Double-Locus Sequence Typing Using porA ... - Mary Ann Liebert, Inc.

FOODBORNE PATHOGENS AND DISEASE Volume 11, Number 3, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/fpd.2013.1634

Double-Locus Sequence Typing Using porA and peb1A for Epidemiological Studies of Campylobacter jejuni Monir U. Ahmed,1 Louise Dunn,1 Mary Valcanis,2 Geoff Hogg,2 and Elena P. Ivanova1

Abstract

Campylobacter jejuni is the leading cause of foodborne bacterial gastroenteritis worldwide. Bacterial typing schemes play an important role in epidemiological investigations to trace the source and route of transmission of the infectious agent by identifying outbreak and differentiating among sporadic infections. In this study, a double-locus sequence typing (DLST) scheme for C. jejuni based on concatenated partial sequences of porA and peb1A genes is proposed. The DLST scheme was validated using 50 clinical and environmental C. jejuni strains isolated from human (C5, H, H15-H19), chicken (CH1-CH15), water (W2-W17), and ovine samples (OV1-OV6). The scheme was found to be highly discriminatory (discrimination index [DI] = 0.964) and epidemiologically concordant based on C. jejuni strains studied. The DLST showed discriminatory power above 0.95 and excellent congruence to multilocus sequence typing and can be recommended as a rapid and low-cost typing scheme for epidemiological investigation of C. jejuni. It is suggested that the DLST scheme is suitable for identification of outbreak strains and differentiation of the sporadic infection strains.

Introduction

B

acterial typing is central to diagnosis and epidemiological surveillance of bacterial infections (Li et al., 2009). Due to the advantages over phenotyping systems in terms of discriminatory power, reproducibility, and rapidity, a number of genotyping systems are currently in use for epidemiological surveillance of Campylobacter jejuni (Wassenaar and Newell, 2000b; Ahmed et al., 2012; Eberle and Kiess, 2012), the most common foodborne bacterial pathogen worldwide (Friedman et al., 2004; Senok and Botta, 2009). However, there is no typing system that would be useful for all forms of investigation in regard to cost, rapidity and reliability, and discrimination power (Foxman et al., 2005). Among genotyping methods, sequence-based typing methods are preferred for unambiguous data production and interlaboratory transferability (Li et al., 2009). Two commonly used sequencebased typing schemes for C. jejuni are flagellin (fla) gene sequence typing and multilocus sequence typing (MLST) (Wassenaar, 2011; Wassenaar and Newell, 2000a). Flagellin gene typing uses only one gene, flaA, flaB or short variable region (SVR) of flaA gene (Meinersmann et al., 1997, 2005; Mellmann et al., 2004). Another single-locus sequence-based typing schemes was described based on the porA or cmp gene (Huang et al., 2005). Recently this typing scheme was employed for outbreak study and was recommended as

1 2

complementary to MLST, pulsed-field gel electrophoresis (PFGE) and whole genome sequencing ( Jay-Russell et al., 2013). As single locus poorly represents the whole bacterial genome, such methods are considered least reliable for epidemiological studies (De Boer et al., 2000; Olive and Bean, 1999). On the other hand, presence of two copies of fla gene (flaA and flaB) and possible intragenomic and intergenomic recombination between the two copies undermines the reliability of typing Campylobacter spp. (Cornelius et al., 2010; Guerry et al., 1991; Harrington et al., 1997). MLST use seven housekeeping genes (Olive and Bean, 1999) and using more stable and less variable housekeeping genes in large number makes MLST costly, laborious and inadequately discriminatory for local epidemiological studies (Maiden et al., 1998; Dingle et al., 2001; Urwin and Maiden, 2003; Korczak et al., 2009). Thus, it is timely to develop an affordable and highly discriminatory double and/or trilocus sequence typing scheme for C. jejuni as, for example, recently proposed typing schemes for Enterococcus faecalis, Staphylococcus aureus, and Listeria monocytogenes, which were developed using a small number of highly variable markers such as virulence or surface protein coding genes (Zhang et al., 2004; Kuhn et al., 2007; Chowdhury et al., 2009). This article aimed to investigate the applicability of virulence and surface-associated genes of C. jejuni, cadF (Konkel et al., 1997; Moser et al., 1997; Krause-Gruszczynska et al.,

Faculty of Life and Social Sciences, Swinburne University of Technology, Victoria, Australia. Microbiology Diagnostic Unit, The University of Melbourne, Victoria, Australia.

