JOURNAL OF NEUROCHEMISTRY
| 2010 | 114 | 606–616
doi: 10.1111/j.1471-4159.2010.06790.x
1 1
Department of Physiology and Medical Physics and RCSI Neuroscience Research Centre, Royal College of Surgeons in Ireland, Dublin, Ireland
Abstract Proteasomal stress is believed to contribute to the pathology of ischemic brain injury and several neurodegenerative disorders, but can activate both cytoprotective and cell deathinducing pathways. Here we have utilized the complex environment of organotypic hippocampal slice cultures (OHSCs) to investigate the stress responses activated in different neuronal populations following proteasome inhibition. Incubation of OHSCs with the specific proteasome inhibitors, epoxomicin or bortezomib led to a selective injury of the CA1 pyramidal neurons although similarly increased levels of polyubiquitinylated proteins were detected throughout all regions of the hippocampus. Micro-dissection, quantitative PCR and immunohistochemical analyses of epoxomicin-treated OHSCs identified a selective activation of cytoprotective genes in
non-vulnerable regions, and a selective activation of p53 target genes within the CA1. Genetic deletion of the proapoptotic p53 target gene, p53-upregulated modulator of apoptosis (puma), significantly reduced injury within the CA1 following proteasomal inhibition. Activation of cytoprotective genes by treatment with inducers of heat shock protein 70 inhibited the selective activation of p53 signaling within the CA1 and protected CA1 neurons from epoxomicin-induced cell death. In summary, we demonstrate that the reciprocal activation of p53/p53-upregulated modulator of apoptosis and heat shock protein 70 signalling determines the selective vulnerability of neurons to proteasome inhibition. Keywords: BH3-only protein, CA1, hippocampus, Hsp70, proteasome, PUMA. J. Neurochem. (2010) 114, 606–616.
Selective vulnerability of specific neuronal populations is a hallmark of many acute and chronic neurological disorders. The accumulation of misfolded proteins coupled with defects in protein degradation has been proposed as potential mediators of such pathologies. These include the loss of CA1 neurons during global cerebral ischemia (Paschen and Doutheil 1999; Hu et al. 2000, 2001; Asai et al. 2002), dopaminergic neurons in the substantia nigra during Parkinson’s disease (Forno et al. 1996), pre-tangle neurons of the hippocampus in Alzheimer’s disease (Hoozemans et al. 2009), and motor neurons during amyotrophic lateral sclerosis (ALS) (Bruijn et al. 1998; Rakhit et al. 2002; Kikuchi et al. 2006; Kieran et al. 2007; Saxena et al. 2009). Neuronal differences in protein synthesis or protein folding and degradation capacity may account for this selective vulnerability. However, it is also possible that individual neurons experience a comparable stress load, but activate
different, individual stress pathways. Indeed endoplasmic reticulum and proteasomal stress have been shown to activate both cytoprotective and cell death-inducing pathways (Reimertz et al. 2003; Concannon et al. 2007). However,
606
Received February 23, 2010; revised manuscript received April 22, 2010; accepted April 26, 2010. Address correspondence and reprint requests to Jochen H. M. Prehn, Department of Physiology and Medical Physics, Royal College of Surgeons in Ireland, 123 St Stephen’s Green, Dublin 2, Ireland. E-mail:
[email protected] 1 These authors contributed equally to this study. Abbreviations used: ALS, amyotrophic lateral sclerosis; BH3, Bcl-2 homology domain 3; DG, dentate gyrus; Hsp70, heat shock protein 70; OHSC, organotypic hippocampal slice cultures; PBS, phosphate buffered saline; PI, propidium iodide; puma, p53-upregulated modulator of apoptosis; qPCR, quantitative PCR; wt, wild type.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
CA1 injury and proteasome inhibition | 607
the control mechanisms for these diverse biological outcomes remain largely unresolved. The 26S proteasome is a large ATP-dependent multimeric complex that provides the main pathway for the degradation of intracellular proteins. Those proteins destined for removal are tagged with Lys48-linked polyubiquitin chains promoting their targeting to the proteasome for degradation (Ravid and Hochstrasser 2008). Alterations in the functionality of the proteasome complex rapidly alter the regulatory status of proteins tightly regulated by the proteasome. Two such proteins, the nuclear factor kappalight-chain-enhancer of activated B cells (NF-jB) inhibitor IjB (Palombella et al. 1994; Traenckner et al. 1994) and the tumour suppressor p53 (Maki et al. 1996; Kubbutat et al. 1997) have been extensively studied because of their ability to modulate pro-survival and pro-apoptotic pathways. Indeed, prolonged inhibition of the proteasome has been shown to induce apoptosis of cancer cells and nontransformed cells, including neurons (Lopes et al. 1997; Rideout and Stefanis 2002; Lang-Rollin et al. 2004). On the other hand, the activation of a cytoprotective response such as heat shock protein 70 (hsp70) during proteasomal stress (Bush et al. 1997) may exert pro-survival effects by reducing protein aggregation and inhibiting apoptosis (Giffard et al. 2004). Organotypic hippocampal slice cultures (OHSCs) have been widely used to study development, physiology, and injury of the hippocampus (Zimmer and Gahwiler 1984). Unlike dissociated neuronal cultures, OHSCs retain a complex threedimensional organisation of nervous tissue very similar to that in vivo, maintaining the concept of selective vulnerability (Vornov et al. 1991; Striggow et al. 2000; Concannon et al. 2008; Murphy et al. 2008). We here report a selective vulnerability of CA1 hippocampal neurons to proteasome inhibition, and investigate how the activation of cell survival (Hsp70, heat shock protein 70) and cell death [p53/p53upregulated modulator of apoptosis (PUMA)] signalling pathways are key determinants in this selective vulnerability.
