Differential extra-renal expression of the mouse renin genes.

Volume 17 Number 8 1989

Nucleic Acids Research

Differential extra-renal expression of the mouse renin genes Christopher C.J.Miller*, Andrew T.Carter, Jeanie I.Brooks, Robin H.Lovell-Badgel and William J.Brammar

Leicester University/ICI Joint Laboratory, Department of Biochemistry, University of Leicester, University Road, Leicester LEl 7RH and 1MRC Mammalian Development Unit, Wolfson House, 4 Stephenson Way, London NWI 2HE, UK Received January 31, 1989; Revised and Accepted March 16, 1989

ABSTRACT We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-ID in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-lC and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-11D transgene (Ren-l*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D.

INTRODUCTION The aspartyl protease renin catalyses the initial and rate-limiting step in the conversion of angiotensinogen to the vasoactive hormone angiotensin II and thus plays a key role in the regulation of blood pressure (1). The primary site of renin biosynthesis is the juxtaglomerular apparatus of the kidney. Mice are polymorphic for the number of renin genes: certain inbred strains (eg C57BV16, CBA) harbour a single renin gene, Ren-1, whilst others (eg DBA/2J) contain two renin genes, Ren-l and Ren-2. In this report, we term the Ren-I gene of one-gene strains Ren-1C and its homologue in two-gene animals Ren-1D. In two-gene strains, the Ren-2 gene is situated approximately 20kb upstream of Ren-1D and both are transcribed in the same direction (2). The renin genes are located on chiromosome 1 of the mouse (3). The presence of the Ren-2 gene correlates with high concentrations of renin mRNA in the submandibular gland (SMG), where Ren-2 expression is elevated approximately 100-fold compared to that of the Ren-1C gene of one-gene strains (4). Renin expression in the SMG is positively controlled by androgens and thyroxine (5,6). SMG renin does not,

©) IRL Press

3117

Nucleic Acids Research however, participate in the control of blood pressure (7). Studies aimed at defining the DNA sequences involved in the control of both Ren-1C/D and Ren-2 expression have been hampered by the unavailability of a renin-producing cell line for DNA transfection. The renin-producing cells of the juxtaglomerular apparatus represent only 0.1% of the kidney cell population (4). However, a Ren-2 transgene comprising the transcriptional unit plus 2.5kb of upstream and 3kb of downstream sequence is sufficient to direct expression to both the kidney and SMG in transgenic mice. Expression of this transgene is also inducible with androgens (8).

Sequence and heteroduplex analyses of cloned Ren-1C, Ren-lD and Ren-2 DNA demonstrate a. high degree of homology within the region of the structural gene (9,10,11). Differences between the flanking sequences of Ren-1C/D and Ren-2 can, however, be discerned and include a proviral intracisternal A particle located downstream of Ren-2 and a B2 repetitive element situated upstream of Ren-2 (12,13). Such sequence variations represent putative cis-acting DNA elements which may be responsible for the different expression patterns observed between the Ren-1 and Ren-2 genes. In contrast, the flanking sequences of Ren-1C and Ren-1D are highly conserved and based upon this homology, the 98.4% homology of their coding sequences (11,14) and similar expression pattern in kidney and SMG, there is a general assumption that Ren-1 C and Ren-1 D display the same tissue-specificities and regulation. In this report, we have analysed renin gene expression in various extra-renal sites of oneand two-gene inbred mouse strains. Using RNase-protection experiments designed to discriminate between Ren-I D and Ren-2 transcripts, we distinguish for the first time, expression of these genes in SMG, testes, liver, brain and heart. The results demonstrate that the Ren-lC and Ren-1D genes display different tissue-specificities. A transgenic Ren-l D in the genetic background of a one-gene strain retains its characteristic tissue-specificity, suggesting that Ren-1 C and Ren-1 D contain different cis-acting DNA elements.

