy and ecology (Brundtland, 1987). 569
The livability concept, closely associated with sustainability, has become increasingly important and necessary as a result of increasing emphasis on research and practices about sustainability. Research on quality of life is becoming a favorable tool to realize sustainable practices based on policies that rely on scientific data, especially in the fields of urban planning, transformation and planning of residential areas. Using scientific and measureable data as a basis and utilizing it holds vital importance in the practices about sustainability. In the Agenda 21 Report of United Nations, the development of tools that allow measurement of various indicators of quality of life such as health, education, social welfare, environment and economic level has been noted as a necessity for countries (United Nations Conference on Environment and Development (UNCED), 1993). While there is a strong relation between the factors that exist around the social environment of an individual and the standard of living, the satisfaction an individual gets from his/her living space and environment, the presence of urban amenities and services, as well as the standard of living defined by urban economy is also reflected on quality of life and, thus, on livability. Physical environment is evaluated on a degree that an individual understands, perceives, uses it and/or howmuch his/her necessities and expectations are fulfilled. It can be said that lesser the deficiencies perceived by an individual, higher the satisfaction from his/her life and the space he lives in. Environments that are appreciated are considered more livable. Therefore, in the livable environments, besides the measurable spatial, physical and social components and the forms of perceiving these components, their individiual effects have to be considered as well.
Figure 1: Quality of life components (Mitchell, 2000). 570
Kamp et al. (2003) adress the subjects “environmental quality” and “human wellbeing” through a comprehensive literature review and discuss concepts with different definitions in a comparative manner. In the study, urban planners are noted to have clear perspectives regarding quality of environment based on concept and time. Mitchell (2000) discuss various factors that affect quality of life in his study and summarize them as can be seen in Figure 1. In the study, in which physical environment is also included among the factors, the effect of recreation and leisure activities on individual development are considered. The concepts of physical environment and individual development, which are accepted to be directly in relation with quality of life, are researched and substantiated by many researchers through field studies. The main motive for human-oriented urban planning is to plan the best area to live in or plan livable areas that will increase the satisfaction of living. Llewelyn Davies Yeang, despite the complexity of livability and quality of life concepts, expresses that livability encompasses various components ranging from education to security in their report. Contrary to general definitions, it is noted that livability is related to quality of place; physical environment; sense of place; generation of satisfaction; attractive, practical and safe environment. In order to address livability, 13 parameters are presented under 4 main topics (Table 1) (Llewelyn Davies Yeang, 2006). Table 1. Dimensions of Livability A. Environmental Quality 1. Is it noisy? – Is it silent? 2. Is it polluted? – Is it clean? 3. Is it crowded? – Is it less crowded? 4. Building quality / Is it sufficient? – Is it poor? B. Physical Quality of Place 5. Quality of built environment 6. Quality level of derelict space 7. Quality of parks and green areas 8. Quality of public space C. Functional Quality of Place 9. Mobility of pedestrians / Is it easy? – Is it difficult? 10. Quality of public transportation 11. Liveliness and livability of services D. Safe Places 12. Crime rates 13. Non-social behaviour
By ignoring human element and the relation between human and space, physical space has become the focus in the studies regarding spatial planning and having a good or beautiful physical space came to signify having a good quality of life. However, on the contrary, establishing a relation and forming emotional bonds between human and space is an important sign of a high quality urban life. These kinds of spaces are places where people can establish relations and connect with each other, establish a sense of belonging to it, identify themselves with it, remember and long for it (Mazumdar, 2003). Therefore, livable cities are a result of evaluation of a space’s physical attributes in conjunction with its social, psychological and cultural components, and planning of it 571
in regard of this evaluation. For urban quality of life and delivery quality of urban services to be higher than predetermined measurements means realization of modern urban and environmental standards in a city. Cities that meet the criteria and have a high quality of life have to meet the requirements for livability, sustainability and healthy cities in order to have that high urban quality of life. 2.LIVABLE CITY The concept of “Livable City” is associated with the population and the size of a living environment by a few theorists since Platon, while others during Greek civilization related it with the governance of a city through an active participation in which city dwellers could face each other (Pacione, 2005; Newman and Kenworthy, 1999). On the other hand, livability finds meaning through health and employment opportunities, level of income, good residential areas, education opportunities, the presence of shopping and entertainment activities, other social opportunities, accessibility, public spaces and societal concepts in our age. For the livability of cities, finding out the sources of environmental degredation, accessibility of basic environmental and sheltering services for urban poor, reduction of being affected from environmental dangers have to become priority fields of study (Ayataç, 2014). As can be understood from the World Bank’s definition of livable city; it should provide “healthy and honourable living environment”. In the context of the economic and social changes/advancements happening in cities, quality of environment and life in existing and newly formed urban areas is a subject that should be addressed in a sensible manner. While quality of environment and life are related to natural and built environment attributes focused on sustainability approach, they are associated with urban equipment and amenities rather than constant factors such as protection of natural resources, climate, ecology etc.; there are also subjective and difficult to measure factors like sense of place and belonging, legibility, collective memory. Other than these, living standards determined by urban economy also reflect the quality of life in a city (Tekeli, 2004). In the search of quality in urban environments, which objective attributes define a livable environment is important to determine. Lynch (1981), in his book named “A Theory of Good City Form”, defines 5 components for a livable environment. These are; vitality – healthy environment; sense of place – identity; fit – a setting’s adaptability; access – to people, activities, resources, places, and information; control – responsible control of the environment. Lynch underlines that urban designs and practices of these designs undertaken in line with these components will be effective in producing livable urban spaces in terms of both better visibility and satisfaction from a psychological standpoint. Smith et al. (1997), based on the components Lynch notes in his book, highlight livability as the most important parameter in the making of high quality places, and under livability concept, they define survival, personal health and development, healthy environment, comfort, security and safety as sub-components. Survival is one of the most basic indicators of livability which includes breathing, eating, drinking, sheltering, wearing and ability to move to fulfill basic necessities. On the other hand, a high quality environment supports various opportunities to be healthy, to ensure physiological and psychological development and to sustain an active living. As for people to utilize these 572
opportunities and sustain active lives in a healthy environment, security has to be assured (Smith et al., 1997). Under all these main criteria, formation of livable cities as centers of attraction that provide high quality infrastructure, communication, transportation and security services, clean air, social opportunities, spatial planning studies regarding green areas, well-educated human resources and necessary technological units to provide economic development, is aimed. Among these main criteria, policies to develop transportation play the key role in the enhancement of livability. In order to create a livable, healthy environment, human-oriented transportation strategies have to be developed in the first place. 2.1.Indicators of Livability and The Most Livable Cities in the World Livable cities can be described as places where planning is human-oriented, healthy and secure living environment is provided, clear and comfortable physical environment exists, natural resources are protected, urban open and green spaces are sufficient, accesibility is high, people are happy to live in and feel commitment to them. Measuring livability through only a few criteria is impossible to accomplish. Although there are many criteria in designation of livable cities, these criteria change according to years and spaces, and different factors come to emerge. Most of the mentioned criteria also show variances based on country, as the criteria of many countries are not suitable for foreign customs, way of livings and urban environments. Therefore, livability criteria have to be decided based on locality. In fact, city dwellers’ expectations from life and city are important for these criteria’s suitability and measurability as well. As a result of policies developed anew each year, new livable cities arise and get ahead of others in various fields. When literature is reviewed, many studies have been conducted to observe how these indicators are shaped from past to present day and there have been many to describe livability in various forms in terms of place, space and time (Table 2) (Yorulmaz, 2013). In general, criteria such as economy, health, education, security, urban life, culture and arts are the main titles to measure livability of a city. That said, specific titles such as political stability, crime rates, transportation criteria, urbanism, metropolitan life and urban culture, likeability of a city, opportunities provided by a city to its inhabitants, cities that live in the morning or at night, which are specified by various institutions that measure livability according to their own policies, also play important role in determining a city’s livability. All these criteria are transformed and renewed based on political, economic, climactic factors happening at the time. Each of the concepts like quality of life, sustainability, livability, walkability has drawn varying interest around the world and there are various studies and practices conducted over these principles. Among them, Copenhagen (Denmark), Melbourne (Australia), Toronto (Canada), Curitiba (Brazil) came to be the most known and successful practices. 2.1.1.Copenhagen Copenhagen, as one of the most lively cities in Europe, is home to various dynamics. The city, according to a quality of life research conducted worldwide based on 39 indicators (Mercer Human Resource Consulting), is designated as the 8th city in terms of quality of life and livability. The success of the city is a result of detailed thinking over the reflection of living on urban conditions and serious work over this subject.
573
574
Table 2: Livability indicators which have been developed in the historical process (Yorulmaz, 2013).
Limitation on vehicle usage is implemented in most of the cities in Europe. Similar practice can be seen in Copenhagen and in addition to that, there is a highly advanced public transportation system and high quality infrastructure in general which prevent disruption of traffic. Particularly, various innovative solutions have also been developed against the potential nuisances that may arise as a result of these limitations. In the revitalization of city center, instead of solutions based on supporting vehicle traffic, infrastructure practices that will allow a variety of transportation modes have been adopted. Planning approach that feature making Copenhagen attractive for pedestrians and making driving more difficult, is the most important factor in the creation of the comfortable environment that exist around the city. In the city center, where the pedestrianization has been started in 1962 for the first time, a new urban island has been pedestrianized each year and connected to the priorly pedestrianized area, while roads left their places to bicycle lanes and as a result, one-third of the transportation has been made by bicycles even during the winters. This is a strong indicator of how much people have adopted this mode of transportation (URL 1).