Materials and methods Preparation of organotypic hippocampal slice cultures Organotypic hippocampal slice cultures were prepared as described previously (Stoppini et al. 1991) with minor modifications. The brains were removed from postnatal 10-day-old C57BL6J mice (Harlan Farm, Bicester, UK) and submerged in ice cold dissection buffer containing Hanks balanced salt solution (Invitrogen, Paisley, UK) supplemented with 20 mmol/L HEPES, 100 U/mL penicillin G and 100 lg/mL streptomycin and 6.5 mg/mL D-glucose (Sigma Aldrich, Dublin, Ireland). Brains were dissected in half and each hemisphere was separated to expose the hippocampi which were separated from the neighbouring thalamus and basal ganglia and the septo-hippocampal connection severed with a scalpel. Both hippocampi were placed on the Teflon plate of a Mc Illwain tissue
chopper (Mickle Laboratory, Guildford, UK), aligned perpendicularly to the chopper blade, and cut into 450 lm sections. The slices were then transferred into fresh dissection medium, inspected, trimmed for excess tissue under a microscope and selected for clear hippocampal morphology and placed on porous (0.4 lm) transparent insert membranes (20 mm in diameter, Millipore Corp, Cork, Ireland). in 24 well plates (Sarstedt, Wexford, Ireland) containing 350 lL of culture medium (50% minimal essential medium, 25% horse serum, 4 mM L-glutamine, 6 mg/mL D-glucose, 2% B27, 50 lg/mL streptomycin). The inserts were placed on top of the media and remained dry. The slices were transferred into the inserts using wide boar transfer pipettes. The plates were then placed into a humidified incubator with 5% CO2 at 35"C. Cultures were maintained for 10 days in vitro with media changes every second day. All procedures were carried out under licences provided by the Irish government and with ethical approval from the Royal College of Surgeons in Ireland. Experimental conditions and treatments After 10 days in vitro, hippocampal slices were tested for viability with propidium iodide (PI) added to the medium at a final concentration of 5 lg/mL (15 min). Healthy slices without PI staining were treated with epoxomicin (250 nmoles/L) or bortezomib (250 nmoles/L) and PI uptake observed over a 24-h period. Control slices were treated with vehicle only (0.1% DMSO, dimethylsulfoxide) for 24 h. For experiments involving NMDA treatment OHSCs were incubated with NMDA (50 lmol/L) for 30 min in experimental buffer (120 mmol/L NaCl, 3.5 mmol/L KCl, 0.4 mmol/L KH2PO4, 20 mmol/L HEPES, 5 mmol/L NaHCO3, 1.2 mmol/L Na2SO4, 1.2 mmol/L CaCl2, 10 lmol/L glycine and 15 mmol/L glucose; pH 7.4), washed and were then returned to conditioned culture medium. Sham slices were exposed to experimental buffer for 30 min supplemented with 1.2 mmol/L MgCl2. For experiments involving the use of the NMDA antagonist, MK801, slices were incubated in the presence of 10 lmol/L MK-801 prior to NMDA or epoxomicin treatment. PI staining and quantification of injury with the OHSC Neuronal injury was assessed by means of PI staining as previously described (Murphy et al. 2009). Briefly, OHSCs were stained live with PI (5 lg/mL) for 15 min prior to image acquisition. Fluorescence images were captured pre- and post-treatment using an Eclipse TE 300 inverted microscope (Nikon, Du¨sseldorf, Germany) with a 4 · objective and a Hamamatsu Orca 285 CCD camera (Micron-Optica, Enniscorthy, Ireland) using 540–580/600–660 nm excitation/emission wavelengths. Illumination and exposure (camera gain and exposure time) were kept constant throughout each series of recordings and between experiments. Resultant images were processed using Wasabi imaging software version 5.0 (Hamamatsu Photonics, Herrsching am Ammersee, Germany). A suitable region of interest for each subregion of the hippocampus was selected and the mean fluorescent intensity was determined. Background intensity was accounted for and neuronal injury was expressed as % of total injury (1 mmol/L NMDA for 1 h and sham conditions with 10 lmoles/L MK-801 was used to assess the fluorescent dynamic range). Data were averaged from three similarly treated slices and at least three independent experiments were carried out for each condition.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
608 | H. P. Bonner et al.
OHSCs derived from puma-deficient mice Organotypic hippocampal slice cultures were prepared from inbred wild type (wt) and PUMA)/) C57BL6/J mice as detailed above. The generation of PUMA)/) mice was described previously (Villunger et al. 2003). Isolation of RNA from whole OHSC Total RNA was isolated from whole OHSCs with the total RNA isolation (RNeasy kit) from Qiagen, Crawley, UK. Briefly the slices were removed from the insert by using 30 lL of lysis buffer to disrupt the slice from the insert and scraped into an Eppendorf tube containing 350 lL lysis buffer (18 were pooled for each treatment). The slices were further disrupted with a 23 G needle with a 1 mL syringe. One volume of 70% of Ethanol was then added, 700 lL of sample was applied to an RNeasy spin column in a 2 mL collection tube, and centrifuged for 15 s at 10 000 g for washing. After the second washing the RNeasy column was centrifuged for 2 min at maximum speed to dry the RNeasy membrane. The RNeasy column was transferred into a new 1.5 mL collection tube, 20 lL of RNase free water was pipetted onto the RNeasy membrane and centrifuged for 1 min at 10 000 g to elute RNA containing solution. Organotypic hippocampal slice micro-dissection Following treatment the membranes containing the slices were placed on ice. The boundaries between CA1, CA3 and dentate gyrus (DG) were dissected away intact from each other using a dissection microscope and a scalpel. Each subfield from 36 individual slices were pooled and added to an Eppendorf tube containing 400 lL of digestion buffer. RNA was then extracted using a ‘Recover All Total Nucleic acid Isolation Kit’ (Ambion, Warrington, UK). Real-time quantitative PCR (qPCR) was routinely performed to ensure CA3 samples had minimal contamination of other hippocampal subfields. To this end genes known to have increased expression within the CA3 (Bcl-2related ovarian killer protein bok) and the dentate gyrus (desmoplakin) were monitored (Fig. 5b and c) to ensure crosscontamination between different sections of the OHSCs was at a minimum (Lein et al. 2004). cDNA synthesis and real time qPCR for whole OHSCs and microdissected OHSCs First strand cDNA synthesis was performed using 2 lg of total RNA as template and Moloney murine leukemia virus reverse transcriptase (Invitrogen) primed with 50 pmol of random hexamers. Quantitative real-time PCR was performed using the LightCycler (Roche Diagnostics, Basel, Switzerland) and the QuantiTech SYBR Green PCR kit (Qiagen) as per manufacturer’s protocol. Specific primers for each gene analyzed were designed using Primer3. Sense and antisense primers were: GACGA CCTCAACGCACAGTA and CACCTAATTGGGCTCCATCT for puma; CCGTGGACAGTGAGCAGTTG and GCAGCAGGGCA GAGGAAGTA for p21/waf1; GGTCCTGTCTTCAGATGAAA ATG and CTTGGTGCAGATTCACCATTC for hsp70; CCAAA CCCATTCCTTTGTGG and GCCTGGGAAATCGAGTGAAA for bok; GAAATTCGGAGAAGGGATGC and TGCTGCCTTTTCTG ATACGC for desmoplakin; and AGCCATCCAGGCTGTGTTGT and CAGCTGTGGTGGTGAAGCTG for actin. Each primer pair