RESULTS Renin gene expression in one gene (CBA and C57BI/6) and two gene (DBA/2J) strains. In order to determine the expression pattern of Ren-1 in both one gene and two gene strains, we performed RNase-protection analyses of RNAs from CBA, C57BI/6 and DBA/2J mice. Figure 1 shows RNase-protection analyses of RNAs from C57BI/6 mice using the riboprobe derived from exon 2 of Ren-11D. Identical results were obtained with CBA mice (data not shown). The 150bp protected fragment diagnostic of Ren-1C expression can be seen with RNA from kidney, SMG, testes, brain and heart. The signals from brain and heart RNA were the lowest (despite using 250ig of RNA) and were approaching the limits of sensitivity of the technique. In contrast, similar RNase-protection analyses of RNAs from

DBAI2J 3118

mice (Figure 2) demonstrate the

presence

of renin mRNA in kidney, SMG, testes,


150w

.:~~~~~~~~~~~~M

a bc

d

e

f

9

h

k

m

n

Fig. 1. RNase-protection analyses of RNAs from organs of 10 week old C57B1/6 male mice. of kidney and SMG RNA and 250~Ig of testes, liver, brain and heart RNA were hybridized to 5xlO5cpm of the untagged Ren-11)-derived riboprobe. Track a, kidney; track b, SMG; track c, testes; track d, liver; track e, brain; track f, heart. Tracks g and h are negative controls containing 250,ug of yeast tRNA or riboprobe only respectively. Tracks j, k, 1, m and n are extended exposures of tracks d-h.

501tg

liver, brain and heart. We reproducibly obtain stronger signals from DBA testes RNA than from the corresponding RNA from one gene strains. A 3bp mis-match between Ren-11D and Ren-2 (14,15) within exon 2 allowed us to discriminate between the transcripts of these two genes. Ren-11D transcripts protect the riboprobe over the full length of exon 2, producing a lSObp fragment. The sequence mis-match in Ren-2 gives rise to 1lObp and 37bp fragmnents. In our hands, the 37bp fragment is often obscured by numerous lower molecular weight species beginning at 40-50bp which we are unable to exclude, so for clarity only the 11 Obp fragmnent ls shown. Signal-to-noise ratios in RNase-protection analyses are known to be susceptible to numerous The application of the riboprobe to RNAs from DBA/2J mice (Figure 2) shows is expressed in kidney, SMG, testes, liver, brain and heart and that Ren-2 is kidney, SMG, testes, and possibly liver, brain and heart. Ren-1 D expression is detectable, but low. The signals from brain and heart RNA are again approaching the limits of sensitivity of the technique. The approximate relative levels of Ren-I C, Ren-1 D and Ren-2 mRNA that we detect in the different organs are shown in Table 1. mice containing the Ren11 gene. Production of tran..enic The RNase protection data suggest that the Reno1C and Reno11 genes exhibit different factors (16). that Ren-11D expressed in in the SMG

3119


'S

Fig. 2. RNase-protection analyses of RNAs from organs of 10 week old DBA miale mice. SOp,t of kidney 1 &of SMG and 250pg of testes, liver, brain and heart RNA were hybridized to YSxIlOcpm of the native Ren-lD-derived riboprobe. Track a, kidney; track b, SMG; track c, testes; track d, liver; track e, brain; track f, heart. Tracks g and h are negative controls containing 2SOpg of yeast tRNA or riboprobe only respectively. Tracks j, k, 1 and m are extended exposures of tracks e-h.

tissue-specif'icities. In order to distinguish the influence of cis-specific sequence elements from trans-acting factors on gene expression, we have introduced a Ren-11D gene into the same genetic background as Ren-1C by construction of transgenic mice. To distinguish the Table 1. Approximate amounts of Ren-1C, Ren,iD, Ren-2 and Ren-l* mRNA detected in the organs of one-gene, two-gene and transgenic mice ORGA

Ren-IC

Ren-I1D

Rten-2

RZen.-l*

Kidney

+++

++

++

H

SMG

++

+

Testes

t

+

+

Liver

-

-

-

Drain

+

+

+

Heart

+

+

+

+++

+ +

+

The Res-1C trnsripts were assyed in CS7BLI6 and CBA/ca mice; the Ren-1D and Ren-2 transripts wetre -me in extrac from DBA/2 mice; the Ren-I* trnmscripts were assayed in flnsI pn'IC mice in the C57BLJ6xCBA/ca background which also carries the Ren-1C pene. 3120


l CCTCGAGGAGTAGGAATCTTCGGAATGGGA GGAGCTCCTCATCCTTAGAAGCCTTACCCT

Bl E

E

B H

B2 H

E B H

H

E

S

Fig. 3. Ren-l* DNA construct introduced into transgenic mice. Boxes show Ren-1D exons (1 to 9). B, BamHl; B1, Bgll; B2, Bgll; E, EcoRl; H, HindI; S, Smal; X, Xhol. Scale bar=Skb.

