We have determined the extent of RNA cleavage carried out during DNA synthesis by either human immunodeficiency virus (HIV) or avian myeloblastosis.
.=. 1994 Oxford University Press
Nucleic Acids Research, 1994, Vol. 22, No. 18 3793-3800
Quantitative analysis of RNA cleavage during RNAdirected DNA synthesis by human immunodeficiency and avian myeloblastosis virus reverse transcriptases Jeffrey J.DeStefano, Lisa M.Mallaber1, Philip J.Fay1l2 and Robert A.Bambaral 3, * Department of Microbiology, University of Maryland, College Park, MD 20742 and Departments of 'Biochemistry, 2Medicine and 3Cancer Center, University of Rochester, 601 Elmwood Avenue, Rochester, NY 14642, USA Received April 4, 1994; Revised and Accepted August 5, 1994
ABSTRACT We have determined the extent of RNA cleavage carried out during DNA synthesis by either human immunodeficiency virus (HIV) or avian myeloblastosis virus (AMV) reverse transcriptases (RTs). Conditions were chosen that allowed the analysis of the cleavage and synthesis performed by the RT during one binding event on a given template-primer. The maximum quantity of ribonuclease H (RNase H) sensitive template RNA left after synthesis by the RTs was determined by treatment with Escherichia coli RNase H. RNA cleavage products that were expected to be too short to remain hybridized, less than 13 nucleotides in length, were quantitated. Results showed that HIV-and AMV-RT degraded about 80% and less than 20%, respectively, of the potentially degradable RNA to these short products. Survival of longer, hybridized RNA was not a result of synthesis by a population of RTs that had selectively lost RNase H activity. Using an assay that evaluated the proportion of primers extended versus RNA templates cleaved during primer-extension by the RTs, we determined that essentially each molecule of HIV- and AMV-RT with polymerase also has RNase H activity. The results indicate that although both HIVand AMV-RTs cleave the RNA template during synthesis, the number of cleavages per nucleotide addition with HIV-RT is much greater. They also suggest that some hybridized RNA segments remain right after the passage of the RT making the first DNA strand. In vivo, these segments would have to be cleaved or displaced in later reactions before second strand DNA synthesis could be completed. INTRODUCTION The conversion of the single-stranded RNA genome of retroviruses to a double-stranded DNA requires several steps which are carried out by the multifunctional viral RT (1). This enzyme possesses both RNA- and DNA-dependent DNA *To whom correspondence should be addressed
polymerase and RNase H activities (2-5). The latter activity can cleave the RNA portion of an RNA -DNA hybrid. The RNase H activity is proposed to be required at several stages of viral genomic replication. These include degradation of the RNA template after the synthesis of the first strand of DNA (6), generation of a specific oligopurine ribonucleotide primer from which second strand DNA synthesis will initiate, and subsequent removal of the oligopurine primer (7-13). Several reports that address the spacial relationship between the DNA polymerase and RNase H active sites of RT have been published (14-18). These indicate that the active sites of the RT are arranged such that they contact polymer substrates approximately 18-20 nucleotides apart. This distance was based on reports showing that binding of the polymerase domain to the recessed 3' terminus of a relatively short DNA hybridized to a longer RNA, positioned the RNase H active site to make cleavages about 18-20 nucleotides upstream of the DNA terminus. The conclusion was that the position of RNase H mediated cleavages can be coordinated by the binding of the polymerase domain to the substrate. Previous work in our laboratory has shown that the polymerase and RNase H activities of HIV-, AMV- and Moloney murine leukemia virus (M-MuLV)-RTs are uncoupled (19). That is, each nucleotide addition is not necessarily accompanied by a cleavage. This conclusion was based on results showing that during one round of processive RNA-directed DNA synthesis, a substantial portion of the potentially degradable RNA template remained as large, partially digested fragments. A round of processive synthesis is the catalytic activity that occurs between the binding of an RT to the template-primer, and the first time it dissociates. We also observed that cleavage by AMV-RT was less frequent than that of MuLV- and HIV-RT. The position of intermittant cleavages could be determined by switching from a polymerization to RNase H mode triggered by stalling of the RT at specific sites on the template (20). Cleavage could also be intermittent even if the active sites are simultaneously functional. This type of mechanism is supported by experiments (21) in which the rate of addition of a single nucleotide to a DNA primer
3794 Nucleic Acids Research, 1994, Vol. 22, No. 18
hybridized to an RNA template was monitored. Results showed that variation of the nucleotide concentration in reactions greatly affected the rate of polymerization but had no effect on the rate of RNA cleavage. A third possibility is that the reactions would be mutually exclusive. In this case, the polymerases would finish a patch of synthesis and dissociate from the template-primer before returning to utilize their RNase H functions. Our previous observation of both polymerization and degradation during one round of processive synthesis, argues against this mechanism. In the current report we have measured the quantity and size of products made by HIV-and AMV-RT during a single round of processive synthesis on a primed RNA template. We found that, with HIV-RT, the majority of the potentially degradable template RNA was reduced to oligonucleotides shorter than 13 nucleotides, presumed to spontaneously dissociate from the DNA. In contrast, AMV-RT, although cleaving the template at least one time during a round of processive synthesis, generated very few small products. The results are discussed with respect to the mechanisms of viral replication for these two viruses.