was tested with a logarithmic dilution of a cDNA mix to generate a linear standard curve, which was used to calculate the primer pair efficiency. The PCR reactions were performed in 20 lL volumes with following parameters: 95"C for 15 min followed by 40 cycles of 94"C for 20 s, 59"C for 20 s, 72"C for 20 s. The generation of specific PCR products was confirmed by melting curve analysis and gel electrophoresis. The data were analyzed using the Lightcycler Software 4.0 with all samples normalized to actin. Immunohistochemistry on OHSCs Free floating whole slices were fixed with 4% paraformaldehyde for 2 h at 20–25"C followed by three washes in phosphate buffered saline (PBS) for 10 min. The sections were then incubated in 3% H2O2 for 5 min to eliminate endogenous peroxidase activity. The slices were washed three times in PBS. Permeabilization of the membranes was achieved by immersing the slices in 3% Triton in 0.01% PBS for 20 min. The slices were then blocked with 5% goat serum in 0.1% Triton X for 1 h at 20–25"C. Free floating slices were then incubated with a mouse monoclonal anti-Hsp70 antibody (StressGen, Victoria, Canada), a rabbit polyclonal ant-p21 (Calbiochem, Merck Biosciences, UK), or a mouse monoclonal antiubiquitin antibody (Biomol, Lo¨rrach Germany) diluted 1 : 200 overnight at 4ºC. After repeated washing in PBS, FITC conjugated anti-mouse and Texas Red conjugated anti-mouse (Santa Cruz, CA, USA) were applied to the sections for 1 h at 20–25"C and then repeatedly washed in PBS. Nuclei were counter-stained with 4¢,6diamidino-2-phenylindole (DAPI) and mounted on slides and viewed under an Epifluorescence microscope (Zeiss, Jena, Germany). Western blotting All preparations of cell lysates from OHSC’s were carried out on ice. 30 lL of lysis buffer [2% sodium dodecyl sulfate (w/v), 67.5 mmol/L Tris/Cl – pH 6.8, 10% glycerol] was added to each insert containing the slice. The slice was removed using a pipette to draw the slice from the insert and then transferred into a 1 mL Eppendorf tube with each tube containing 90 lL of lysis buffer and n = 3 OHSCs treated in the same fashion. The concentration of protein was measured using the Micro-BC method (Protein quantification kit, Uptima, UK). Western blotting was carried out as described (Reimertz et al. 2003). The resulting blots were probed with a mouse monoclonal anti-ubiquitin antibody (Biomol, Germany) diluted 1 : 1000, and a mouse monoclonal anti-atubulin antibody (clone DM 1A; Sigma), diluted 1 : 5000, a mouse monoclonal anti-Hsp70 (StressGen, Victoria, Canada) diluted 1 : 1000, or a rabbit polyclonal anti-Bim (StressGen) diluted 1 : 500. Horseradish peroxidase conjugated secondary antibodies (Pierce, Northumberland, UK) were detected using SuperSignal West Pico Chemiluminescent Substrate (Pierce) and imaged using a FujiFilm LAS-3000 imaging system (Fuji, Sheffield, UK). Statistics Data are given as means ± SEM. For statistical comparison, ANOVA followed by Tukey’s test was employed using SPSS software (SPSS GmbH Software, Munich, Germany). p-Values smaller than 0.05 were considered to be statistically significant.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
CA1 injury and proteasome inhibition | 609
populations that exist within the hippocampus displayed a selective vulnerability to proteasomal inhibition and the accumulation of ubiquitinylated proteins within the cytosol. Incubation of OHSCs with the proteasomal inhibitor, epoxomicin, induced a selective injury primarily within the CA1 region of the hippocampus within a 24-h period (Fig. 1a and b). Interestingly, the injury with the OHSC was not significantly enhanced beyond 24-h treatment with no
Results An inhibition of proteasome function induces a selective injury within the CA1 region of the hippocampus The accumulation of protein aggregates within specific neuronal populations has been linked to the pathology of ischemic brain injury and a number of neurodegenerative disorders. Here we investigated if the different neuronal
(a)
(b)
(c)
(d)
(e)
Fig. 1 Proteasomal inhibition with epoxomicin induces a selective damage to the CA1 region of the hippocampus. (a) Organotypic hippocampal slices (OHSCs) prepared from day 10 C57BL6/J mice were exposed to epoxomicin (Epoxo 250 nM) for indicated time periods and injury monitored using propidium iodide. Scale bar = 500 lm. (b) Quantification of neuronal injury within the CA1, CA3 and dentate gyrus (DG) as assessed by PI staining (see Materials and Methods) in response to epoxomicin treatment. *p < 0.01 difference between vehicle treated OHSCs and OHSCs exposed to epoxomicin for 24 h. n = 5 experiments in triplicate. (c) DAPI staining within the CA1 region (upper panel) and CA3 region (lower panel) of the hippocampus at 8, 16 and 24 h following incubation with Epoxo. Scale bar = 5 lm. (d)
(f)
Whole slice lysates were analysed by western blotting and probed with an antibody recognizing mono- and poly-ubiquitinylated proteins at 4, 8 and 24 h following Epoxo treatment. Actin served as a loading control. (e) Representative images of immunohistochemistry analysis of mono- and poly-ubiquitinylated proteins in the CA1 and CA3 regions of the hippocampus 24 h after treatment with epoxomicin or vehicle. Scale bar = 10 lm. (f) Quantification of ubiquitin staining within the CA1, CA3 and dentate gyrus (DG) regions of the hippocampus after 8, 16 and 24 h exposure to Epoxo. Data presented as a percentage of total neurons positive for ubiquitin within each field of view (three slices quantified at each time point from two separate experiments). *p < 0.05 compared to Vehicle treated controls.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
610 | H. P. Bonner et al.