Ren-1D transgene (Ren-l*) and its transcript from the highly homologous Ren-1C gene of the recipient strain, a synthetic deoxyoligonucleotide of 30 base-pairs containing a unique XhoI site was introduced into exon 2 of the Ren-1D gene (Figure 3). A 19kb SaII fragment containing the modified Ren-1D gene, Ren-l*, was used to produce transgenic mice in a background containing only the Ren-IC gene. Mice harbouring Ren-l* transgenes were identified by Southern analyses (17). DNAs were restricted with BamHI and XhoI and probed with a 6.6kb BamHI fragment spanning exons 2 to 5 from Ren-l* (Figure 3). The Ren-lC gene of C57 and CBA strains produces fragments of approximately 5.3kb, 0.8kb and 0.5kb in this Southern analysis whilst an untagged Ren-lD gene of DBA/2J mice produces a 6.6kb fragment. These differences are due to the different restriction patterns of

6i:6~ 9:*z 646*

4

.-

9

2.6-

a

b

c

d

Fig. 4. Southern analyses of Ren-1* transgenic founders. Track a, non-transgenic control; track b, transgenic #101; track c, transgenic #4; track d, transgenic #59. The weaker hybridizing 0.8kb and 0.5kb fragments from the endogenous Ren-lC gene are not visible on this exposure. 3121


Fig. 5. RNase-protection analyses of RNAs from organs of F1 males from transgenic founder #59, sacrificed at 10 weeks of age and a non-transgenic male sibling control. 40Lg of kidney, SMG, testes and liver RNA, 30,ug of brain and heart RNA and 15OjLg testes RNA were hybriized to 5xlO5cpm of the Ren-l*-derived riboprobe. Track a, control kidney; track b, transgenic kidney; track c, transgenic SMG; track d, 40pg transgenic testes RNA; track e, transgenic liver; track f, transgenic brain; track g, transgenic heart. Tracks h and j are negative controls with 15O0Lg yeast tRNA or riboprobe only. Track k, 1 50ytg transgenic testes RNA.

Ren-11D. In contrast, the Ren-1 * transgene produces 4kb and 2.6kb fragments as it contains an XhoI site. Three male transgenic founder mice were obtained (#4, *59, #101), which harboured approximately twenty (#4), three (#59) and ten (#101) Ren-1C and

copies of the transgene (Figure 4). We attribute the presence of the 6.6kb fragment to partial methylation of the Xhol site within the transgene. Further Southern analyses of transgenic DNAs confirmed that apparently full length unrcarranged transgenes had been incorporated. Exreion pattern of the Ren-1* transgene Figure 5 shows RNase-protection analyses of RNAs from F1 males from transgenic founder #59 and a non-transgenic sibling control. Analyses performed using the Ren-1* derived riboprobe produce protected fragments of lOObp and SObp (total = tSObp) from the endogenous Ren-IC gene, but a 180bp fragment from the Ren-1* transgene (Reni-1d*erived RNAs protect the probe over the full length of exon 2). The 180bp fragment diagnostic of transgene expression is only present in transgenic and not control tissues. This 180bp species is produced by RNAs extracted from kidney, SMG, testes, liver and brain of the transgenic

3122

Nucleic Acids Research mice. In contrast, the lOObp and 50bp fragments diagnostic of endogenous Ren-1C gene expression are only generated by RNA from kidney, SMG and testes. As with the 37bp fragment in DBA mice, the 50bp fragment is generally obscured by numerous lower molecular weight species and only the 100bp fragment is shown. Since differential loss of a particular RNA species during work-up of a sample is unlikely, the relative intensities of the 180bp and lOObp fragments within each track, after correction for size differences, correlate with the ratio of transgene-derived and endogenous Ren-lC-derived mRNAs. Thus in kidney, Ren-l* mRNA levels are approximately equal to those of Ren-lC; in the SMG, Ren-l* mRNA levels are lower than those of Ren-lC; in testes, Ren-l* mRNA levels are higher than Ren-1C and in the liver and brain, only the Ren-l* product can be detected (see Table 1). RNase-protection analyses of founder #4 produced similar results and ratios. Transgenic line #101 showed the same patterns and ratios except in kidney, where transgene expression was approximately one quarter that of Ren-1C (data not shown).