Figure 2. Livable Outdoor Space in Copenhagen and Bycle Usage.
Copenhagen, which was European Green Capital in 2014, provide its inhabitants clean air, advanced infrastructure for renewable energy resources and a strong green area system besides convenient transportation. Bicycle lanes and hiking trails exist between wetlands, forests and rivers in Copenhagen where green area system reach towards city center in a finger form. There is approximately 20-40 m2 green area per person in the city. Parks, playgrounds, green and cultural areas are integrated with green networks and, thus, their accessibility by pedestrians and bicycles is increased. As urban agriculture is given importance in the city, urban gardening, hobby gardening and floriculture is promoted. Moreover, as one of the leading cities in organic agriculture, 20% of the food consumed by citizens and 90% of the food consumed by public sector 575
is consisted of organic food (URL 2). Copenhagen, which reduced its carbon emissions by 20% to this day, aims to become the first carbon-neutral capital in the world. Vehicles without at least C energy efficiency class are prohibited from traffic in order to prevent air pollution born out of traffic. In addition to that, Copenhagen, as the sole capital to produce 31% of its electricity from wind, aims to increase this ratio to 50% by 2020 (URL 2). There are strict standards regarding the consumption of heating, cooling and hot water in newly built structures. Also, there are noise measurements undertaken in order to reduce noise pollution and noise maps are being drawn. There are precautions being taken to prevent noises originating from transportation and entertainment (URL 2). In addition to these, separated collection of wastes and recycling is being carried out in Copenhagen. There are also separate collection services for residual oil, battery and electronic waste besides the ones for glass, paper, metal and plastic. Reusing kitchen waste as biogas is being promoted. Copenhagen recycles 58% of its waste and reuse 40% of it in urban heating system (URL 2). 2.1.2.Melbourne Together with the advancing technology, changing world trends and cities under its effect are being shaped by new demands of the technological society. Changing demography, economy and environmental factors will be affecting the whole planning process of cities. Plans drawn according to good evaluation of these changes in order to adapt to the future, play an important role in Melbourne becoming one of the most livable cities. In order to make Melbourne livable, strong transportation strategies designate the key policies and aims oriented towards planning process. Transportation by walking or cycling is possible in the city for 24 hours a day. 800.000 people move about by these means within the city each day and this number is expected to reach 1 million by the year 2030. Strategies regarding transportation in the city are addressed under 6 key headings. Integrated implementation of transportation and land use planning Ensuring accessibility by public transportation to anywhere in the city between any time period Turning Melbourne into a bicycle city Infrastructure operations to increase the transport efficiency of the roads within Melbourne Development of streets which are pedestrian-friendly and supported by strong public transportation Adoption of innovative approaches towards transportation, especially in the city center (URL 3). The city of Melbourne faces threats such as climate change, urban heat island effect and rapid population increase. These are important factors that may affect built environment, urban services and quality of life in the city. For this reason, there is a strong emphasis on green area planning in the city. Thanks to this emphasis, both the air quality in the city is improved and activity areas that positively impact mental health are being arranged. Ethisphere Institute has designated Melbourne as the 6th among the 10 most sustainable cities in the world. This ended up as a sufficient study to name Melbourne as the Global Sustainability Center 2020. Institute considers criteria like 576
economic potentials and quality of life in its evaluation and Melbourne is especially successful in terms of sustainability. Also, Australia Conservation Foundation has selected Melbourne as the 7th most sustainable city among the Australian cities (URL 4). Melbourne, thanks to its active ports, is the 14th most economically active city among 150 metropolitan areas. Other than economic activity, Melbourne is also considered as an important tourism destination and a center for business trips.
Figure 3. Open and Green Space in Melbourne and Rail Transport System.
2.1.3.Toronto Toronto, previously a car-oriented city similar to American cities, became one of the most livable cities in the world today by its advanced transit services, revitalized city center, prevented urban sprawl (by density planning) and inclusion of dynamics and people from various cultures. The changes experienced in Toronto have been realized through remarks and guidances from Jane Jacobs’ book “The Death and Life of Great American Cities” (1961).
Figure 4. Urban Structure of Toronto.
Jacobs, regarding the development of Toronto, highlighted the importance of several attributes such as respect of citizens towards the organic composition of the city, the development of urban characteristics according to structural and functional density, rediscovery of city center and public spaces, dangers of car-oriented urban planning and benefits of transit-oriented planning, and the concept of urban community, and she also started public movements towards the realization of these aims. The politicians’ adoption and promotion of this awareness movement started by Jacobs, led to Toronto’s 577
becoming one of the most livable and dynamic cities in North America and being shown as a model for the rest of the big cities in the continent (URL 5). The main planning aims in reaching this success have been; promotion of flexible uses, conservation of the city’s historical legacy while developing new forms, adding new functions to the existing buildings and reusing them, providing new public spaces to the citizens, creating high quality living and working environment, and adoption of integrative planning approach. 2.1.4.Curitiba City of Curitiba is seen as one of the most successful sustainable planning examples in the recent years. Despite in a developing country that faces many problems, the city that has reached high quality of life is an example to many cities in the world in that regard. Since the year 1854 when it was declared as the capital of Parana province to the south of Brazil, there have been many masterplans prepared for the city to prevent uncontrolled growth. On this subject, one of the most important people for the city is Jamie Lerner due to his contributions in the year 1964. Lerner saw the city not as a politician but as an architect and as an urban planner, and provided the logical and conceptual basis in the creation of today’s Curitiba (Barth, 2015). Especially due to the rapid population increase in the last 20 years, the city, in which social, economic and environmental problems have peaked, has been awarded “Sustainable City Award” in 2010 thanks to its planning approach. The most important factors in reaching this success are the integrative and versatile urban planning, the reduction of traffic at the city center, conservation of historical quarters, realization of cheap and practical public transportation systems and development of practical design solutions suitable to various purposes.
Figure 5. Curitiba Public Transportation Systems.
In the development of Curitiba, the effect of public transportation by busses holds great significance. The reason why busses are opted for is to reduce transportation costs as much as possible. Bus system is designated based on its service area and speed of accessibility and differentiated with colour schemes. Red for faster busses, green for interregional busses and yellow for traditional busses have been used. In 1980, transportation is possible with a single fee between any two point in the city thanks to the establishment of RIT (Rede Integrada de Transporte: Integrated Transportation Network). This system is being used by 85% of the population of Curitiba and contributed in reducing the traffic for 30%. While the system reduces fuel usage and air pollution, it also prevents environmental losses in urban transportation (URL 6). Curitiba has shown great success in the implementation of environment-friendly policies and it is possible to say that the larger share of this success rest on the citizens’ 578
contributions. Works towards conserving and increasing the green areas of the city have been started by 2010 in order to create 52 m2 green area per person and this environmental vision has been realized together with the participation of citizens. Inhabitants of the city which is known as the ecological capital of Brazil, have planted approximately 1.5 million trees a year, which became a model that shows requirements of citizen awareness to the rest of the world cities’ inhabitants (URL 7). Curitiba also has a highly disciplined sustainability approach in waste management. Almost 70% of the city’s wastes are being recycled by the public before they even turn into wastes. The paper recycling undertaken in the city prevents 1200 trees to be cut down in average each year. The sewage treatment systems of the city, on the other hand, are being used in the water treatment systems in the ponds of the region to prevent seasonal overflows and floods. New ponds created in the parks assist in the prevention of overflows and floods with this system (www.theecologist.org, 2016). Besides all these, Municipality of Curitiba has created various centers, which provide education to public and accomodate libraries, internet centers and other varying social activities, in order to realize the aims of increasing the quality of life of public both in physical and social terms. Employment finding programmes and sustainable income principles are being practiced in every operation of the municipality and social programmes provide opportunities especially for the poor. 3.CONCLUSION Changing technological, economic, and sociological dynamics are causing rapid transformations in the urban areas. In this process, the relations between urban space and behaviours of individuals are being ignored. While the cities are heading towards a consumption based formation as a result of all these changes, individuals’ mobility and behaviours in the urban areas bring up new challenges with it. In this context, the subject of livability in urban areas gains emphasis. Urban policies have to be developed for cities to be more livable spaces. Especially in urban planning, development of integrated solutions to problems through human-oriented planning approach will play a considerably significant role in cities’ becoming more active, dynamic and livable. Today, cities spread on much wider areas and, thus, distances also increase. In making the cities more livable places, making the mobility of individuals around the city easier, increasing the accessibility and creating walkable spaces are important elements. Enhancement of urban quality of life will be contributed to with the development of policies on public transportation integrated with pedestrian and bicycle transportation. Improving a city’s transportation and providing high quality transportation services is one of the vital elements that make that city livable to its inhabitants. In carrying out studies on increasing the quality of life, it can be seen that walkability, livability, sustainability and urban quality of life are concepts that cannot be addressed separately. When the transportation sector is observed, multi-modal integrated transportation systems are being organized in the cities with successful public transportation and walkability is given priority especially in city centers. This situation shows that walkability is one of the irreplaceable components of a livable city. Other than that, it is necessary to realize highest accessibility in neighbourhoods, city centers and urban areas in a livable city. In this process, besides promoting city dwellers to walk, sustainability in transportation gains significance for reducing noise and air 579