194

DOUBLE-LOCUS SEQUENCE TYPING OF CAMPYLOBACTER JEJUNI 2007), and/or peb1A (Pei and Blaser, 1993; Del Rocio LeonKempis et al., 2006; Mu¨ller et al., 2007) in association with porA for double-locus sequence typing scheme. It was aimed to comparatively assess double-locus sequence typing (DLST) performance using C. jejuni strains isolated from different sources.

195

Chromosomal DNA extraction

Materials and Methods

For DNA extraction, cultures were removed from storage and allowed to thaw at room temperature. For each isolate, a Preston agar (Oxoid) plate was spread for discrete colonies and incubated at 37C for 48 h under microaerophilic conditions. Chromosomal DNA was extracted from a loopful of C. jejuni colonies using a Wizard genomic DNA purification kit (Promega, Madison, WI).

Bacterial strains

Amplification and sequencing of the selected genes

Forty-nine C. jejuni strains isolated from various sources obtained from the Collection of the Enteric Reference Section, Microbiological Diagnostic Unit Public Health Laboratory, The University of Melbourne, Australia and the type strain C. jejuni LMG 8841T ( = ATCC 33560T = CIP 70.2T) obtained from the Belgium Coordinated Collections of Microorganisms/ Laboratorium Microbiologie Ghent (BCCM/LMG) were included in this study. The species C. jejuni consists of two subspecies, C. jejuni subsp. jejuni and C. jejuni subsp. doylei (Veron and Chatelai, 1973; Steele and Owen, 1988). In this article, only C. jejuni subsp. jejuni will be considered and hereafter will be referred to as C. jejuni. Altogether, 50 C. jejuni strains were included in this study (see Supplementary Tables S1 and S2; Supplementary Data are available online at www.liebertpub.com/fpd): 32 C. jejuni epidemiologically unrelated strains isolated from human (C5, H, H15-H19), chicken (CH1-CH15), water (W2-W17), and ovine (OV1-OV6) (Supplementary Table S1); and 17 epidemiologically related strains that consisted of three groups, namely, 10 C. jejuni outbreak strains (OB1-OB102) from a school camp outbreak in 1993; four strains (C1-C4) from an aged care center isolated in 2011; and three C. jejuni strains (Ca1-Ca3) isolated from a canine in 2012 (Supplementary Table S2).

The selected genes (cadF, porA, and peb1A) were amplified using the primers described elsewhere (Konkel et al., 2005; Pei and Blaser, 1993; Dingle et al., 2008) with initial denaturation of 95C 15 min followed by 35 cycles of 94C for 30 s, 50C for 30 s, and 72C, 90 s, and a final extension of 72C 5 min. The PCR products were purified using Wizard SV Gel and PCR Clean-Up System (Promega) upon visualization in 1% agarose gel. Subsequently, the amplicons were sequenced at the Australian Genome Research Facility (AGRF, www.agrf .org.au), following their instructions using the primers designed in this study (Table 1). Fla-SVR was amplified and sequenced by using the primers described previously (Meinersmann et al., 1997).

Growth, cultivation, and storage conditions All bacterial strains were grown on Preston agar (Oxoid, Hampshire, UK) at 37C for 48 h in an anaerobic jar incorporating a CampyGen (Oxoid) gas generation kit to produce suitable microaerophilic conditions. All C. jejuni strains included in this study had been maintained with minimal passages at - 70C in 20% (vol/vol) glycerol in nutrient broth 2 (Oxoid).

Allele and sequence type (ST) assignments CLUSTALW from Genome Net bioinformatics tools (http:// www.genome.jp/tools/clustalw/) was used for Slow/Accu rate DNA alignment. Allelic sequences having at least a onenucleotide difference were assigned arbitrary numbers. For each strain, the combination of two alleles defined its allelic profile, and a unique allelic profile was designated as a doublelocus sequence type; in short, D type. To depict the phylogenetic relationship based on concatenated sequence of porA and peb1A, the maximum likelihood method was used to construct a dendrogram using MEGA 5.05 with 1000 bootstrap replications and Tamura-Nei model (Tamura et al., 2011). MLST MLST based on seven housekeeping genes was performed using the experimental conditions and primers developed and previously used for C. jejuni strains as described elsewhere (Dingle et al., 2001). Sequence types for MLST and allele type

Table 1. Primers Used for Amplification and Sequencing of cadF, peb1A, and porA Gene Primers cadF-F2B CadF-R1B cadF_SF cadF_SR Peb1A F2 Peb1AR2 Peb1A_SF Peb1A_SR MOMP-2 MOMP-3 PorA_SF PorA_SR FLA242FU FLA625RU