DISCUSSION In this report, we analyze renin gene expression in various extra-renal sites of one- and two-gene mouse strains. Previous studies have focussed largely upon renin gene expression in the kidney and SMG of the mouse (4,9,18). Recent work has, however, demonstrated the presence of renin mRNA in the heart and brain of rats and mice (19,20). Using RNase-protection analyses, a triplet sequence mis-match in exon two (14,15) enabled us to discriminate between Ren-1D and Ren-2 transcripts in two-gene DBA/2J mice. We find equal levels of Ren-lD- and Ren-2-derived mRNAs in kidney and approximately 200-fold excess Ren-2 over Ren-1D mRNA in SMG. Previous studies utilizing primer-extension methodologies (4) also showed that Ren-11D and Ren-2 are expressed at equal levels in the kidney but failed to demonstrate Ren-1D expression in the SMG. This failure to detect SMG Ren-1D expression may be due to technical difficulties relating to the predominance of the Ren-2 transcript. However, since primer-extension readily detects Ren-1C derived SMG mRNA in one-gene strains (4) this is consistent with our observations that Ren-lC is expressed at higher levels than Ren-1D in the SMG. Our analyses also demonstrate renin gene expression in several other tissues of DBA/2J mice. By RNase-protection, we can detect both Ren-1D and Ren-2 transcripts in testes and Ren-1D (and possibly Ren-2) transcripts in liver, brain and heart. Renin mRNA levels in brain and heart are, however, approaching the limits of sensitivity of the technique in our hands. In contrast to the situation in DBA/2J mice, similar analyses of one-gene strains (C57BV16 and CBA) show that Ren-1C expression is restricted to the kidney, SMG, testes, brain and heart. We cannot detect Ren-lC-derived mRNA in the liver of these animals. Furthermore, we consistently detect higher levels of Ren-1D compared to Ren-1C expression 3123

Nucleic Acids Research in testes. The Ren-1C

of C57Bt/6 and CBA mice and the

Ren-11D

DBA/2J mice thus display quite different tissue-specificities. The presence of renin mRNA in the liver of DBA2/J and transgenic mice was interesting. Renin activity inhibitable by anti-renin antibodies has been detected in mouse liver (21), and renin mRNA has recently been detected by a nuclease-protection assay in rat liver (22). Although the physiological role of renin in the liver is unknown, the findings that angiotensin II can interact with high affinity receptors in rat liver chromatin (23) and can affect transcription in isolated hepatic nuclei (24) suggests a role for an intracellular gene

gene of

renin-angiotensin system in the regulation of gene expression in the liver. In order to determine whether the different tissue-specificites of the highly homologous Ren-l C and Ren-1 D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-l D transgene (Ren-l *) into a background strain containing only the Ren-1 C gene. In these animals, transgene-derived mRNAs can be detected in kidney, SMG, testes, liver and brain, accurately reflecting Ren-lD expression in DBA/2J mice, whilst Ren-lC-derived mRNAs are restricted to kidney, SMG and testes. The failure to detect expression from either renin gene in the heart is probably due to the lower levels of RNA used in these experiments. We obtain less than 10gg of RNA per mouse heart and are currently breeding the larger numbers of transgenics required to study expression in this organ. Thus the pattern of expression of the Ren-l D transgene in the C57B1/6xCBA background is similar to that in the DBA/2J background and quite distinct from that of Ren-1C. The simplest explanation of this finding is that the different tissue-specificities displayed by Ren-1C and Ren-1D are due to different cis-acting DNA elements contained within these genes or their flanking regions. Indeed, recent studies have shown that the Ren-2 gene is situated approximately 20kb upstream of the Ren-lD gene (2) and that as a consequence, the homology between Ren-lC and Ren-11D breaks down approximately 3.5kb upstream of the transcriptional start sites (our unpublished observations). The different tissue-specificities displayed by Ren-lC and Ren-lD may therefore be due these different flanking sequences some way upstream of the structural genes. More complex explanations based on the interplay of cis-specific sequences and different trans-acting factors cannot be eliminated. We see no correlation between transgene copy number and the level of transgene expression in the different Ren-l* lines. Many genes studied in transgenic mice likewise display correct tissue-specificity but expression levels that fail to correlate with transgene copy number and this has been attributed to positional effects on expression of the transgene (25). DNA sequences flankdng the human B-globin gene cluster have been shown to specify position-independent expression of the B-globin gene that is related to copy number (26). These sequences are located approximately 50kb upstream and 20kb downstream of the B-obin gene. Any corresponding sequences governing Rcn-1D expression levels may