pollution as well. Increasing density of cities also bring with it a few negative consequences on air quality. When the world is observed in general, cities are responsible for 70% of emissions originating from use of energy. When technology and infrastructure meets correct planning and vision, smart, sustainable and livable cities can be achieved. Separating the concepts of quality of life, sustainability and livability is not possible. In this context, in order to increase the quality of life of a city, it is necessary to develop that city as a sustainable one. As a result of these, having people to lead their lives in a health environment has become the aim and this is one of the indispensable aspects of a livable city. In fact, one of the most important components of this healthy environment is the places where individuals socialize, meaning parks and active green areas. These areas act as lungs of cities as well as provide opportunities to individuals to find themselves a place in social life. Livability measurements are consisted of objective and subjective data. Therefore, it is meaningless to designate same livability criteria everywhere. While data on education, health, economy, security, crime rates which are measured according to numerical data compose important basis for evaluation of livability; urban life, social life, culture and arts, likeability of the city, individuals’ expectations from the city and other local dynamics are other indicators to be integrated with numerical ones in the final evaluation. In a study to measure livability, locality standards should also be taken into accordance to evaluate the results, indicators have to be interpreted correctly, and during the reformation of cities, demands and regards of citizens have to be taken into consideration in every step of planning, and activities located in a city have to be organized according to them. Participatory planning approach, sustainability and livability are important tools that can provide development of innovative solutions by bringing different perspectives to the problems that could not be solved by planners and local governments in the planning of cities. At this point, it is important to approach to the concept of livability in a suitable perspective. Livability has to be considered with an approach on the level of urban design and planning principles, and be integrated to planning. Urban quality of life is an important factor that affect individuals’ lifestyle, physical and mental health, and especially the effect of built environment is highly significant at this point. When the livable cities around the world are observed, active and successful transportation systems, economic stability, security, high quality environment and air, successful social services stand out in specific. Development of transportation policies to enhance accessibility, adoption of environment-friendly policies, adoption of principle of sustainability in waste management and improvement of services that regulate social life are strategic interventions to be made on a city. Frequency of use of urban spaces and their quality hold considerable significance for people to describe the city they live in as livable or not. For urban areas to provide variety of activities, to have higher accessibility and to have areas that strive at night make a city lively, attractive, secure and a place where high quality of life is provided. The most effective way to measure whether cities in their entirety and urban spaces themselves are successful or not is the user satisfaction. If individuals are content with the spaces they use, this increases the likeability and place attachment of a city. For the livability to be defined at this point, primarily those who live in a city have to love that city and be glad of its built environment. 580
REFERENCES Atıl, A., Gülgün, B. ve Yörük, İ. (2005). Sürdürülebilir Kentler ve Peyzaj Mimarlıgı. Ege Üniversitesi Ziraat Fakültesi Dergisi, 42(2);215-226. Ayataç, H., (2014). “Yaşanabilir Şehirlerin Planlanması İçin Temel Belirleyiciler”, İstanbul. Brundtland, G. (1987). Ortak Gelecegimiz, Dünya Çevre Kalkınma Komisyonu Raporu, Oxford Üniversitesi Yayını. Habitat II. (1996). Environmentally sustainable, healthy and liveable human settlements. UN Documents. İstanbul. İnceoğlu, M., Aytuğ, A. (2009). Kentsel Mekanda Kalite Kavramı. MEGARON,4(3), 131-146.
Jacobs, J. (1961). The Death and Life of Great American Cities. New York: Random House. Llewelyn Davies Yeang, (2006). Quality of place: The North’s Residential Offer Phase IIa Report, Llewelyn Davies Yeang Architecture Planning Design, UK. Lynch K. (1981). A theory of good city form, MIT Press, Cambridge, MA. Mazumdar, S. (2003). Sense of Place Considerations for Quality of Urban Life. International Conference on Quality of Urban Life: Policy Versus Practise, (s. 83-97). Istanbul, Turkey. Mitchell, G. (2000). Indicators as tools to guide progresson the sustainable development pathway. In: Lawrence, R.J. (Ed.), Sustaining Human Settlement: A Challenge for the New Millennium, Urban International Press, pp.55-104. Newman, P.W.G. (1999). Sustainability and cities: extending the metabolism model. Landscape and Urban Planning, 44 [4], 219-226. Newman, P. (1999). Sustainability and Cities: Overcoming Automobile Dependence. Washington DC: Island Press. Oktay, D. (2007, Mayıs-Haziran). Kentsel Yaşam Kalitesi: Sürdürülebilrilik, Yaşanılabilirlik ve Kentsel Yaşam Kalitesi. Mimarlık Dergisi (335). Pacione M. (1990). Urban livability: a review. Urban Geography 11 [1], 1-30 Pacione, M. (2005). Urban Geography: A Global Perspective”, Routledge, New York Smith, T., Nelischer, M., Perkins, N. (1997). Quality of an urban community: a framework for understanding the relationship between quality and physical form, Landscape Urban Planning, 39 (2–3), 229–241 Tekeli, İ. (2001). Sürdürülebilirlik Kavramı Üzerine İrdelemeler. Ankara, Türkiye: Mülkiyeliler Birliği Yayınları. Tekeli, İ. (2004). Yaşam Kalitesi Göstergeleri: Türkiye İçin Bir Veri Sistemi Önerisi. TUBA Raporları, Ankara. United Nations Conference on Environment and Development (UNCED). (1993). Agenda 21: Program for Action on Sustainable Development. New York, United Nations. URL 1 http://denmark.dk/en/green-living/copenhagen/green-capital, (2016). URL 2. ec.europa.eu/environment/europeangreencapital/winning-cities72014-copenhagen/ URL 3. http://www.melbourne.vic.gov.au/parking-and-transport/transport-planningprojects/Pages/transport-strategy.aspx, (2016). URL 4. ttp://www.melbourne.vic.gov.au/Pages/Plans-and-publications.aspx, (2016). URL 5. www.math.toronto.edu/toronto, (2016).URL URL 6. http://www.ekoyapidergisi.org/632-surdurulebilir-sehirler-icin-bir-model-curitiba.htm. URL: http://denmark.dk (01.06.2016). Van Kamp, I., Leidelmeijer, K., Marsman, G., & Hollander, A. (2003). Urban Environmental Quality and Human Well-Being Towards a Conceptual Framework and Demarcation of Concepts; A Literature Study. Landscape and Urban Plan (65), 5-18. Yorulmaz, H. (2013). Liveability In Urban Spaces: The Case of Orhangazi Urban Square, MSc Thesis, The Graduate School of Natural and Applied Sciences, Middle East Technical University.
581
Chapter 41 Buildings After Republic in Balıkesir City Center Timur KAPROL 1. INTRODUCTION In the history of our cities after Republic, we can read the evolution of the changing Turkish family structure through the plans of the buildings which were built as products of the economic, cultural and social structuring of the eras they were built in. Buildings that reflect the social acclaim, economic opportunities and cultural formation of the eras they were built in by years of built are the architectural documents of their own eras. Three historical elements of the architecture of Balıkesir City, ‘Kula’, ‘Pura’ and ‘Kabakçılar’ Buildings are the traces of the socio-cultural and socio-economic development of the renewal and modernization of Turkish Republic. In this article, socio-cultural and socio-economic values and traces of the socio-cultural facts in architecture of these three houses which were built in Balıkesir in the mid-way through 20th Century were researched and common architectural features of these buildings were studied with reference to information and data about these houses by using ‘Structure Analysis, a sociological method used in studying the architectural identities of the houses. 2. APPLICATION OF THE STRUCTURE ANALYSIS METHOD IN THE STUDY As there has been a mutual and interconnecting relation between social structure/life and sociology institutions, while new formations that have occurred in social structure provided opportunities for emergence and development of new theories, these theories on the other hand have contributed to explanation and restructuring of social structure (Kızılçelik,2000). Within this motion, particularly the plans of the houses in which people spend significant parts of their lives can be considered as data in architecture. Vital necessities of the times define a distinctive spatial pattern in domestic architecture as a result of their interaction with the social structure. In sociology, “basic research searches whether certain theories are correct or wrong and aims to develop new theories with reference to the acceptance that basic research has to be “theoretically” valid” (Çelebi, 2001). While scientists approach the subject with the purpose of “know to know” in basic researches, they approach the subject with the purpose of “know to benefit” in applied (needs) researches (Arslantürk,2001). However, the subject where these two researches combine is attaining the knowledge of socio-cultural reality and as a matter of fact, these two researches feed each other. Social structure analysis which is a basic-applied research in sociology might be helpful in architecture with reference to the thought that space setups have their own
Assist. Prof. Dr., Department of Architecture, Namık Kemal University, Tekirdağ, Turkey.