discernable differences at 48- and 72-h incubation compared to 24 h (Fig. 1a and b). This injury was apoptotic in nature with the neuronal nuclei becoming highly condensed and fragmented at 16 and 24 h in the CA1 but not the CA3 (Fig. 1c), in agreement with previous studies (Lang-Rollin et al. 2004; Concannon et al. 2007). Western blot analysis of mono and poly-ubiquitinylated proteins demonstrated a timedependent increase in the levels of ubiquitinylated proteins characteristic of proteasome dysfunction (Fig. 1d). Moreover, immunohistochemistry analysis of ubiquitinylated proteins within the hippocampus identified increases in the number of neurons with diffuse ubiquitin accumulation within the cytosol in the CA1, CA3 and DG regions (Fig. 1e) with no apparent difference in the degree to which ubiquitin accumulated within each region (Fig. 1e and f). These data suggest that proteasome inhibition selectively damages the pyramidal neurons of the CA1 despite the disruption of the correct functioning of the proteasome within all regions of the hippocampus. The neuronal injury within the CA1 region of the hippocampus in response to proteasomal inhibition with epoxomicin (Fig. 2a; lower left panel) had a similar profile to that induced by transient NMDA receptor over activation (Fig. 2a, upper left panel). In order to establish if the injury occurred as a consequence of an overactivation of NMDA receptors, mediated through a stimulation of glutamate release upon prolonged proteasome inhibition, we incubated epoxomicin treated slices with the NMDA receptor antagonist MK-801. As demonstrated in Fig. 2(a) and (b) pretreatment with MK-801 did not reduce the epoxomicin induced injury within the CA1, whereas NMDA mediated CA1 neuronal injury was significantly attenuated in the (a)
(c)
presence of MK-801 (Fig. 2a and b). Therefore, the epoxomicin induced injury within the CA1 region was mediated independent of NMDA receptor activation. Interestingly, the NMDA treatment in this model also selectively damaged the CA1 in a MK-801 sensitive manner with no apparent injury in the CA3 or DG regions of the hippocampus (Fig. 2c and d). The transcriptional activation of the p53 target gene and Bcl-2 homology domain 3-only gene puma mediates epoxomicin-induced selective injury in the CA1 region of the hippocampus Previously, we have utilized high density DNA microarrays to investigate the transcriptional changes that occur in response to proteasomal inhibition in SH-SY5Y neuroblastoma cells (Concannon et al. 2007). Amongst the genes found to be up-regulated and to partially mediate proteasome inhibitor-induced apoptosis was a prominent member of the Bcl-2 homology domain 3 (BH3)-only family of proapoptotic genes, the p53 upregulated mediator of apoptosis (puma). Western blot analysis of p53 expression identified an early accumulation of p53 protein levels within 2 h following the addition of epoxomicin with this accumulation maintained throughout the time period of treatment (Fig. 3a). Real-time qPCR of OHSCs treated with epoxomicin (18 slices pooled per condition) demonstrated a marked induction of the p53 target gene, puma, after 8 h, with the expression levels of puma peaking at 16-h treatment (Figure S1), a period when neuronal injury was becoming prevalent (Fig. 1a and b). To further validate our hypothesis that puma activation played the predominant role in cell death following prote-
(b)
(d)
Fig. 2 Proteasomal inhibition induced apoptosis in the CA1 is not mediated by NMDA receptor over activation. (a) Representative images of PI staining in OHSCs 24 h after exposure to NMDA (50 lM for 30 min) in the presence and absence of MK-801 (10 lM) or epoxomicin (Epoxo 250 nM) in the presence and absence of MK-801 (10 lM). Scale bar = 500 lm. (b, c, d) Quantification of neuronal injury with the CA1 (b), CA3 (c), and DG (d) following treatment of OHSCs as described above. All experimental conditions were carried out four times in triplicate. *p < 0.05 difference between NMDA treated OHSCs and those treated with NMDA and MK-801.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
CA1 injury and proteasome inhibition | 611
(b)
(a)
(c)
(d)
(e)
Fig. 3 Epoxomicin induced injury within the CA1 region of the hippocampus occurs in a p53/PUMA dependent manner. OHSCs prepared from C57BL6/J mice were treated with 250 nM Epoxo for the indicated time periods. (a) Western blotting using an antibody to detect p53 expression. Actin served as a loading control and the experiment was repeated twice with similar results. (b) wt and puma)/) OHSCs were treated with 250 nM Epoxo for 24 h, whole-slice lysates were obtained and probed with an antibody recognizing mono- or polyubiquitinylated proteins. Actin served as a loading control. Similar responses were obtained from three different sets of samples. (c) Representative images of PI staining in OHSCs derived from wt and puma)/) mice following exposure to vehicle (0.1% DMSO) or
250 nM Epoxo for 24 h. Scale bar = 500 lm. (d) Quantification of neuronal injury within the CA1 region of OHSCs treated with epoxomicin or vehicle for 24 h and using PI as a marker of cell death. Data presented as a percentage of total cell death (see Materials and Methods). Data are from four separate experiments carried out in triplicate. *p < 0.05 difference between Epoxo induced CA1 neuronal injury in OHSCs derived from wt mice and those derived from puma)/) mice. (e) Quantification of PI staining within the CA1 region following treatment with bortezomib (250 nM) or vehicle for 24 h. Data presented as a percentage of total cell death (three separate experiments carried out in triplicate). *p < 0.05 difference between bortezomib induced CA1 neuronal injury in OHSCs derived from wt and puma)/) mice.
asomal inhibition, we monitored the progression of injury in OHSCs derived from both wt and puma)/) mice treated with epoxomicin (Fig. 3c). Whole cell lysates derived from both wt and puma)/) OHSCs treated with epoxomicin revealed similar levels of ubiquitinylated proteins indicating similar levels of proteasome inhibition in both genotypes (Fig. 3b). Intriguingly, the injury induced within the CA1 region of OHSCs derived from wt mice was almost completely attenuated (from 52.3 ± 6.16% to 23.1 ± 3.41%) in those OHSCs derived from puma)/) mice (Fig. 3c and d). Indeed, incubation of OHSCs from puma)/) and wt mice with an additional proteasome inhibitor, bortezomib (250 nM), resulted in a similar injury
with similar levels of protection afforded by deficiency in puma expression (Fig. 3e). Differential expression of cytoprotective and p53 target genes in the hippocampus following proteasomal inhibition Because proteasomal stress can activate both cytoprotective and pro-apoptotic signaling pathways, we reasoned that the selective vulnerability of neurons could be caused by a differential regulation of either cytoprotective or pro-apoptotic signaling pathways, or indeed a combination of both. In order to address this question, we examined the region specific expression levels of hsp70 and the p53 target genes puma and p21, following proteasome inhibition. To this end
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
612 | H. P. Bonner et al.
we employed a qPCR micro-dissection technique whereby following the treatment of OHSCs with epoxomicin or vehicle, the CA1, CA3 and DG were dissected out under high magnification, and qPCR carried out on the pooled (n = 36) samples for each condition (Fig. 4a). To ensure that cross-contamination between the OHSCs regions was minimal we examined the expression of bok (Fig. 4b) and desmoplakin (Fig. 4c), genes known to be enriched in the CA3 and DG respectively (Lein et al. 2004). These genes were found to be differentially expressed as previously reported (Fig. 4b and c). We next examined the expression levels of the p53 target genes puma (Nakano and Vousden 2001) and p21 (Raycroft et al. 1990; Gartel and Tyner 1999) in the different sub-fields of the OHSC following epoxomicin treatment and identified a marked and selective induction of both puma and p21 within the CA1 region of the hippocampus. We next investigated the activation of the cytoprotective hsp70 gene. Control qPCR analysis experiments of hsp70 mRNA levels in whole OHSCs incubated with epoxomicin identified a dramatic time dependent increase in hsp70 expression (Figure S2). Further analysis of microdissected OHSCs revealed that this induction of hsp70 mRNA occurred primarily in the CA3 and DG regions with a notable absence of increased expression in the CA1 (Fig. 4f). Immunohistochemical analysis of Hsp70 protein levels confirmed the differential activation of Hsp70 expression within the OHSCs in response to epoxomicin treatment.