Sequences (5¢-3¢)

Target genes/size (bp)

Purpose

TTGAAGGTAATTTAGATATG CTAATACCTAAAGTTGAAAC AGCCAAAGAATCACTAAGACG GGATAATCGTTATGCACCAG GCAGAAGGTAAACTTGAGTCTATT TTATAAACCCCATTTTTTCGCTA ACGCATCAACTCTTTTAGCA CCGCATTATGCTTTACTTGA TGAGAAGTTAAGTTTGGAGAG GATGGTTTAGTWGGMACAGG AGGAAATCTTTACGGTGCTG CAGCTTCTGTTTTTGTTCCA CTATGGATGAGCAATTATAAAAT CAAGATCCTGTTCCATACTGAAG

cadF (400)

Amplification Amplification Sequencing Sequencing Amplification Amplification Sequencing Sequencing Amplification Amplification Sequencing Sequencing Amplification and sequencing

peb1A (702)

porA (673)

flaSVR (425)

References Konkel et al., 1997 This study Pei and Blaser, 1993 This study Dingle et al., 2008 This study (Meinersmann et al., 1997)

196 for fla-SVR were assigned in accordance with the database available at www.pubmlst.org/campylobacter/. DI and epidemiological concordance (E) DI values were calculated as previously described (higher DI values indicate higher discriminatory power) (Hunter and Gaston, 1988). Epidemiological concordance (the ability of the typing method to classify epidemiologically related strains derived from presumably single clone outbreaks into the same clones) was determined as described elsewhere (Struelens et al., 1996). Simpson’s index of diversity or discriminatory power was calculated using the online tool at http:// insilico.ehu.es/mini_tools/discriminatory_power/. The adjusted Rand and Wallace coefficient was calculated using online tool at http://darwin.phyloviz.net/ComparingParti tions/index.php?link = Tool.

AHMED ET AL. OV6), were studied in order to test the applicability of the selected genes. A subset of 20 strains was shown to be sufficient for the purposes of a pilot study as previously suggested (Urwin and Maiden, 2003). The number of allele types for cadF, porA, and peb1A was found to be 4, 10, and 6, respectively. The discriminatory index for cadF was 0.61, for porA was 0.88, and for peb1A was 0.76. The porA and peb1A pair was found to have satisfactory discriminatory power (0.9524) (van Belkum et al., 2007b) and therefore porA and peb1A loci were selected for further study. Typeability and stability of two selected markers For porA and peb1A, amplification products were obtained from the type strain and all C. jejuni strains included in this

Nucleotide sequences Nucleotide sequences were submitted to GenBank database with Accession no. from KC330872 to KC330891 for cadF, KC330892 to KC330941 for peb1A, and KC330942 to KC330991 for porA. Results and Discussion Selection of genotyping markers Initially, three genetic markers were considered including two virulence genes, cadF (Moser et al., 1997; Konkel et al., 1997; Krause-Gruszczynska et al., 2007) and peb1A (Moser et al., 1997; Olive and Bean, 1999; Leon-Kempis Mdel et al., 2006) and porA, surface-associated gene. In C. jejuni, the porA gene encodes the major outer membrane protein, which is antigenic (Dingle et al., 2008; Cody et al., 2009). Therefore, porA gene has been considered a valuable marker in the typing scheme (Cody et al., 2009). This gene was previously included as an additional component in the MLST study of C. jejuni strains for further differentiation among strains belonging to same types by MLST and was found useful in short-term epidemiological studies, such as outbreak investigation (Dingle et al., 2008). We, therefore, have included the porA gene in our study to evaluate its performance in combination with other surface-associated genes of C. jejuni. CadF is an outer membrane protein and is expressed in every C. jejuni strain, because this gene mediates binding of C. jejuni cells to host fibronectin (Konkel et al., 1997; Krause-Gruszczynska et al., 2007). Since binding to the host cells is an essential step in C. jejuni host cells colonization, CadF protein plays a vital role in C. jejuni pathogenicity and considered a virulence factor for C. jejuni (Moser et al., 1997). For this reason, cadF gene was selected as a surface-associated virulence marker candidate for C. jejuni typing. Peb1A of C. jejuni is an antigenic surface associated protein that plays a role in adherence and host colonization and thus in pathogenesis (Pei and Blaser, 1993; Leon-Kempis Mdel et al., 2006; Mu¨ller et al., 2007). This virulence gene was also included in this study to find a suitable double-locus genotyping scheme. Selection of two loci for double-locus sequence typing of C. jejuni Initially, a subset of 20 representative isolates from four sources, namely, human (strains C1-C5), chicken (strains CH1-CH9), water (strains W2-W12) and ovine (strains OV1-

FIG. 1. Epidemiological relationships of Campylobacter jejuni strains based on the concatenated sequences of porA and peb1A genes. The cladogram was constructed using MEGA 5.05.