identities. This article aims to add depth to the subject with the analysis of the impacts of social facts of the eras on the building design approaches by examining three of the houses of the era. In “Bir Analiz Modeli Denemesi (An Assey on Analysis Model)” of B. Dikeçligil, features of the structures regarding their types were determined before establishing a model and thereby, these structures were interpreted sociologically. In the study which was about basic researches, application of quantitative and qualitative method was discussed. Five features of the study are presented below. Although these five features aim to review the behavior of the society in macro scale, they also help to explain the social facts that are determinant in planning of the buildings when they are applied particularly to building analysis (Dikeçligil,1997). Pieces or elements that have no common features whatsoever don’t compose a structure. The areas of a building, the parts that form it, affect formation of all parts. In space definition, these elements provide help both in functional sense and in design of the architecture of the building in third dimension and such element appear before us with their identities in both city walls and in city silhouette. Structure comprises of the (relatively) steady relations between a part and the whole. In terms of inner spaces, it’s observed that there is a steady relation between spaces belonging to the house and the areas shared by the houses. In order to develop an analysis model in accordance with the mentioned features, basic acceptances of the harmonizing approach were determined as below (Dikeçligil,1997). First Basic Acceptance: Between the individual and the society, there is a mutual interaction rather than a one-sided relation in which one determines the other. As to houses, houses have macro scaled interaction with the city they are in with the space they occupy and the social life they integrate in the city while they have micro-scaled interaction with the city with the spatial array formed by the needs of the users and in terms of third dimension setup. Second Basic Acceptance: Socio-cultural facts have interconnected, intertwined three-dimensional structures. Changes in the society like women entering business life changed particularly the operating characteristic the houses assumed in previous centuries and as a result of lives in which products manufactured abroad are consumed more than inland products, in which lives are spent more outside than in houses, in which spatial designs required modifications for the times spent in houses, it became a necessity for the intertwined life setup to identify the spaces. Wet areas started to be designed within the houses, spaces that took places in the cupboards in the rooms as bathing places started to take places in the houses as parent’s bathrooms. Cellars, storerooms which were placed near the kitchens before started to appear in house spaces. On the basis of this development, it can be said that people formed their new houses within the context of customs and traditions coming from the past. Third Basic Acceptance: principle of impartibility of social and cultural things Sense of privacy which is particularly prevailing in Turkish society is a social and 583
cultural return in building plan. Guest room solutions with entrances from the outside are the indicators of social and cultural impartibility in the building plan. Fourth Basic Acceptance: In a sociological analysis, “existing/happening” and “should exist/should happen” should be separated. Achieving the contemporary living conditions that should be achieved in the time the house is built is what should happen, while what happens is that the house is designed within the context of sociocultural data on the basis of customs and traditions. Fifth Basic Acceptance: In order to obtain scientific knowledge, world of sociocultural facts should be understood and explained. While structuring of Turkish Republic continued in the mid-way through 20th Century, both economic and cultural lives were formed. All these formations have affected the life and brought new space setups. 3. URBAN DEVELOPMENT OF BALIKESİR IN REPUBLIC PERIOD Before the Republic Period, Balıkesir had a bright trade life because it was on an important route of Western Anatolia that connected Istanbul and Bursa to Izmir. Following the formation of Milli Kuvvetler District before proclamation of the republic, Vasıf Çınar District came into prominence during 1930s. Kabakçı, Pura and Kula buildings discussed in this study are located in the area which was formed between Vasıf Çınar District and Anafartalar District after proclamation of the republic.
Figure 1: Urban map of Balıkesir and locations of the discussed buildings
4. REFLECTION OF SOCIAL LIFE TO HOUSE IN PART AND WHOLE RELATION Similar characteristics of the structures that contain pieces with similar features are the pattern of the interactions that form them. From the discourse that this pattern contains steady relations between the part and the whole, life style has changed as a result of the transformation from patriarchal family to nuclear family and earthbound agricultural society transformed to a social life based on industry (Dikeçligil,1997). Changing of social life and narrowing of the family size provided the opportunity to live together (Stewing,1986). Since more than one house being together brought communal life, public domains and private areas have developed in the buildings. 4.1 Areas within the Buildings Social structure that has changed with the republic required solutions for wet areas like kitchen or toilet which have been located outside of the building in traditional architecture. Design of the area that featured such function and the relations between 584
spaces affected the spatial organization. Indoors of the houses with certain characteristics were examined separately for analyzing the fact experienced in new structure. Entrance hall; Regarding the sofa that was seen in traditional architecture, with the rapid and new structuring that has started in the cities after Republic, inner sofa became narrower and transformed to corridor while middle sofa became narrower and transformed to a hall that solely provides passing from one space to another (Eruzun,1985). In the Kabakçı building, hall takes place in the middle and is connected to the living room with a glazed door. In addition to serving as a travelling area, entrance hall which is sized in accordance with the size of the house it’s in also serves for additional functions. Functions of the hall have become separating to go to the rooms and eating. Usage of the entrance hall has transferred to middle area usage in which life continues. In this formation, sofa that has come from the traditional has been modernized and used in contemporary house of the time. Room connections; In two of the discussed three buildings, doors were used for passing from one room to another. These doors provide privacy between the rooms and in addition to increasing the functionality, these doors provide passing from one room to another in Kula building while it connects the entrance hall to the room in Kabakçı building. Room with the outdoor entrance; When designs of the houses in this era are reviewed, rooms that are entered in from the landing rather than through entrance hall are observed. Among these three structures, particularly Kabakçı building has a similar setting. The guest room having two separate doors to the entrance and to the hall refers to this design. Having an opening to the guest without entering in the house, this room is a reflection of a life style originating from traditional. This room is virtually the adapted version of separation area for rooms exclusively for women and men to the new life style. Cellar; This section that takes place in Kabakçı and Pura houses is used as storage and entered from the kitchen. Originating from the traditional house design, this area can be seen in this era in building designs developed by one of the significant architectures of the era, Sedad Hakkı Eldem through modernization of the traditional design (Eldem, 1984) Pura Building Kabakçı Building Kula Building
Figure 2: Storey plans of the discussed buildings
Wet Area; As a return of the changing life, kitchen and toilet are located within the house. The toilet which has been located outside the house in traditional house is organized at the same level with the rooms and in relation with them. The bathing 585
function which has been located in inbuilt cupboards in traditional house was solved with bathrooms in new house. In addition to and in parallel with bathing, these bathrooms serve for washing purpose as well. Toilets contain of pan closet and washbasin. It’s seen that mosaic pavement was used in the wet areas in the entrance and the halls. Counters with extensive usages are placed in the kitchens. Fume hoods are located above the ovens. Due to the usage of oil stoves for cooking, cast counters are wider. 4.2. Features of the Facades When facades of the buildings are examined, coves and projections that brought façade dynamism are observed. While coves can be seen in Pura and Kabakçı buildings, projections are seen in Kula building. The coves and projections in façade formations features of three separate categories as open, closed and open and closed. Closed projections seen in Kabakçı and Kula buildings have two characteristics. First characteristic is that the room fully protrudes from the façade while the second is that the narrower part of the room protrudes from the façade. In Pura and Kabakçı houses, open projection (balcony) is used in front of the living areas and street sides of the buildings are opened to outside. In Pura building however, another open projection with the half size of the other two balconies is located in front of the kitchen. Closed and open projections are formed with usage of both types together. In Kabakçı building, projection form was used as full-empty-full forms. Pura Building
Kabakçı Building
Kula Building
Figure 3: Entrance sides of the discussed buildings
4.3.1. Characteristics of the facade elements Kula Building: The building is built in corner positioned parcel and buttress projections are located on the edges of the building. Entrance landing is an arched type landing. Upstairs projections are connected to this arch design with concave storey moldings. Pura Building: It’s located on a corner parcel with attached building setting on one side. Support elements under the projection located on lateral façade of the building refer to the buttresses in traditional house. A modernist approach is observed in façade formation of the building. Kabakçı Building: The idea of “two eyes side by side and horizon line continuing on a horizontal line, allowing the outer view to inner space uninterrupted” which was frequently used in the buildings built in this era in which Bauhaus and International Style prevailed introduced window openings with horizontal proportions into architecture. Balconies located on both sides of the entrance door were located side by side on upstairs as loge type balconies and limited with living areas. 586
5. CONCLUSION
The buildings of the era discussed in the study are the documents of the social structuring and the cultural continuity of the era they were built in. The tendency of creating one space can be seen in the middle spaces functioning like central or inner sofa and in the passages from one room to another while the relations of the buildings with outdoors are seen in the planning. Window openings with horizontal proportions chilled iron entrance doors, balcony parapets and handrails provide a perspective from today to past as the reflections of the social acclaim of the era. As a result, the distance between “should have happened” at cognitive level which can open up new horizons to designers and socio-cultural “happened” level at which these functions are realized could only be explained with a structural analysis model which was developed with a holistic approach. Mabeyn Room 1) It’s the room or department that is located between the room exclusively for men and the room exclusively for women in palaces and mansions and has a door on each side. These rooms are called “mabeyn” rooms. The departments in royal palaces in which chamberlains worked and carried out the works of sultan and in which the sultan accepted representatives and ambassadors were named as mabeyin_i hümayun (Arseven, 1950). 2) The room in a palace or a mansion between the room for men and room for women with openings to both rooms (Övünç, 1972). Washing oneself: Having a bath (Övünç, 1973). REFERENCES Arseven, C. A. (1950). ‘Mabeyn’ Sanat Ansiklopedisi (madde yazarlığı, cilt 3s 1254), Milli Eğitim Basımevi, İstanbul Arslantürk, Z.(2001). Araştırma Metot ve Teknikleri, İstanbul, Çamlıca Yayınları, İstanbul Çelebi,N. (2001) Sosyoloji ve Metodoloji Yazıları, Anı Yayıncılık, Ankara ISBN 9756956542 Dikeçligil, B. (1997). “Bir Analiz Modeli Denemesi ‘Sosyal Yapı’ ve ‘Toplumsal Yapı”, Yeni Türkiye, cilt no 3, Sayı15, s 447-666. Durkheim, E. (2010). Sosyolojik Yöntemin Kuralları, Dost Kitabevi, Ankara, ISBN 9789752984127, Eldem, S.H. (1984). ‘’Plan Tiplerine Göre Karakteristik Örnekler’’ Türk evi Osmanlı Dönemi I:, Türkiye Anıt ve Çevre Değerlerini Koruma Vakfı Yayınları, s, İstanbul Eruzun, C. (1985). ‘’Kültürel Süreklilik İçinde Türk Evi’’ Mimarlık Dergisi IV. İstanbul Kızılçelik, S. (2000). Sosyoloji Yazıları, Anı Yayıncılık, Ankara ISBN 975695633X, Stewing, (1986). ‘’Bursa, Nordwestanatolien’’ IM Selmverlag des Geographischen Inlstaius der Universitat Kiel Övünç, T. (1972). ‘Mabeyin, Mabeyvin’ Meydan Larousse (madde yazarlığı, cilt 12 ss 150), Meydan Gazetecilik ve Ltd Şti., İstanbul Övünç, T. (1973). ‘Yunmak’ Meydan Larousse (madde yazarlığı cilt 12 ss 858), Meydan Gazetecilik ve Ltd Şti., İstanbul Yüksel, Y. (1995). ‘Konut Mekanı Kavramanın Tipolojik Temelleri’ İTÜ Mim.Fak.Baskı Atölyesi, İstanbul
587
Chapter 42 Interior Finishing Materials Gülru KOCA 1. INTRODUCTION At the prehistoric age, human beings built huts in order to defend themselves from environmental factors and other living creatures. They were the first architectural samples. In order to build these huts simple materials, which can be gathered easily from the environment, were used. Afterwards different construction techniques developed and the building materials also improved and evolved. At the beginning, construction and strength of the building were of prime importance and space phenomenon did not develope. After the improvement of new building techniques, interior space gained importance. In order to create an esthetic and durable interior space, some factors had to be taken into consideration. These are environmental effects (heat, water, moisture, noise, light, etc.), mechanical effects and esthetic requirements. The layer which was created to provide these features is called "finishing layer". Finishing layer has to be esthetic, durable and strong. Also in recent years, ecology of the building and finishing materials have gained importance in order to protect the user health and ecological balance of the world. The purpose of this study is the classification of finishing materials according to their place of use and identifying important performance criterion needed under different conditions. Different applications of frequently used finishing materials were examined by emphasizing their visual and ecological properties. 2. INTERIOR FINISHING MATERIALS Finishing can be defined as the final layer which protect and fix the surface of the building elements. This layer plays an important role in visual and psychological definition of interior space. At the period of traditional building techniques; buildings were usually produced by traditional materials such as stone, wood and adobe. They were used uncoated or sometimes plastered. After the transition to modern building techniques; the building section got thinner and new layers had to be added in order to provide comfort requirements. Consequently finishing layers were needed. The main purpose of finishing layer is to fix the surface. Also it is essential to coat wall, floor and ceiling in order to create a suitable appearance and to protect the construction from effects of water, heat, moisture, abrasion. 2.1. Wall finishing The prior function of wall is to separate spaces from each other vertically, but depending on the structural system of the building it may also carry loads. Wall has to protect the space against the effects of water, moisture, heat, noise, light, fire, etc. Wall section can be analyzed in three layers; interior coating, core and exterior coating (Figure 1). Some walls can be formed by one layer while some of them are formed by
Assist. Prof. Dr., Işık University, Fine Arts Faculty, Interior Architecture Department
three layers. For instance, exposed concrete is formed by one layer, but brick walls are formed by three layers (Toydemir, Gürdal, Tanaçan, 2000).