3124

Nucleic Acids Research therefore be absent from our transgene and caution must be exercised in interpreting the ratios of Ren-1C- to transgene-derived mRNAs in the various organs. Nevertheless, the ratios we observe in general corresponds to the levels we see when comparing Ren-1C and Ren-1D in one- and two-gene animals. Thus Ren-l* mRNA levels are similar to those of Ren-1C in kidney, higher than those of Ren-lC in the testes and lower than those of Ren-1C in the SMG (see Table 1). The only exception is in the brain of the transgenics where we can only detect transgene expression. This may in part be due to a loss of sensitivity in studying Ren-1C expression with a Ren-1*-derived riboprobe. However our ability to clearly detect Ren-l* mRNA with the relatively small amounts of RNA used in these experiments may mean that the transgene is being preferentially transcribed in this organ. DNA sequences modulating expression in the brain may therefore be absent from our transgene. Clearly, the identification of any sequences which specify position-independent, copy-number related expression is fundamental to future studies of renin gene control. In order to gain insight into the sequences controlling renin gene-expression, we have also produced transgenic mice bearing a Ren-1D-CAT reporter gene. This comprises the same Ren-lD promoter/upstream and mRNA leader sequences as those of the Ren-l* transgene, potentially driving CAT-expression. We have been unable to detect CAT activity in any organ studied from five independent transgenic lines (data not shown). This observation suggests that sequences downstream of the Ren-11D cap-site are required for transcriptional activity. Sequences downstream of the cap-site are known to influence transcription in a number of genes (for example see 27-35). The mouse Ren-1D gene may thus be analogous to this class of genes in having control element(s) situated downstream of the promoter. Experiments designed to elucidate further the differential expression patterns of Ren-1C, Ren-11D and Ren-2 and to define more closely the location of cis-acting DNA elements are in progress.

MATERIALS AND METHODS Isolation of RNA RNA was isolated from mouse organs by precipitation with lithium chloride/urea. Organs were removed, frozen in liquid nitrogen and then homogenized in approximately 15ml of 3M lithium chloride, 6M urea in a polytron (Northern Media) at 4 C. RNAs were precipitated overnight and collected by centrifugation on a swing-out rotor at 15,000g (average) for 30 minutes. The RNA pellets were dissolved in 10mM Tris-HCl pH 8.5 containing 0.5% (w/v) sodium dodecyl sulphate, extracted twice with phenol/chloroform, twice with chloroform/isoamyl alcohol and precipitated with ethanol. RNAs were resuspended in minimal volumes of diethyl pyrocarbonate-treated water. Absolute amounts were determined by spectrophotometric absorbance at 260nm and RNA integrity estimated by observing 28S and 18S ribosomal bands after glyoxylation and agarose gel electrophoresis (36). 3125

Nucleic Acids Research RNase-Protection assays Transcripts from Ren-11D and Ren-2 in DBA mice, and Ren-1 * and Ren-1C in transgenic animals were discriminated from each other by RNAse-protection analyses (16). A 699bp BglII to HindlIl fragment spanning exon 2 from XRen-l * and the corresponding 669bp fragment from the native "untagged" DBA Ren-1 D gene (Figure 3) were subcloned into Bluescript vectors (Stratagene). Plasmids were linearized with Xbal and riboprobes transcribed with ((>32P) UTP using T7 RNA polymerase. Total RNA samples were hybridized with excess probe and digested essentially as described (16). Protected fragments were resolved on 6% sequencing gels. Production of Ren-1 D DNA constructs The Ren-1 D DNA constructs produced were all derived from previously described X genomic clones from DBA/2 mice (9). Since we possess no clones spanning the entire gene, a complete Ren-11D gene with 5kb of upstream and 4kb of downstream sequence was produced by subcloning BglI-BamHI, BamHI-BamHI and BamHI-SmaI fragments (Figure 3) into pUC18 and then ligating these inserts in X EMBL-301. The design of the cloning permitted release of the intact Ren-1 D gene from vector sequences with Sall. For further details