Whilst Hsp70 immuno-staining was prominent within the CA3 and DG regions, there was little or no increase in protein levels of Hsp70 evident within the CA1 (Fig. 5a and b). Treatment with the heat shock response inducer geldanamycin reverses the selective vulnerability of the CA1 region to proteasome inhibition In order to further establish that the selective vulnerability of the CA1 to proteasome inhibition in the intact environment of OHSCs could be related to a negative interaction of Hsp70 expression with p53 gene activation we pre-treated OHSCs with geldanamycin a negative regulator of Hsp90 activity which leads to the downstream up-regulation of Hsp70 expression (Zou et al. 1998) but also functions as an indirect inhibitor of Ras/Raf-1 signaling (Blagosklonny 2002). Following geldanamycin pre-treatment we analyzed the levels of p53 activation and cell death after epoxomicin treatment. Control experiments demonstrated that geldanamycin pretreatment potently increased the expression of Hsp70 within the CA1 (Fig. 6a). As demonstrated in Fig. 6(b), this pretreatment with geldanamycin was sufficient to dramatically reduce the accumulation of p53 (Fig. 6b) following epoxomicin treatment and significantly reduced it’s ability to increase the levels of the p53 target gene, p21 (Figure S3). Furthermore, geldanamycin pre-treatment reduced cell death within the CA1 following subsequent treatment with epoxomicin (Fig. 6c) with quantification of the PI staining within
(a)
(b)
(c)
(d)
(e)
(f)
Fig. 4 Differential expression of p53 target genes between the CA1 and CA3 regions of the hippocampus following epoxomicin treatment. (a) Schematic demonstrating the various regions of the OHSC which were micro-dissected for qPCR analysis. Real time qPCR analysis of bok (b) and desmoplakin (c) expression levels in the CA1, CA3 and dentate gyrus (DG) regions of the microdissected hippocampus. (d, e, f) Expression of puma, p21 and hsp70 mRNA in the various subfields
of the OHSC was analysed in OHSCs treated with 250 nM epoxomicin (Epoxo) or vehicle (Veh) for 16 h. The CA1, CA3 and DG regions were micro-dissected and pooled (n = 36 slices per region per condition). Real time qPCR analysis was performed and the data normalised to b-actin and expressed relative to vehicle treated controls from each appropriate region.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
CA1 injury and proteasome inhibition | 613
(a)
(b)
Fig. 5 Differential expression of Hsp70 within the hippocampus in response to proteasomal inhibition. (a) Representative images of Hsp70 staining in CA1, CA3 and DG following treatment with 250 nM epoxomicin (Epoxo) for 24 h. Scale bar = 5 lm. (b) Quantification of cells with Hsp70 expression within the CA1, CA3 and DG regions of the hippocampus after treatment with epoxomicin for indicated time periods. Data presented as a percentage of total neurons positive for Hsp70 within each field of view (three slices quantified at each time point from two separate experiments). *p < 0.05 compared to vehicle treated controls from same sub-field of the OHSC.
the CA1 revealing that geldanamycin pre-treatment reduced the epoxomicin induced cell death levels to that of vehicle treated slices (Fig. 6d).
Discussion Defects in protein quality control (such as endoplasmic reticulum and proteasomal stress) activate evolutionary conserved stress response and gene expression pathways. These aid to alleviate stress by inhibiting protein translation and increasing the protein folding and degradation capacity of a cell, often resulting in increased resistance of cells to further injuries. Defects in proteasomal degradation and other protein degradation pathways, however, can also induce apoptosis, and have been suggested to contribute to cell death and neurodegeneration associated with ischemic injury and several neurodegenerative disorders. Using OHSCs as a model system, we here explored the question of selective vulnerability of central neurons in response to proteasome inhibition and the underlying ‘decision making’. We demonstrate a selective vulnerability of pyramidal neurons within the CA1 in response to proteasomal inhibition despite the accumulation of ubiquitinylated proteins throughout all regions of the hippocampus. This injury was dependent on
puma expression, a BH3-only protein and pro-apoptotic p53 target gene. We also demonstrate that this selective vulnerability is associated with surprisingly narrow, confined activation of pro-apoptotic gene expression pathways in vulnerable neurons, and cytoprotective pathways (Hsp70) in non-vulnerable neurons. Finally we demonstrate a strong correlation between hsp70 gene activation and the subsequent activation of p53 and apoptosis, suggesting that these signalling pathways are key determinants of proteasomal stress induced survival and apoptosis. In this study, we used the highly selective proteasomal inhibitor, epoxomicin, to inhibit the proteasome within OHSCs, a structure that has different neuronal populations. From the outset of this study it was readily evident that the pyramidal neurons within the CA1 region of the hippocampus were highly vulnerable to proteasomal stress. This finding is particularly interesting in the context of delayed ischemic injury in response to global ischemia, where the accumulation of polyubiquitinylated proteins is detectable in the selectively vulnerable neurons of the hippocampal CA1 subfield prior to their degeneration (Hu et al. 2000). Interestingly, only approximately 40% of cells in the CA1 were positive for ubiquitin inclusions despite levels of 75% cell death within 24 h in the CA1 although this may be attributable to decreased immunofluorescent staining because of leakage of ubiquitinylated proteins from neurons which have undergone cell death and whose cell membrane is no longer impermeable. This selective vulnerability has been historically attributed to a higher density of NMDA receptors within the CA1 (Simon et al. 1984). However, we could not demonstrate a role for excitotoxicity during proteasome inhibitor-induced CA1 injury, suggesting that multiple stress pathways can induce a selective vulnerability of CA1 neurons. A selective vulnerability of motorneurons to the less specific proteasome inhibitor, lactacystin, has previously been reported in organotypic rat spinal cord slice cultures (Tsuji et al. 2005). It therefore appears that specific neuronal populations are selectively vulnerable to the consequences of prolonged proteasome inhibition. Here we demonstrated that neurons within the CA1 region of OHSCs derived from puma)/) mice are almost completely protected from the proteasomal stress induced by epoxomicin and bortezomib indicating a key role for puma expression in propagating the neuronal injury. It is apparent that the regulation of p53 within cells is highly dependent on a fully functional proteasome complex with alterations in proteasome activity resulting in a rapid increase in cellular p53 levels (Maki et al. 1996; Kubbutat et al. 1997; Lopes et al. 1997). Indeed, the p53/PUMA pathway has been shown to play a predominant role in the injury associated with a cellular model of Parkinson’s disease (Biswas et al. 2005), depletion of PUMA delays motorneuron loss in ALS mice (Kieran et al. 2007) and it has also been reported that after cerebral ischemia in rats, PUMA expression is up-
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
614 | H. P. Bonner et al.