Figure 1: Types of wall sections
Core is the structural part of the wall and its primary function is load-bearing. At solid masonry buildings, wall core has to carry all the loads which effect building. At skeleton systems; wall has to carry its own load and transfer it to the system. Other functions such as; heat, water, moisture, noise, light and fire resistance are shared by all layers. If a function stands out in design process, an appropriate detail solution has to be created (Toydemir et al, 2000). Functions of the coatings can change depending on its position on the wall. Exterior coating takes a role in forming the architectural character of the building. Also it has to be resistant to atmospheric, mechanic and chemical effects and easy to clean. Interior coating can also be named as interior finishing. It doesn't have direct contact with water and also doesn't come across with great temperature changes; therefore it doesn't have heat and water problems. Although the core solves the problems about noise, finishing has to be porous enough to emit the noise and provide the acoustic balance. Interior finishing has to be nonflammable, vapor permeable and non-toxic. In addition, interior finishing has to be compatible with the function of the space by appearance, color and texture (Toydemir et al, 2000). Different building materials can be used as interior finishing. Plaster, paint, wood, gypsum panel, sandwich panel, ceramic, natural stone, artificial stone, glass and metal can be used as wall finishing materials. 2.2. Floor finishing Floor is the horizontal structural element of the building. The prior function of floor is load-bearing. It increases the strength by connecting the walls in solid masonry systems. At skeleton systems it has to carry its own load and transfer it to the system. It also has to be resistant to some effects such as; heat, water, moisture and noise, according to its location in building. Floor's section can be analyzed in four layers; floor coating, base, structural system and ceiling coating (Figure 2). The most important layer is structural system and the others support it. Floor and ceiling coatings are finishing layers and have to create a visually and functionally favorable impact (Toydemir et al, 2000). Floor coating is the upper layer of the floor. It has to protect the layers below and has to be appropriate with the function of the space. Therefore, while choosing floor coating; primarily the function of the space and user requirements has to be determined and the selection has to be made by taking these factors into consideration.
589
Figure 2: Floor section
Screed (cement, magnesia, gypsum based), terrazzo, natural and artificial stone, ceramic, glass, cork, wood, polymers and metal can be used for floor coating. 2.3. Ceiling finishing Ceiling is the lower part of the floor. If it does not have any equipment, such as HVAC or installation, it is usually straight and can be solved easily. But if the ceiling has an acoustic, HVAC, lighting or sprinkler system equipment on it, a suspended ceiling has to be created in order to hide the system (Toydemir et al, 2000). Suspended ceilings are usually composed by a hanging system and a finishing material. Hanging system is installed primarily and then the finishing material is installed to the system (Figure 3, 4). Hanging system is usually composed from metal. Finishing material can be gypsum, metal, wood, ceramic, glass, etc.
Figure 3: Suspended ceiling detail
Figure 4: Installation of suspended ceiling
3. PERFORMANCE CRITERION REQUIRED FOR INTERIOR FINISHING MATERIALS Generally the most important criterion for a finishing material is to have appropriate visual appearance with the function of the space and proper texture and color with the users requirements. Besides there are some other criteria they should have. Finishing materials are usually affected by the mechanical factors because of the direct contact with the user. Floors and walls can be damaged by the furniture or objects. Therefore finishing materials have to be resistant to mechanical effects and the selection has to be done according to the material's strength properties. In order to protect surface properties and user's safety, finishing materials must have a sufficient 590
compressive strength, impact resistance and walking safety. Also it has to be nonflammable and it shouldn't emit toxic gas during fire (Toydemir et al, 2000; Binggeli, 2008). In order to provide the comfort conditions, finishing materials have to be resistant to some physical effects. It has to ensure thermal comfort if the core doesn't have enough insulation properties. An internal insulation layer has to be added in such cases (Fig. 5). Figure 5: Internal insulation application Generally interior finishing materials don't have direct contact with water. But the behavior of material against water gain importance in wet areas. Water-resistant and easy cleanable materials should be used in wet areas such as kitchen, bathroom and WC. Interior finishing materials have to allow vapor movement to prevent condensation and mold problems, and if necessary a vapor barrier has to be added. Also additional precautions have to be taken to prevent water intrusion from the interface of the materials (Fig. 6) (Toydemir et al, 2000; Addleson, Rice, 1991).
Figure 6: Vapor barrier on floor
Interior finishing materials should absorb the noise and provide the acoustic balance of interior space. Appropriate detail solutions have to be suggested at crowded spaces such as theaters, schools and offices. Usually porous and soft materials are used for acoustic solutions to increase absorbance. Due to their soft structural properties they can easily be damaged. For this reason they must be installed from a certain height in acoustically important places such as conference rooms and theaters. In places where the acoustic does not have prior importance, such as schools and offices, suspended ceilings can be installed by using sound absorbing materials (gypsum board, rock wool) (Toydemir et al, 2000). Finishing materials also have to be dimensionally stable, resistant to chemicals and sunlight, easy cleanable and durable. Recently due to the environmental concerns it is recommended to use sustainable, local and recyclable materials in order to reduce energy and consumption of natural resources (Yeang, 2012). 4. INTERIOR FINISHING MATERIALS and INSTALLATION TECNIQUES Interior finishing materials visually identify and reflect the character of the space. A lot of materials had been used for this purpose for centuries. Although these materials were limited before the Industrial Revolution, they have increased with the development of modern technologies. Today there are hundreds of products which can be used for this purpose. In this part of the study, the types, general properties, application techniques and environmental properties of interior finishing materials are 591
discussed. 4.1. Cement-based materials Cement is the most common binding material nowadays. According to various sources; natural cement was produced BC 7000 and artificial cement was produced BC 5600. But the cement used today is based on 1824 (Binggeli, 2008). Specific proportions of lime and clay are mixed and baked at high temperatures in the production of portland cement. During the baking process clay and lime components forms cement clinker. 2 to 3% of gypsum is added into clinker in order to adjust the setting time and then the mixture is grinded to obtain portland cement (Neville, 1995). Cement-based finishing materials are composed of mortar by mixing cement, aggregates, and water. They can be continuous or in tiles. Terrazzo is cement-based continuous material; while cement, terrazzo and concrete tiles are products in tiles (Toydemir et al, 2000). Terrazzo floor is formed from a mixture of small stone pieces and cement mortar created from marble flour and color pigments. When the mixture is ready it is installed to a well leveled screed powder. Installation has to be done quickly in two layers. The upper layer's abrasion resistance is higher than the other. Crack detailing is necessary to prevent the transmission of fractures in the concrete. After it sets the surface of terrazzo is polished (Fig. 7) (Toydemir et al, 2000). Figure 7. Terrazzo floor Cement tile, is a layered tile produced from cement, sand and oxide paint. The upper layer is paint. Desired colors and patterns can be created with the oxide paint. The second layer below paint has a high cement factor; the last layer is produced from a regular cement mortar. Cement tile is installed on a well leveled clean surface with adhesive mortar. While positioning the tiles a thin gap is left for the joint. After the installation, joints are filled with grouting (Figure 8). The terrazzo tiles are formed by white and colored stones/glass, cement, paint, marble powder and water. It has an abrasion layer of approximately 1 cm and below that it has a regular mortar layer. It is installed just like cement tile and should be periodically polished (Toydemir et al, 2000). Figure 8. Cement floor tile Concrete tile is formed by cement, polymeric resin, fine aggregate and water. It is installed with cement adhesive mortar. A high heat input is required in the production of cement; therefore the process causes a large amount of carbon emission and consumption of some non-renewable mineral and water resources. Different environment friendly combinations of alternative materials are recommended in recent years. For this purpose; blast furnace slag and industrial waste are recommended as aggregate (Calkins, 2009; Joseph, Tretsiakova, 2010).