regarding the structure, sequence and restriction mapping of the Ren-1 D gene, see Burt et al., (11,14). In order to distinguish the Ren-1D transgene and its transcript from the endogenous Ren-1C gene, we inserted a synthetic 30mer into exon 2. The 30mer

5'-CCTCGAGGAGTAGGAATCTTCGGAATGGGA-3' was inserted at a StuI site in exon 2 which is unique within a HindIII fragment spanning this exon. This HindII fragment was therefore subcloned into pUC18, tagged with the 30mer and then replaced. The 30mer contains a unique XhoI site and encodes an additional 10 amino acids (pro, arg, gly, val, gly, leu, phe, gly, met, gly) at a position where pro-renin is cleaved to produce the mature active renin (14). The final "tagged" renin gene was termed Ren-I *. Production and identification of transgenic mice The Ren-1* DNA construct was isolated from vector sequences by Sall digestion and separation on agarose gels. Since the Ren-1 * insert migrates close to the largest X arm, the arms were further restricted with ClaI which does not cut within Ren-1$. DNAs were eluted from excised gel fragments, extracted several times with phenol/chloroform, chloroform/isoamyl alcohol and ether, ethanol-precipitated and dissolved in 5mM Tris-HCI pH 7.5, 0.1mM EDTA at approximately lng/1l. DNAs were injected into the pronuclei of CBAxC57BI/6 F xF1 embryos, cultured overnight and then transferred to 0.5 day pseudopregnant Fl foster mothers as described (37). CBA and C57BI/6 are both single renin gene strains harbouring the Ren-1C gene. Transgenic mice were identified by Southern blotting (17) of DNA isolated from tail segments. Probes were labelled by random deoxyoligonucleotide priming of DNA polymerase in the presence of d32P-dCTP (38).

3126

Nucleic Acids Research ACKNOWLEDGEMENTS We thank the University Grants Committee (UK) and ICI for financial support, John Keyte for production of deoxyoligonucleotides and the Central Photographic Unit in Leicester University for photographic assistance. We also wish to thank Dr. David Morton and staff of the Biomedical Services unit at Leicester University for their advice on animal husbandry and John Clark for gift of X EMBL-301 DNA. Finally, we are indebted to Pat O'Donoghue for typing the manuscript and Nilesh Samani, Dave Burt and Karen Lilleycrop for communicating their unpublished results. *To whom correspondence should be addressed

REFERENCES 1.

2. 3. 4. 5.

6. 7.

8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

22. 23.

Dzau, V.J., and Pratt, R.E. (1986). In Haber, E., Morgan, H., Katz, A., Fozzard H. (eds). Heart and Cardiovascular System. 1631-1667. Raven Press, New York. Abel, K.J. and Gross, K.W. (1988). Nucleic Acids Res. 16, 2111-2126 Wilson, C.M., Erdos, E.G., Wilson, J.D. and Taylor, B.A. (1978). Proc. Natl. Acad. Sci. USA. 75, 5623-5626. Field, L.J. and Gross, K.W. (1985). Proc. Nati. Acad. Sci. USA. 82, 6196-6200. Wilson, C.M., Erdos, E.G., Wilson, J.D. and Taylor, J.D. (1981). Biochem. Genet. 19, 509-523. Wilson, C.M., Myhre, M.J., Reynolds, R.C. and Wilson, J.D. (1982). Endocrinology. 110, 982-989. Bing,J., Poulson, K., Hackenthal, E., Rex, E. and Taugner, R. (1980). J. Histochem.