MATERIALS AND METHODS Materials Recombinant HIV-RT, having native primary structure was graciously provided to us by Genetics Institute (Cambridge, MA). This enzyme had a specific activity of approximately 40,000 U/mg. One unit of RT activity is defined as the amount required to incorporate 1 nmole of dTTP into nucleic acid product in 10 min at 370C using poly(rA)-oligo(dT) as template-primer. Aliquots of HIV-RT were stored frozen at -70°C, and a fresh aliquot was used for each experiment. T4 polynucleotide kinase and T7 RNA polymerase were obtained from United States Biochemical Corp. AMV-RT, bovine pancreatic DNase (RNase free), placental RNase inhibitor, rNTPs, dNTPs, and E. coli ribonuclease H were obtained from Boehringer Mannheim Biochemicals. RNase H minus MuLV-RT (Superscript) was from Life Science Technologies (BRL). Oligonucleotides were synthesized by Genosys Inc. Restriction enzymes were from New England Biolabs. All other chemicals were from Sigma Chemical Co. Radiolabeled compounds were from New England Nuclear or Amersham. Methods Reverse transcriptase assays. RT at the concentrations indicated in the figure legends was preincubated with 5 nM template (internally labeled, see below)-primer 1 (see Figure 1) for 5 minutes in 10 ml of 50 mM Tris-HCl (pH 8.0), 80 mM KCl, 1 mM dithiothreitol and 0.1 mM EDTA (buffer A). Assays were initiated by addition of MgCl2, dNTPs, and trap in 2.5 ,L of buffer A to give a final concentration of 6 mM MgCl2 and 50 zM each of dATP, dTTP, dCTP, and dGTP. The trap was poly(rA)-oligo(dT16) (2 mg per reaction at 8:1 w:w). Its purpose is discussed in the Results. Reactions were stopped at the indicated times with an equal volume of 2 x gel loading buffer (80% formamide, 10 mM EDTA (pH = 8), 0.1 % each of xylene cyanole and bromphenol blue). The poly(rA)-oligo(dT) used in the reactions was prepared by mixing poly(rA) with oligo(dT16) at an 8:1 ratio (w:w) in 10 mM Tris-HCI (pH 7.5) and 1 mM EDTA. The mixture was incubated for 30 minutes at 37°C, and then slow cooled to room temperature. Reaction products were fractionated by electrophoresis on 8% or 20% polyacrylamide-7
M urea gels. To determine the amount of products less than 13 nucleotides in length, these products were located by autoradiography and excised. The level of radioactivity was determined by liquid scintillation. The size distribution of products less than 13 nucleotides long was determined by densitometry of the autoradiogram. Determinations were done at film exposure and densitometer response ranges that were approximately linear. Assay for determining the proportion of enzymes with both polymerase and RNase H activities. Conditions for the assays were similar to the reverse transcriptase assay with following changes: Template-primer 2 was used (see Figure 1); dGTP was omitted from the reactions, limiting primer-extension to 14 nucleotides; and incubations after initiation of the reactions were for 1 minute. In the reactions that determine the maximum amount of degradable template and extendible primer, E. coli RNase H (1 unit) or RNase H minus MuLV-RT (20 units), respectively, were used. Incubations after the initiation of the reactions were for 5 minutes in the absence of trap. Nucleotides were omitted from the reactions with E. coli RNase H. Reaction products were separated on an 8% polyacrylamide-7 M urea gel, and RNA degradation products or primer-extension products were quantitated as described above. The graphs showing relative RNase H or polymerase activity vs. the level of enzyme were constructed by calculating the ratio of cleaved template or extended primer at each enzyme level to the maximum amount determined in the reactions with E. coli RNase H and RNase H minus MuLV-RT, respectively.
RNA -DNA hybridization. Specific 20 nucleotide long deoxyoligonucleotides (primer 1 or primer 2, see Figure 1) were hybridized to the RNA template at the positions indicated in Figure 1. The RNA -DNA hybrid was prepared by mixing primer and template at a 5: 1 ratio of 3' termini in buffer A. The mixture was heated to 65°C for 10 minutes, and then slow cooled to room temperature.