592
4.2. Earth-based materials Earth-based materials are used in the building because they can easily be found since the prehistoric times. Ceramics which are baked at high degrees are used as the earth-based finishing materials at the building. The most significant property of the baked earth-based materials is their high heat insulating ability. In addition, they are light and resistant to chemicals and high temperature. The biggest disadvantage of the material is their fragility. Ceramics are divided into three groups according to their porosity; porous, semiporous and non-porous ceramics. The approximate cooking degree is 900°C for porous ceramics, 1150°C for semi-porous ceramics and 1400°C for non-porous ceramics. Compression strength of porous ceramic is low when compared to non-porous ceramic. Therefore its heat insulation ability is higher. Nonetheless, the compression strength of non-porous ceramics is quite high. While non-porous ceramics cannot be used for floor coating, porous kinds can be used both on walls and floorings (Toydemir et al, 2000). Ceramic is usually glazed to decrease its water absorption and to create a smooth surface. Glaze is composed by the transition of metal-oxides on the surface of the ceramic. The abrasion resistance of glaze is low and also its slippery surface reduces the walking safety. Therefore, glazed ceramics should not be used at floors with high traffic (Riggs, 2003). Baked earth-based materials are frequently used as wall and floor coatings. Ceramics are preferred to create easy cleanable surfaces and prevent condensation by controlling the vapor movement. Installation is done with cement-based adhesive mortar. Joints are left between the tiles to allow the ceramics expanse. Grouting is applied after the mortar is dried (Fig. 9).
Figure 9. Ceramic tile application
Another earth-based material used for interior floor coating is terracotta tile. It is produced by baking a clay-rich ceramic dough above 1000°C degrees. Due to its high baking degree it has a low porosity and impermeability. To increase the adhesion surface, grooves are opened under tiles. They are installed with cement-based adhesive mortar. Joints are left between the tiles and after they are dried grouting is applied (Toydemir et al, 2000). Because of the high baking degrees, ceramics have high carbon emissions and are harmful to the environment. Also, the elements which are used in the production of ceramic such as arsenic and lead give damage to the environment. (Calkins, 2009; Nicoletti, Notarnicola, Tassielli, 2002) 4.3. Glass Glass is used since prehistoric times and it is defined as a kind of ceramic. It had been used for producing ornaments in prehistoric times. Later it has started to be used as structural purposes. Glass was first used in the windows to make the connection
593
between interior and exterior spaces. Later, with the emerging technologies, it has started to be used in large sizes and for different features in different parts of the structures (Binggeli, 2008). Glass is formed by melting the ingredients together at high temperatures, shaping and annealing of the material. Usually floating method is used for shaping the structural glass. Glass is used in interior spaces as glass brick walls, floor tiles and mosaics. Also, glass foam can be used on walls for acoustic purposes. Glass brick is created by pressing the molten glass into a mold. Then the glass machine slowly reheats two blocks until the edges melts to join the two pieces. The molten edges of two blocks fuse forming a single block with a remaining gap between them. Glass bricks have a high thermal insulation property, it is light permeable and esthetic. Cement-based mortar is used in Figure 10. Glass block wall installation of glass bricks and grout is applied to joints after drying (Fig. 10). The transparency can be changed and glass can be produced opaque during production. Opaque glass tiles are installed by cement-based adhesive mortar and after the mortar is dried grouting is applied to joints (Toydemir et al, 2000). Tempered and laminated large glass panels can also be used at floor voids. Tempering is a process applied to increase the heat and impact resistance of glass. This process is based on heating the glass to a high temperature and then cooling it quickly. Lamination is combining the two sides of the glass with an adhesive foil. When laminated glass is cracked, it does not break into pieces and also retains its surface integrity because of the adhesive in between. Glass panels are placed into floor voids with adhesives and sealing profiles. Glass foam is obtained by treatment of glass components with carbon dioxide. Glass foam is nonflammable, light, thermally resistant and dimensionally stable. It is used on interior surfaces for acoustic purposes. It is used in sound studios, shooting ranges and movie theaters (Fig. 11). When glass is evaluated ecologically; it can Figure 11. Acoustic foam wall be said that glass is an environment friendly covering material. Sand which is the raw material of glass is economic and easily be found. It is also a highly recyclable material. The biggest concern is the large amounts of energy spend during the manufacturing process. In addition to this, the treatment of glass with acid and sand is harmful to the environment. 4.4. Metals Metals are resistant and shiny materials obtained from the mines. Metal has a high heat and electric conductivity due to its regular atomic structure. This also leads to a high compression and tension strength value. The most important problem about metal is corrosion reasoned from water vapor and oxygen. This can be solved by periodic 594
painting or using alloys. Alloys are obtained by melting and mixing two or more metals in order to increase the strength and resistance of metal. Metal is known since ancient times, but its industrial production started in the 19th century. It became widespread as a building material since the beginning of the 20th century. In ancient times iron is burned with charcoal and copper to obtain metal and used as a coating material. Metal is preferred due to its structural strength and esthetic appearance in interior spaces. It is used as wall and floor coating material in panel or tile form. Metals can also be used at the ceilings as suspended ceiling material (Toydemir et al, 2000). Metal wall cladding panels are usually produced from aluminum in different dimensions. They are installed on metal profiles. Ceramic-like metal tile and mosaics are produced from stainless steel, copper, aluminum, and zinc. They are installed like ceramics (Fig. 12) (Toydemir et al, 2000). Metal floor coating materials have a high temperature, friction, abrasion and impact resistance. This type of floor coatings are often used in steel constructions. Figure 12. Metal tile They have glossy or lined surfaces and are placed on the floor with cement-based mortar. Their surface is roughened in production stage in order to increase the walking safety. The material has to be painted to prevent corrosion (Toydemir et al, 2000). Metal can also be used on the ceiling as a suspended ceiling material. It is used at both hanging system and finishing material. Metal profiles, screws, straps and strips are used for the hanging system. Different sized and formed metal panels are used as finishing materials. Metal is a non-renewable source, its embodied energy is high and also it causes a great amount of carbon emission during production. For this reason it is harmful to the environment (Berge, 2003). But in recent years, with some changes in production methods (melting the material by electric ovens) its damage to the environment has decreased. Metals can also be used for many years in non-corrosive environments and are recycled at high rates. 4.5. Polymers (Plastics) Plastic is produced by processing carbon (C) with hydrogen (H), oxygen (O), nitrogen (N) and other organic or inorganic elements. Plastic is not found in nature, but obtained by the treatment of natural elements. Plastics were firstly produced and used in the late 19th century. The high resistance against environmental factors, low cost and the unlimited production forms has increased its usage area and production amounts. Polymers are divided into two groups according to their thermal behavior; thermosets and thermoplastics. Thermosets doesn't soften and melt when they are heated, after a certain temperature they begin to break down. They can only be formed 595
during polymerization. Termoplastics are solid at room temperature. They soften and melt when they are heated without breaking down (Binggeli, 2008). Plastics are used as panels, sandwich panels, stretch ceilings, polymer and epoxy floors in interior space. Polymer panels can be produced in desired width and color from PVC, acrylic and polycarbonate. They are installed to a construction system. Sandwich panel is a structure made of three layers. It has a low density core inserted between two relatively thin layers. It has a high mechanical performance. The sandwich panels are often used in prefabricated buildings. Sandwich panels are applied in a similar manner with the other interior coating panels (Toydemir et al, 2000). Polymer floor coatings are manufactured as tiles or rolls. They are installed to a fine leveled surface with glue (Fig. 13). Epoxy is a mixture of synthetic resin, aggregate and pigment. They are applied onto smooth surfaces in two separate layers. Stretch ceilings are usually created with PVC fabric and installed to an aluminum ceiling Figure 13. PVC tile application mounted frame. The lightness, easy installation and light transmission features increase its frequency of use. Although plastics can easily be produced, have a high product range and prevalence of use; still it cannot dissolve in nature and is a non-ecologic material. Also it causes a high carbon emission during production and use. The best method for producing environment friendly plastic is biodegradable plastic. This material easily decomposes in nature. Recently biological materials such as corn and starch are used in order to produce biodegradable plastics (Joseph and Tretsiakova, 2010). 4.6. Natural stone Natural stones are obtained by cutting the solid layer under the soil. It has been used as a structural and coating material in building for centuries. It is preferred because it is resistant to environmental factors, has a high abrasion resistance, impact strength and has a low absorption rate. Natural stones are used as wall and floor coating material in interior space. Two different methods are used in wall installation. At the first method the material is directly installed to the wall with cement mortar, the second is applied to a metal supporting system. In interior coatings direct installation is preferred. Porous stone types such as travertine and sandstone has to be used in order to increase adherence. Precautions should be taken to prevent the stones from falling before the mortar has hardened (Toydemir et al., 2000; Riggs, 2003). Natural stones used as floor coating has 2-5 cm thickness. 2 cm tiles can be used in normal floors, 3 cm tiles can be used in borders and 4 cm tiles can be used in stair coating. Stone selection should be done according to the circulation of the space. Hard stones such as granite, andesite, basalt, diabase and porphyry should be preferred in spaces which has high human traffic. On the other hand in spaces where there is low human traffic, softer stones can be preferred such as marble and limestone. Installation is made with cement-based mortar. After the coating is dried, grouting is applied to joints and then polished (Fig. 14) 596
(Riggs, 2003). Natural stones are environment friendly materials which have a low embodied energy. But long distance transportation and acid treatments damage the nature. It is recommended the use local and less processed natural stones (Joseph, Tretsiakova, 2010).