(a)
(b)
(c) (d)
Fig. 6 Induction of Hsp70 expression with geldanamycin attenuates Epoxo induced CA1 injury. OHSCs prepared from C57BL6/J mice were pre-incubated with geldanamycin (200 nM) for 24 h prior to exposure to Epoxo (250 nM) for 24 h. (a) Representative images of DAPI and Hsp70 staining in the CA1 of OHSCs following treatment with vehicle (DMSO) or geldanamycin (200 nM) for 24 h. Scale bar = 10 lm. (b) Representative images of p53 staining in the CA1 following treatment with either vehicle, epoxomicin, geldanamycin or
geldanamycin and epoxomicin for 24 h. Scale bar = 5 lm. (c) Representative images of control OHSCs and geldanamycin pre-treated OHSCs exposed to vehicle (0.1% DMSO) or Epoxo (250 nM) for 24 h. Scale bar = 500 lm. (d) Quantification of neuronal injury using PI staining within the CA1 region. Data presented as a percentage of total cell death (three separate experiments carried out in triplicate). *p < 0.05 difference between injury in the CA1 induced by epoxomicin pre-treated with vehicle versus those pre-treated with geldanamycin.
regulated in the CA1 region of the hippocampus (Reimertz et al. 2003; Niizuma et al. 2009). While it was perhaps less surprising that puma activation occurred selectively in CA1, we also noted a selective activation of the apoptosis-unrelated p53 target gene p21 in the CA1. Perhaps more surprisingly, the induction of Hsp70 at a transcriptional and translational level was significantly blocked in the CA1 and activated in the other sub-regions of the hippocampus. Notably a previous study has identified a similar pattern of Hsp70 induction in the CA1, with an absence in the dentate gyrus and CA3 following global cerebral ischemia (Vass et al. 1988). Furthermore, in motor neurons an impaired ability to activate heat shock factor 1 has been shown to be associated with the progression of ALS (Batulan et al. 2003), a disease which has also been linked to proteasome dysfunction. These findings suggest that specific neuronal populations recruit specific transcriptional complexes in response to proteasomal stress, and initiate specific signalling pathways that ultimately determine cellular outcome. This may be mediated via differences in the baseline expression of transcription factors and/or their regulators which are then disturbed following inhibition of protein
degradation. Alternatively, the activity and composition of the ubiquitin-proteasome pathway may be differentially regulated in the various neuronal populations. Interestingly, Rideout and colleagues have previously demonstrated that in neurons, derived from the rat embryonic ventral midbrain, the tyrosine hydroxylase-positive dopaminergic neurons fail to induce Hsp70 and undergo apoptosis following proteasome inhibition; whilst the GABA-positive neurons up-regulate Hsp70 and fail to undergo apoptosis (Rideout et al. 2005). Importantly, we also demonstrate that these transcriptional pathways can functionally interact. Induced expression of Hsp70 in the OHSCs using the pharmacological activator, geldanamycin (Xu et al. 2003; Ouyang et al. 2005), potently inhibited p53-dependent gene activation and injury to the CA1 region of the hippocampus following proteasomal inhibition with epoxomicin. Geldanamycin has been previously demonstrated to increase Hsp70 expression and to be neuroprotective in a number of models including focal cerebral ischemia (Lu et al. 2002), Parkinson’s disease (Shen et al. 2005) and Huntington’s disease (Sittler et al. 2001). Several studies have demonstrated that inhibition of Hsp70 expression results in the activation of p53 signalling pathways
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
CA1 injury and proteasome inhibition | 615
(Sherman et al. 2007; Gabai et al. 2009). Interestingly, Hsp70 and p53 have previously been demonstrate to interact with one another in cancer cells (Pinhasi-Kimhi et al. 1986; Matsumoto et al. 1994; Chen et al. 1999) with disruption of this interaction demonstrated to induce cell death (Leu et al. 2009). Therefore, an investigation of the interdependence of Hsp70 expression and p53 activation during ischemic injury and neurodegenerative disorders may well be warranted. Undoubtedly, inhibition of Hsp70 expression using siRNA technology or via pharmacological means such as utilising the recently identified Hsp70 inhibitor, pifithrin l (Leu et al. 2009), will aid in the elucidation of the functional significance of the selective Hsp70 induction in the hippocampus following proteasomal stress. Indeed, such tools may also provide be useful in assessing the selective vulnerability of subregions of the hippocampus during other neuronal insults including ischemia. In conclusion, the current study has highlighted the differential inducible expression of cytoprotective (Hsp70) and pro-apoptotic (p53/PUMA) stress signalling pathways within the hippocampus as a major determinant of the consequences of proteasome inhibition. This finding may have wider implications for our understanding of selective vulnerability and the potential treatment of ischemic and neurodegenerative disorders.
Acknowledgements This work was supported by grants from Science Foundation Ireland (08/IN.1/B1949) to J.H.M.P., and the Health Research Board to J.H.M.P. (RP/2005/238) and M.W.W. (RP/2006/181). The authors wish to thank Dr. Andreas Strasser (WEHI, Melbourne, Australia) for the puma)/) mice.
Supporting Information Additional Supporting information may be found in the online version of this article: Figure S1. Induction of puma mRNA following epoxomicin treatment in OHSCs. Figure S2. Induction of hsp70 mRNA following epoxomicin treatment in OHSCs. Figure S3. Inhibition of epoxomicin induced p21 expression in the CA1 following pre-treatment with geldanamycin. As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.