Run-off transcription. Run-off transcription was done as described in the Promega Protocols and Applications Guide (©1989). Plasmid pBSM13 + (D), prepared as previously described (22), was cleaved at its two Pvul sites, which are 335 base pairs apart. Contained between these sites is the promotor for T7 RNA polymerase. Using this enzyme, a run-off RNA transcript 225 nucleotides in length was generated in the presence of 100 ,uM each of a-32P-labeled ATP, GTP, UTP, and CTP (approximately 2 Ci/mmol each). The DNA template was digested with bovine pancreatic RNase-free DNase I (1 unit/mg of DNA). The RNA transcript was then purified by electrophoresis on a 8% polyacrylamide gel containing 7 M urea. The full-length transcript was located by autoradiography, excised, and eluted from the gel by soaking in Nensorb (Dupont) reagent A (0.1 M Tris-HCI, pH 7.7, 1 mM EDTA, and 10 mM TEA). The RNA was then purified over a Nensorb column according to directions from the manufacturer. Quantitation of transcript and primers. The amount of RNA transcript was determined based on the specific activity of the RNA. DNA primers were quantitated by spectrophotometry. Determination ofprocessivity ofpolymerizaton. This parameter is defined in the Results. The average value for HIV-RTs in the
Nucleic Acids Research, 1994, Vol. 22, No. 18 3795 reaction was determined using the reverse transcriptase assay in the presence of trap. Assays were performed as described above under reverse transcriptase assays. Internally labeled RNA template and 5'-32p labeled primer (template-primer 1, see Figure 1) were used. After primer-extension by reverse transcriptase (5 minutes), the RNA template was digested to small products by a subsequent 10 minute incubation at 37°C following addition of 2 units of E. coli RNase H and 1 unit of DNase-free RNase. Primer-extension products were resolved by gel electrophoresis on an 8% polyacrylamide -7 M urea gel, and then autoradiography was performed. The autoradiograms were analyzed by densitometry. The product size was estimated by comparison to DNA standards. The proportion of total product of a given size was determined using the integration function of the LKB Ultroscan XL densitometer. For processivity determination, the primer length (20 nucleotides) was subtracted from the product length. The average value of primer extension length was calculated. Gel electrophoresis. Denaturing 20% or 8% polyacrylamide sequencing gels (19:1 acrylamide:bis-acrylamide), containing 7 M urea, were prepared and subjected to electrophoresis as described (23).
RESULTS HIV-RT degrades most of the potentially degradable RNA template to oligomers of less than 13 nucleotides in length We used the template-primer shown in Figure 1 (primer 1) to assess the coupling of DNA synthesis and RNA degradation by RT. The template consisted of a 225 nucleotide RNA which was derived from pBSM13 + (D) (22). This RNA was primed near the 3' end with a 20 nucleotide long DNA segment such that full-length extension of the primer resulted in a 212 nucleotide product (addition of 192 nucleotides to the primer). The template RNA was internally labeled with 32p, such that each nucleotide had the same specific activity (see Methods). Therefore, the amount of radioactivity in each RNA cleavage product was directly proportional to the length of the RNA. This eliminated difficulties in quantitating RNA cleavage that may have occurred if the RNA were labeled with a single radioactive rNTP that was not uniformly distributed along the template. All reactions were performed under conditions that limited the RT molecules to catalysis that could occur during a single binding event to a given template-primer. This was accomplished by prebinding the RT to the template-primer and initiating the reactions with Mg++ and dNTPs along with an excess of enzyme trap. The trap sequesters enzymes that have dissociated
1
25
from the template-primer preventing the enzymes from rebinding other templates. The trap used for these experiments was poly(rA)-oligo(dT) (19). We measured the processivity for DNA polymerization by HIV-RT. This value is the number of nucleotides added by an RT molecule during a single binding event with the template primer. RTs are bound to the template-primer and then synthesis is initiated in the presence of a polymer that can trap RTs as they dissociate. The length of primer extension is then indicative of the extent of processive synthesis. Shown in Figure 2 is an experiment using internally labeled RNA template and 5' end 1
2
238217201 1 90-
3
.h
160-
ft
1 47-
_**
1231
10s
..
110- :10k"1
70- .-
7667- 4fiW--
34-
50
GGGCGMUUAGCUUUUGUUCCCUUOAGUGAGGGUUMUUCCGAGCUUGGCGUMUCAUGGUCAUAGCUGUUU 75 primer 2 CCUGUGUGAAAUUGU 150
pUCCGCUCACAUUC&CAC
135
AUACGAGCCGGAGCAUAAGUGUAAAGCCUGGG
175 pnmer 1 GUGCCUMUGAGUGAGGUMCUCACAUUAAUUGCGUUGCGCUCACU FCCGCUUUCCAGUCGGGMUCUGU 225
CGUGCCAG-3
Figure 1. Template-primers used in experiments. The nucleotide sequence of the RNA template transcribed from pBSM13 +(D) is shown (see Methods). The template was primed with a specific 20 nucleotide long DNA oligomer at one of the two positions indicated by the boxes. The numbering above the sequence starts from the 5' terminal nucleotide of the transcript.
Figure 2. DNA synthesis on template-primer 1. An autoradiogram of an experiment to determine the processivity of HIV-RT on template-primer 1 is shown. The assay shown in lane 3 was performed as described under detemunanon of enzyme processivity using 4 units of HIV-RT and a poly(rA)-oligo(dT) trap. Lane 2 shows the starting material handled identically, but in the absence of enzymes. Note the presence of the 225 nucleotide internally labeled RNA template and 20 nucleotide 5' end-labelled DNA primer in this lane. Lane 1 shows DNA size markers of the indicated lengths in nucleotides.
*