Figure 14. Marble tile application
4.7. Textiles Textile is used as carpets and upholstery fabric for furniture and curtains. For this purpose wool, cotton, linen, leather are used; polymers such as nylon and perlon can also be used. Carpet is used for floor coating in the residential and working spaces. The carpets are divided in two different groups; woven and non-woven carpets. In recent years polymer-based non-woven carpets are preferred for their high sound absorption values and economic reasons. They are produced in rolls or tiles and applied to the floor with glue (Fig. 15). Figure 15. Carpet application
Woven carpets are made of various threads and they are thicker. This type is applied in the same way with the non-woven carpets. Dirt can easily penetrate into the material because of its thickness. For this reason woven carpets are not recommended at places where hygiene is important (Toydemir et al, 2000). Appearance, comfort, safety and cost features are important in the selection of textile. Also ecological properties during the use and the production are important. Polymer-based materials are harmful to the environment during the production and use. Natural origin material can be preferred (Binggeli, 2008). 4.8. Wood and wood composites From the prehistoric times wood is preferred due to its strong, lightweight, easily processed structure. It is mentioned at various sources that wood has been used for different purposes in ancient Egyptian, Greek, Roman and Chinese civilizations. It had been used as construction, coating and furniture material in forestry regions; and in less frequent regions it has been used as door, wall panel and furniture (Riggs, 2003, Williams, 2012). Wood is the material obtained by sawing tree trunk. The properties of the wood are directly affected by many things such as the geographic area where the tree is grown, climate, orientation, amount of the water in the soil. Therefore each material produced from wood has its own characteristics (Bozkurt, Erdin, 1997; Arntzen, 1994). The trunk's section consists of bark, cambium layer and annual rings. When the annual ring is examined microscopically, different cell types can be seen. These cells are tracheids, parenchyma, fibers and rays. Coniferous trees have a simple and broad597
leaved trees have a complex cell structure (Bozkurt, Erdin, 1997; Rowell, 2005). The simple cell structure seen in coniferous wood makes it more flexible, homogeneous, smooth and slightly fibrous. Such trees are especially used in building construction and in paper production. The complex cell structure of broad-leaved trees cause different appearance alternatives on wood. Therefore they are used for decorative purposes such as furniture and coatings (Lyons, 2004; Rowell, 2005). Wood is an organic material and may deteriorate due to environmental factors. These factors are divided into three groups; physical, chemical and biological factors. Due to its organic structure wood is a food source for many organisms. Thus biological factors are the most influential of all these factors. The organisms settle into wood and decrease its strength. Wood should be dried properly, strong species should be selected and chemically treated wood should be used in order to prevent biological deterioration. Chemical treatment can be defined as saturation of wood with chemicals. The life of wood can be increased from 8 years to 20 Figure 16. Non-treated and acetylated years by chemical treatment (Fig. 16) wood under biological attack (Domone, Illston, 2001; Addleson, Rice, 1991). Wood can be used in the structure as solid or composite wood. In many different sectors wood is used in a large amount and this brings consumption problems. Therefore, in recent years the use of composite wood is more common. Although VOC (volatile organic compound) of composite materials is harmful to the environment it is preferred because it’s economic and it uses wood more efficiently. Composites used in interior space are; fiber boards, particle boards, OSB and plywood (Güller, 2001). Wood is one of the most common coating materials in interior space. It can be used in different dimensions of panels on the wall. Solid wood panels are often produced in 8-12 cm dimensions (Fig. 17). They are used in small dimensions because of the movement of wood. However, it is possible to manufacture large sized composite wood panels. They can be produced from fiberboard and particleboard. Both panels are installed on metal or wood strips. Wood floorings are divided into two groups; tonguegrooved wood floors and parquet floors. Tongue-grooved wood floors are applied by nailing the pieces on furring strips. Parquets are divided into several groups such as solid wood, engineered wood and laminate wood parquet. Solid wood parquet is derived directly from wood, produced in different sizes and are applied in two different ways. In the first installation, wood parquets are laid onto wood joists with nails. The other installation is made by fixing the parquets on screed by glue (Fig. 18). Engineered wood floor materials, first began to be produced in Northern Europe in the 70s. The advantage of engineered wood is to reduce the consumption of source. Figure 17. Wood paneling 598
Its thickness changes between 12-15 mm and consists of three solid wood layers. The top layer is aesthetic and has high quality; other layers have a relatively poor quality. Engineered wood floor is applied with glue on screed (Riggs, 2003). Laminate parquet is found in late 70’s and became popular because it’s economic. Usually fiberboard and particle board is used to produce the core of laminate Figure 18. Application of solid wood wood floor. Engineered wood parquet is often mixed with laminate flooring. parquet The obvious difference is; engineered wood parquet consists of three solid layers of wood, while laminate parquet core is obtained from fiberboard or particleboard. Laminate wood parquet is not glued on the floor surface. It is laid over a mattress to provide sound insulation and joined to each other by glue. Wood can be used on the ceiling as solid wood, fiberboard and particleboard. It can be directly installed to the ceiling or installed to a previously created hanging system (Toydemir et al, 2000). Table 1. Embodied energy of different building materials Embodied Energy of Materials Machine dried, cut softwood Air-dried hardwood Plywood Plastic Synthetic rubber Stabilized earth Imported granite Local granite Clay bricks In-Situ concrete Mild steel Aluminum
MJ/kg 2,0 0,5 10,4 90,0 110,0 0,7 13,9 5,9 2,5 1,7 34,0 170,0
When wood is ecologically evaluated it can be indicated that; it is the only renewable building material on earth. It is sustainable if planting is more than the amount of chopped tree. Wood usage in buildings is preferred to reduce the embodied energy of the building and to reduce the use of environmentally harmful materials. Embodied energy can be defined as the amount of energy wasted during the production of the material (Table 1) (Calkins, 2009; Joseph and Tretsiakova, 2010; Leydecker, 2008). REFERENCES Addleson L., Rice, C. (1991). Performance of Materials in Buildings, Butterworth & Heinemann, 588 pp., Oxford UK. Arntzen, C.J. (1994). Encyclopedia of Agricultural Science, Academic Press, 549-561 Vol 4 October, Orlando. Berge, B. (2003). The Ecology of Building Materials, Architectural Press, 453 pp., Oxford, UK. Binggeli, C. (2008). Materials for Interior Environments, John Wiley & Sons, 338 pp., New 599
Jersey. Bozkurt, A.Y., Erdin, N. (1997). Ağaç Teknolojisi, İ.Ü. Orman Fakültesi Orman Endüstri Mühendisliği, 372 s., İstanbul. Calkins, M. (2009). Materials for Sustainable Sites: A Complete Guide to the Evaluation, Selection and Use of Sustainable Construction Materials, John Wiley & Sons: Hoboken, 480 pp., New Jersey, USA. Domone, P., Illston, J.M. (2001). Construction Materials: Their Nature and Behavior, E & FN Spon, 584 pp., London. Güller, B. (2001). Odun Kompozitleri, Süleyman Demirel Üniversitesi Orman Fakültesi Dergisi, (2), 135-160. Joseph, P., Tretsiakova Mc N. (2010). Sustainable Non-Metallic Building Materials, Sustainability, (2), 400-427. Leydecker, S. (2008). Nano Materials in Architecture, Interior Architecture and Design, Birkhäuser, 191 pp., Boston. Lyons, A. (2004). Materials for Architect and Builders, Elsevier Butterworth & Heinemann, 440 pp., Amsterdam. Neville, A.M. (1995). Properties of Concrete, Trans-Atlantic Publications, 846 pp., Pennsylvania, USA. Nicoletti, G. M., Notarnicola, B., Tassielli, G. (2002). Comparative Life Cycle Assessment of Flooring Materials: Ceramic versus Marble Tiles, Journal of Cleaner Production, (10), 283-296. Riggs, R. (2003). Materials and Components of Interior Architecture, Prentice-Hall, 6th Edition, 226 pp., New Jersey. Rowell, R. M. (2005). Handbook of Wood Chemistry and Wood Composites, CRC Press, 703 pp., USA. Toydemir, N., Gürdal, E., Tanaçan, L. (2000). Yapı Elemanı Tasarımında Malzeme, Literatür Yayınevi, 393 s., İstanbul. Williams, T.L. (2012). The Interior Design Sourcebook, Allworth Press, 245 pp., New York. Yeang, K. (2012). Ekotasarım, Ekolojik Tasarım Rehberi, YEM Yayın, 472 s., İstanbul.