References Asai A., Tanahashi N., Qiu J. H., Saito N., Chi S., Kawahara N., Tanaka K. and Kirino T. (2002) Selective proteasomal dysfunction in the
hippocampal CA1 region after transient forebrain ischemia. J. Cereb. Blood Flow Metab. 22, 705–710. Batulan Z., Shinder G. A., Minotti S., He B. P., Doroudchi M. M., Nalbantoglu J., Strong M. J. and Durham H. D. (2003) High threshold for induction of the stress response in motor neurons is associated with failure to activate HSF1. J. Neurosci. 23, 5789– 5798. Biswas S. C., Ryu E., Park C., Malagelada C. and Greene L. A. (2005) Puma and p53 play required roles in death evoked in a cellular model of Parkinson disease. Neurochem. Res. 30, 839–845. Blagosklonny M. V. (2002) Hsp-90-associated oncoproteins: multiple targets of geldanamycin and its analogs. Leukemia 16, 455–462. Bruijn L. I., Houseweart M. K., Kato S., Anderson K. L., Anderson S. D., Ohama E., Reaume A. G., Scott R. W. and Cleveland D. W. (1998) Aggregation and motor neuron toxicity of an ALS-linked SOD1 mutant independent from wild-type SOD1. Science 281, 1851–1854. Bush K. T., Goldberg A. L. and Nigam S. K. (1997) Proteasome inhibition leads to a heat-shock response, induction of endoplasmic reticulum chaperones, and thermotolerance. J. Biol. Chem. 272, 9086–9092. Chen Y. C., Lin-Shiau S. Y. and Lin J. K. (1999) Involvement of heatshock protein 70 and P53 proteins in attenuation of UVC-induced apoptosis by thermal stress in hepatocellular carcinoma cells. Photochem. Photobiol. 70, 78–86. Concannon C. G., Koehler B. F., Reimertz C. et al. (2007) Apoptosis induced by proteasome inhibition in cancer cells: predominant role of the p53/PUMA pathway. Oncogene 26, 1681–1692. Concannon C. G., Ward M. W., Bonner H. P. et al. (2008) NMDA receptor-mediated excitotoxic neuronal apoptosis in vitro and in vivo occurs in an ER stress and PUMA independent manner. J. Neurochem. 105, 891–903. Forno L. S., DeLanney L. E., Irwin I. and Langston J. W. (1996) Electron microscopy of Lewy bodies in the amygdala-parahippocampal region. Comparison with inclusion bodies in the MPTPtreated squirrel monkey. Adv. Neurol. 69, 217–228. Gabai V. L., Yaglom J. A., Waldman T. and Sherman M. Y. (2009) Heat shock protein Hsp72 controls oncogene-induced senescence pathways in cancer cells. Mol. Cell. Biol. 29, 559–569. Gartel A. L. and Tyner A. L. (1999) Transcriptional regulation of the p21 (WAF1/CIP1) gene. Exp. Cell Res. 246, 280–289. Giffard R. G., Xu L., Zhao H. et al. (2004) Chaperones, protein aggregation, and brain protection from hypoxic/ischemic injury. J. Exp. Biol. 207, 3213–3220. Hoozemans J. J., van Haastert E. S., Nijholt D. A., Rozemuller A. J., Eikelenboom P. and Scheper W. (2009) The unfolded protein response is activated in pretangle neurons in Alzheimer’s disease hippocampus. Am. J. Pathol. 174, 1241–1251. Hu B. R., Martone M. E., Jones Y. Z. and Liu C. L. (2000) Protein aggregation after transient cerebral ischemia. J. Neurosci. 20, 3191–3199. Hu B. R., Janelidze S., Ginsberg M. D., Busto R., Perez-Pinzon M., Sick T. J., Siesjo B. K. and Liu C. L. (2001) Protein aggregation after focal brain ischemia and reperfusion. J. Cereb. Blood Flow Metab. 21, 865–875. Kieran D., Woods I., Villunger A., Strasser A. and Prehn J. H. (2007) Deletion of the BH3-only protein puma protects motoneurons from ER stress-induced apoptosis and delays motoneuron loss in ALS mice. Proc. Natl Acad. Sci. USA 104, 20606–20611. Kikuchi H., Almer G., Yamashita S., Guegan C., Nagai M., Xu Z., Sosunov A. A., McKhann 2nd G. M. and Przedborski S. (2006) Spinal cord endoplasmic reticulum stress associated with a microsomal accumulation of mutant superoxide dismutase-1 in an ALS model. Proc. Natl Acad. Sci. USA 103, 6025–6030.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
616 | H. P. Bonner et al.
Kubbutat M. H., Jones S. N. and Vousden K. H. (1997) Regulation of p53 stability by Mdm2. Nature 387, 299–303. Lang-Rollin I., Vekrellis K., Wang Q., Rideout H. J. and Stefanis L. (2004) Application of proteasomal inhibitors to mouse sympathetic neurons activates the intrinsic apoptotic pathway. J. Neurochem. 90, 1511–1520. Lein E. S., Zhao X. and Gage F. H. (2004) Defining a molecular atlas of the hippocampus using DNA microarrays and high-throughput in situ hybridization. J. Neurosci. 24, 3879–3889. Leu J. I., Pimkina J., Frank A., Murphy M. E. and George D. L. (2009) A small molecule inhibitor of inducible heat shock protein 70. Mol. Cell 36, 15–27. Lopes U. G., Erhardt P., Yao R. and Cooper G. M. (1997) p53-dependent induction of apoptosis by proteasome inhibitors. J. Biol. Chem. 272, 12893–12896. Lu A., Ran R., Parmentier-Batteur S., Nee A. and Sharp F. R. (2002) Geldanamycin induces heat shock proteins in brain and protects against focal cerebral ischemia. J. Neurochem. 81, 355–364. Maki C. G., Huibregtse J. M. and Howley P. M. (1996) In vivo ubiquitination and proteasome-mediated degradation of p53(1). Cancer Res. 56, 2649–2654. Matsumoto H., Shimura M., Omatsu T., Okaichi K., Majima H. and Ohnishi T. (1994) p53 proteins accumulated by heat stress associate with heat shock proteins HSP72/HSC73 in human glioblastoma cell lines. Cancer Lett. 87, 39–46. Murphy N., Bonner H. P., Ward M. W., Murphy B. M., Prehn J. H. and Henshall D. C. (2008) Depletion of 14-3-3 zeta elicits endoplasmic reticulum stress and cell death, and increases vulnerability to kainate-induced injury in mouse hippocampal cultures. J. Neurochem. 106, 978–988. Murphy B. M., Engel T., Paucard A. et al. (2010) Contrasting patterns of Bim induction and neuroprotection in Bim-deficient mice between hippocampus and neocortex after status epilepticus. Cell Death Differ. 