Cytochem. 28, 874-880. Tronik, D., Dreyfus, M., Babinet, C. and Rougeon, F. (1987). EMBO J. 6, 983-987. Mullins, J.J., Burt, D.W., Windass, J.P., McTurk, P., George, H. and Brammar, W.J. (1982). EMBO J. 1, 1461-1466. Holm, I., Ollo. R., Panthier, J.J. and Rougeon, F. (1984). EMBO J. 3, 557-562. Burt, D.W., Mullins, L.J., George, H., Smith, G.M., Brooks, J.I., Pioli, D. and Brammar, W.J. (1989). Gene. In press. Burt, D.W., Reith, A.D. and Brammar, W.J. (1984). Nucleic Acids Res. 12, 8579-8593. Field, L.J., Philbrick, W.M., Howles, P.N., Dickinson, D.P., McGowan, R.A. and Gross,K.W. (1984). Mot. Cell Bid. 4, 2321-2331. Burt, D.W., Beecroft, L.J., Mullins, J.J., Pioli, D., George, H., Brooks, J.I., Walker, J. and Brammar, W.J. (1985). In Kostka, V. (ed). Aspartic proteinases and their inhibitors. 355-377. Walter de Gruyter and Co., Berlin. Panthier, J.J., Holm, I. and Rougeon, F. (1982). 1 EMBO J. 1417-1421. Melton, D.A., Kreig, P.A., Rebagliati, M.R., Maniatis, T., Zinn, K. and Green, M.R. (1984). Nucleic Acids Res. 12, 7035-7056. Southern, E.M. (1975). J. Mcl. Bicd. 98, 503-517. Rougeon, F., Chambraud, B., Foote, S., Panthier, J.J., Nageotte, R. and Corvol, P. (1981). Proc. Natl. Acad. Sci. USA. 78, 6367-6371. Deschepper, C.F., Mellon, S.H. Cumin, F., Baxter, J.D. and Ganong W.F. (1986). Proc. Natl. Acad. Sci. USA. 83, 7552-7556. Dzau, V.J., Ellison, K.E., Brody, T., Ingelfinger, J. and Pratt, R.E. (1987). Endocrinology. 120, 2334-2338. Dzau, V.J., Ingelfimger, J. and Pratt, R.E. (1986). J. Cardiovasc. Pharmacol. 8, (suppl. 10) S11-S16. Samani, N.J., Swales, J.D. and Brammar, W.J. (1988). Biochem. J. 253, 907-910. Re, R.N., Vizard, D.L., Brown, J. and Bryan, S.E. (1984). Biochem. Biophys. Res. Comm. 119, 220-227.

3127

Nucleic Acids Research 24. Re, R.N. and Parab, M. (1984). Life Sci. 34, 647-651. 25. Palmiter, R.D. and Brinster, R.L. (1986). Ann. Rev. Genet. 20, 465-499. 26. Grosveld, F. van Assendelft, G.B., Greaves, D.R. and Kollias, G. (1987). Cell, 51,

975-985. 27. Choi, O.R. and Engel, J.D. (1986). Nature. 323, 731-734. 28. Antoniou, M., deBoer, E., Habets, G. and Grosveld, F. (1988). EMBO J. 7, 377-384. 29. Kollias, G., Hurst, J., deBoer, E. and Grosveld F. (1987). Nucleic Acids Res. 15,

5739-5747. 30. Wright, S., Rosenthal, A., Flavell, R. and Grosveld, F. (1984). Cell. 38, 265-273. 31. Charnay, P., Treisman, R., Mellon, P., Chao, M., Axel, R. and Maniatis. (1984). Cell. 38, 251-263. 32. Banerji, J. Olson, L. and Schaffner, W. (1983). Cell. 33, 729-740. 33. Queen, C. and Baltimore, D. (1983). Cell. 33, 741-748. 34. Hayashi, S., Goto, K., Okada, T.S. and Kondoh, H. (1988). Genes & Development. 1, 818-828. 35. Krimpenfort, P., de Jong, R., Uematsu, Y., Dembic, Z., Ryser, S., von Boehmer, H., Steinmetz, M. and Berns A. (1988). EMBO J. 7, 745-750 36. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982). Molecular cloning. A laboratory manual. Cold Spring Harbour Laboratory Press. Cold Spring Harbour. NY. 37. Hogan, B., Costantini, F. and Lacy, E. (1986). In Manipulating the mouse embryo: A laboratory manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY. 38. Feinberg, A.P. and Vogelstein, B. (1983). Anal. Biochem. 132, 6-13.

3128