600
Chapter 43 Green Building Rating Systems in Sustainable Architecture Müjde ALTIN INTRODUCTION Buildings are responsible for nearly half of the energy use in the world. This means that they are responsible for nearly half of the greenhouse gas emissions like CO2 emissions. Green buildings are important at decreasing the harm given to the environment by decreasing the energy use, greenhouse gas emissions and material use. And Green Building Rating Systems (from now on will be referred as GBRSs) are the tools that help us measure how much green these buildings are, in shortly how to assess their sustainability. They assess the building’s sustainability and give a degree on how much green or sustainable that building is. So in another point of view it can be said that they urge architects to build more sustainable buildings. There are many GBRSs around the world to certificate buildings according to their sustainability degrees. They work through some criteria and give points/credits to the building according to meeting these criteria. And the building finally gets its certificate degree according to how much point/credit it gets. Most of the GBRSs have similarities in common more than differences. This is due to the fact that all of these systems are trying to help us create a better world and leave our children a better and cleaner world. Therefore, the principles are and should be nearly the same: principles to decrease the harm given to the environment. Therefore, the aim of this study is to give an overview of mostly used GBRSs around the world from the viewpoint of sustainability. This is going to be done by describing sustainable development, sustainability and sustainable architecture first, and then by explaining what a green/sustainable building is and how a building can be assessed in terms of sustainability, then by describing some of the mostly used GBRSs around the world, by discussing the common points of these GBRSs, in the end the results achieved through this discussion will be put forward. SUSTAINABLE DEVELOPMENT, SUSTAINABLE ARCHITECTURE AND GREEN BUILDINGS The term “Sustainable Development” was first pronounced and introduced to the literature by Gro Harlem Brundtland in 1970’s. The most commonly used definition of ‘sustainability’ was set by the Brundtland Report (by the World Commission on Environment and Development) as; “Sustainable development is development that meets the needs of the present without compromising the ability of future generations to meet their own needs” (WCED, 1987). The objectives requiring global policies on sustainability created the expression of the concept ‘sustainable architecture’ having the thought of ‘energy efficient architecture’ inside. (Durmuş Arsan, 2009)
Assoc. Prof. Dr., Dokuz Eylül University Faculty of Architecture Department of Architecture, İzmir, Turkey
Sustainable architecture term has a long history from 1970’s until today. As Durmuş Arsan stated in her paper, architectural applications have been called with different names in different times. They are called as “environmental design” in 1970’s, as “green design” in 1980’s, as “ecological design” in late-1980’s and 1990’s, and as “sustainable design” from mid-1990’s until today (Durmuş Arsan, 2008). Today we use “Sustainable Architecture” term for the architecture activity that has the sustainable architecture principles in them. “Sustainable architecture is all of the activity of construction of buildings that protect human health and provide comfort, prefer renewable energy resources, are environmentally conscious and use energy, water, materials and land efficiently, considering the future generations in the present situation and in whole life span.” (Sev, 2009) Its target is to create a healthy built environment depending on resource efficiency and ecological design principles. Sustainable designs are the ones that are responsible to their environment and that give the minimum harm possible to their environment. Sustainable architecture principles can be summarized as following: * Efficient use of construction site, * Energy efficiency and use of renewable energy resources, * Water efficiency, * Material efficiency and use of local material and manpower, * Indoor comfort and human health, * Waste management, * Recycling. Since 1970’s, sustainability issue has been discussed throughout the world. Since then, it has been an important issue to determine, define and measure how much sustainable the constructed environment (in general), and a building (in detail) is. In order to make this assessment, many methods and programs have been developed all over the world. There’s a wide range of these assessment methods as: LCA based tools, rating systems, technical guidelines, assessment frameworks, checklists and certificates (Happio, 2012). A wide variety of these green building and LCA tools are being used nowadays. One of the most suitable ways to classify these methods is the ATHENA classification system “Assessment Tool Typology” (Trusty, 2000), which Haapio and Viitaniemi (Haapio & Viitaniemi, 2008) set as one of the most accredited ones. It is developed by the Athena Sustainable Materials Institute and it classifies these assessment tools by end use (Trusty, 2000). It is a basic three-level classification system. These levels are (Haapio & Viitaniemi, 2008): Level 1: product comparison tools and information sources, e.g. BEES 3.0, TEAMTM, Level 2: whole building design or decision support tools, e.g. ATHENATM, BEAT 2002, BeCost, Eco-Quantum(Netherlands), Envest 2, EQUER, LEGEP® and PAPOOSE, Level 3: whole building assessment frameworks or systems, e.g. BREEAM(UK), EcoEffect(Sweden), EcoProfile, Environmental Status Model, ESCALE(France), and LEED®. There are other classification systems. One of them is IEA Annex 31 classification system. It classifies the assessment tools into five classes. These groups are as follows (Haapio & Viitaniemi, 2008): 602
1. Energy Modeling Software, 2. Environmental LCA Tools for Buildings and Building Stocks, 3. Environmental Assessment Frameworks and Rating Systems, 4. Environmental Guidelines or Checklists for Design and Management of Buildings, 5. Environmental Product Declarations, Catalogues, Reference Information, Certifications and Labels. Another classification is done by Larsson (Larsson, 2004). In this system, there are three groups which are: 1. Assessment methods, 2. Rating systems, 3. Labeling system. Another classification system is done by Hastings and Wall (Hastings & Wall, 2007). They grouped the assessment systems into three groups. They are: 1. Cumulative energy demand (CED) systems, which focus on energy consumption, 2. Life cycle analysis (LCA) systems, which focus on environmental aspects, 3. Total quality assessment (TQA) systems, which evaluate ecological, economic and social aspects. (Hastings & Wall, 2007)(Berardi, 2012) The subject of this study is Level 3 group of the Athena classification system which includes the assessment of whole building. They are named according to the criteria area included during the assessment. Sustainability has three dimensions which are: * Economy, * Environment and * Social. In general if the sustainability of a building is in question, all three dimensions should be assessed. But since the social dimension is very difficult to assess, it is generally not being considered during the whole building assessment. Therefore they are used to be called as “environmental assessment tools” at first, and with the criteria getting larger containing the economy and environment both nowadays, they are being called as “green building rating systems”. Since the assessment methods are still in development, they are getting to cover all the three aspects of the sustainability (economy, environment and social aspects) at the same time, being to be called as “sustainability rating systems”. But today they are still called as “Green Building Rating Systems”. GREEN BUILDING RATING SYSTEMS AROUND THE WORLD There are many GBRSs all around the world today. All of them were developed and implemented after the implementation of BREEAM in 1990. A brief summary of GBRSs is given in Table 1. It includes the GBRSs implemented until today.
603
Table 1. GBRSs around the world Year of Implementation
Name
1990
BREEAM
1993
BEPAC
1996
HK- BEAM LEED
1998
SB- Tool (former GBTool)
1999
EEWH
2000
Green Globes GBCS Green Star SB- Tool (former GBTool)
2002 2003
Protocollo Itaca CASBEE
2004
2005
Eco Profile Green Mark Green Building Standard SI- 5281 LiderA HQE
Long Name Building Research Establishment Environmental Assessment Method Building Environmental Performance Assessment Criteria Building Environmental Assessment Method Leadership in Energy and Environmental Design Sustainable Building Tool
Itaca Protocol Comprehensive Assessment System for Built Environment Efficiency Eco Profile
Multi-National Taiwan
Italy Japan Norway
Green Mark
Singapore
Green Building Standard SI- 5281
Israel
-
2016
Al Safat
-
2009
USA
Multi-National
Pearl/ Estidama
2008
Hong Kong
Sustainable Building Tool
2010
CEPAS
Canada
Canada South Korea Australia
DGNB AQUA Minergie GBI Malaysia BERDE
2006
3- Star GRIHA PromisE
UK
Ecology, Energy Saving, Waste Reduction and Health Green Globes Green Building Certification System Green Star
Haute Qualité Environnementale National Australian Built Environment Rating System 3- Star Comprehensive Environmental Performance Assessment Scheme -
Nabers
Country
Portugal France Australia China India Finland Hong Kong Germany Brasil Switzerland Malaysia Philippines United Arab Emirates Dubai
The following GBRSs are chosen and examined in this study due to the fact that they are among mostly used, internationally well known and advanced systems in the world today: * BREEAM, * LEED, 604
* SB-Tool (formerly GB-Tool), * CASBEE, * DGNB. BREEAM, UK BREEAM, which is short for Building Research Establishment Environmental Assessment Method, was developed by the Building Research Establishment and consultants in United Kingdom. It was launched in 1990 and was the first assessment system implemented in the world. It has been used as a model for nearly all of the following systems like HK-BEAM in Hong Kong. (Todd, Crawley, Geissler & Lindsey, 2001) It is available for a number of lifecycle stages such as New Construction, In-Use and Refurbishment, and Fit-out. As of 2016 according to BREEAM web page, globally there are more than 548,400 BREEAM certified developments, and almost 2,247,700 buildings registered for assessment in 77 countries since it was first launched in 1990 (URL: BREEAM, 2016). BREEAM works with the criteria and it has criteria in these categories: * Energy, * Health and Wellbeing, * Innovation, * Land Use, * Materials, * Management, * Pollution, * Transport, * Waste, * Water. During the assessment process, each category is divided into other issues which have their own targets. When a target is reached, it is awarded with credits. After all the issues and criteria have been assessed, a final score is reached and the rating is achieved. Then the certification level is determined according to this rating result. BREEAM assessments are carried out by independent, third party, BREEAM licensed organizations, using assessors trained through nationally or internationally recognized and accredited competent person schemes, to assess against various life cycle stages of the built environment. (URL: BREEAM, 2016) Buildings that are assessed by using BREEAM are awarded with the levels given in Table 2 according to their score. Table 2. Certification levels of BREEAM Level Score Outstanding* (≥85 score) Excellent (≥70 score) Very good (≥55 score) Good (≥45 score) Pass (≥30 score) Unclassified (