17, 459–468. Nakano K. and Vousden K. H. (2001) PUMA, a novel proapoptotic gene, is induced by p53. Mol. Cell 7, 683–694. Niizuma K., Endo H., Nito C., Myer D. J. and Chan P. H. (2009) Potential role of PUMA in delayed death of hippocampal CA1 neurons after transient global cerebral ischemia. Stroke 40, 618–625. Ouyang Y. B., Xu L. and Giffard R. G. (2005) Geldanamycin treatment reduces delayed CA1 damage in mouse hippocampal organotypic cultures subjected to oxygen glucose deprivation. Neurosci. Lett. 380, 229–233. Palombella V. J., Rando O. J., Goldberg A. L. and Maniatis T. (1994) The ubiquitin-proteasome pathway is required for processing the NF-kappa B1 precursor protein and the activation of NF-kappa B. Cell 78, 773–785. Paschen W. and Doutheil J. (1999) Disturbances of the functioning of endoplasmic reticulum: a key mechanism underlying neuronal cell injury? J. Cereb. Blood Flow Metab. 19, 1–18. Pinhasi-Kimhi O., Michalovitz D., Ben-Zeev A. and Oren M. (1986) Specific interaction between the p53 cellular tumour antigen and major heat shock proteins. Nature 320, 182–184. Rakhit R., Cunningham P., Furtos-Matei A., Dahan S., Qi X. F., Crow J. P., Cashman N. R., Kondejewski L. H. and Chakrabartty A. (2002) Oxidation-induced misfolding and aggregation of superoxide dismutase and its implications for amyotrophic lateral sclerosis. J. Biol. Chem. 277, 47551–47556. Ravid T. and Hochstrasser M. (2008) Diversity of degradation signals in the ubiquitin-proteasome system. Nat. Rev. Mol. Cell Biol. 9, 679– 690. Raycroft L., Wu H. Y. and Lozano G. (1990) Transcriptional activation by wild-type but not transforming mutants of the p53 anti-oncogene. Science 249, 1049–1051.
Reimertz C., Kogel D., Rami A., Chittenden T. and Prehn J. H. (2003) Gene expression during ER stress-induced apoptosis in neurons: induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway. J. Cell Biol. 162, 587–597. Rideout H. J. and Stefanis L. (2002) Proteasomal inhibition-induced inclusion formation and death in cortical neurons require transcription and ubiquitination. Mol. Cell. Neurosci. 21, 223–238. Rideout H. J., Lang-Rollin I. C., Savalle M. and Stefanis L. (2005) Dopaminergic neurons in rat ventral midbrain cultures undergo selective apoptosis and form inclusions but do not up-regulate iHSP70, following proteasomal inhibition. J. Neurochem. 93, 1304–1313. Saxena S., Cabuy E. and Caroni P. (2009) A role for motoneuron subtype-selective ER stress in disease manifestations of FALS mice. Nat. Neurosci. 12, 627–636. Shen H. Y., He J. C., Wang Y., Huang Q. Y. and Chen J. F. (2005) Geldanamycin induces heat shock protein 70 and protects against MPTP-induced dopaminergic neurotoxicity in mice. J. Biol. Chem. 280, 39962–39969. Sherman M., Gabai V., O’Callaghan C. and Yaglom J. (2007) Molecular chaperones regulate p53 and suppress senescence programs. FEBS Lett. 581, 3711–3715. Simon R. P., Swan J. H., Griffiths T. and Meldrum B. S. (1984) Blockade of N-methyl-D-aspartate receptors may protect against ischemic damage in the brain. Science 226, 850–852. Sittler A., Lurz R., Lueder G., Priller J., Lehrach H., Hayer-Hartl M. K., Hartl F. U. and Wanker E. E. (2001) Geldanamycin activates a heat shock response and inhibits huntingtin aggregation in a cell culture model of Huntington’s disease. Hum. Mol. Genet. 10, 1307–1315. Stoppini L., Buchs P. A. and Muller D. (1991) A simple method for organotypic cultures of nervous tissue. J. Neurosci. Methods 37, 173–182. Striggow F., Riek M., Breder J., Henrich-Noack P., Reymann K. G. and Reiser G. (2000) The protease thrombin is an endogenous mediator of hippocampal neuroprotection against ischemia at low concentrations but causes degeneration at high concentrations. Proc. Natl Acad. Sci. USA 97, 2264–2269. Traenckner E. B., Wilk S. and Baeuerle P. A. (1994) A proteasome inhibitor prevents activation of NF-kappa B and stabilizes a newly phosphorylated form of I kappa B-alpha that is still bound to NFkappa B. EMBO J. 13, 5433–5441. Tsuji S., Kikuchi S., Shinpo K., Tashiro J., Kishimoto R., Yabe I., Yamagishi S., Takeuchi M. and Sasaki H. (2005) Proteasome inhibition induces selective motor neuron death in organotypic slice cultures. J. Neurosci. Res. 82, 443–451. Vass K., Welch W. J. and Nowak Jr T. S. (1988) Localization of 70-kDa stress protein induction in gerbil brain after ischemia. Acta Neuropathol. 77, 128–135. Villunger A., Michalak E. M., Coultas L., Mullauer F., Bock G., Ausserlechner M. J., Adams J. M. and Strasser A. (2003) p53- and drug-induced apoptotic responses mediated by BH3-only proteins puma and noxa. Science 302, 1036–1038. Vornov J. J., Tasker R. C. and Coyle J. T. (1991) Direct observation of the agonist-specific regional vulnerability to glutamate, NMDA, and kainate neurotoxicity in organotypic hippocampal cultures. Exp. Neurol. 114, 11–22. Xu L., Ouyang Y. B. and Giffard R. G. (2003) Geldanamycin reduces necrotic and apoptotic injury due to oxygen-glucose deprivation in astrocytes. Neurol. Res. 25, 697–700. Zimmer J. and Gahwiler B. H. (1984) Cellular and connective organization of slice cultures of the rat hippocampus and fascia dentata. J. Comp. Neurol. 228, 432–446. Zou J., Guo Y., Guettouche T., Smith D. F. and Voellmy R. (1998) Repression of heat shock transcription factor HSF1 activation by HSP90 (HSP90 complex) that forms a stress-sensitive complex with HSF1. Cell 94, 471–480.
! 2010 The Authors Journal Compilation ! 2010 International Society for Neurochemistry, J. Neurochem. (2010) 114, 606–616