DOUBLE-LOCUS SEQUENCE TYPING OF CAMPYLOBACTER JEJUNI

197

Table 2. Allelic Profile and Sequence Type of Campylobacter jejuni Isolates Included in the Comparison of Multilocus Sequence Typing (MLST) and Double-Locus Sequence Typing Isolate

STM (MLST profile)a

Source; year of isolation

Type/reference strain LMG 8841T C1-C4 Human (aged care cluster); 2011 C5 Human (sporadic); 2011 CH1 Chicken; 2002 CH5 Chicken; 2005 CH6 Chicken; 2005 CH9 Chicken; 2008 CJ81116 Reference strain; 2011 OB1, 9, 14, 24, 41 Human (outbreak); 1993 W2 Water; 2005 W6 Water; 2007 W9 Water; 2008 W11 Water; 2008 DI (outbreak strains not included)

403 567 2343 583 45 320 45 267 48 190 800 327 4272

STD (Alleles of porA, peb1A)

(10, 27, 16, 19, 10, 5, 7) (1, 3, 6, 4, 3, 3, 1) (2, 4, 5, 2, 10, 1, 5, 2) (4, 7, 10, 442, 51, 354) (4, 7, 10, 4, 1, 7, 1) (9, 7, 10, 4, 1, 7, 1) (4, 7, 10, 4, 1, 7, 1) (4, 7, 40, 4, 42, 51, 1) (2, 4, 1, 2, 7, 1, 5) (2, 1, 5, 3, 43, 3, 5) (64, 2, 22, 460, 43, 97, 79) (18, 2, 78, 35, 1, 86, 16) (4, 7, 10, 4, 5, 7) 0.9333

1 (1, 1) 2 (2, 2) 3 (3, 3) 5 (4, 4) 7 (3, 4) 8 (6, 4) 7 (3, 4) 12 (18, 87) 16 (3, 6) 20 (3, 2) 21 (10, 3) 22 (12, 3) 24 (5, 5) 0.9333

a Allelic profile and STM was determined by interrogating the MLST database at http://pubmlst.org/perl/bigsdb/bigsdb.pl?db = pubmlst_campylobacter_seqdef&page = profiles&scheme_id = 1 DI, discrimination index.

study, which were isolated from five different sources (human, chicken, water, ovine, and canine) and over a period of 18 years (1993–2012) (Supplementary Tables S1 and S2). Each of the 50 strains was assigned to a type based on the allelic profile of porA and peb1A gene sequences. Genotyping markers are considered stable if multiple epidemic strains are identified as indistinguishable by these markers (van Belkum et al., 2007a). Using the porA and peb1A markers individually and in combination, it was possible to identify all 10 outbreak strains from the 1993 outbreak as genetically indistinguishable. Thus, the chosen markers could be considered universal and stable enough to be used for genotyping of C. jejuni. Assessment of DLST performance To evaluate the appropriateness of DLST, two performance criteria (i.e., discriminatory index and epidemiological concordance, which depend on the markers used), were determined. Upon selection of porA and peb1A genes for the double-locus sequence typing scheme, discriminatory power of the scheme was calculated for 33 epidemiologically unrelated strains (Supplementary Table S1). Thirty-three unrelated strains were differentiated into 25 types by the double-locus scheme and the discriminatory index was found to be 0.9624 (Supplementary Table S1). The double-locus sequence typing scheme showed good epidemiological concordance (ability of typing method to group bacterial strains compatible with available epidemiological information) (Struelens, 1996), by revealing the relatedness of outbreak strains and other epidemiologically related strains (Fig. 1 and Supplementary Table S2). For example, all 10 outbreak strains (OB1-OB102, type 16, Supplementary Table S2) were assigned to the same type. It was also possible to distinguish three strains (Ca1-Ca3) isolated from the same canine as belonging to the same type. Further analysis of the DLST grouping indicated that four strains isolated from the patients of the aged care facility (C1-C4) were indistinguishable (Fig. 1 and Supplementary Table S2). The analysis of DLST clustering of three epidemiologically related groups of C. jejuni strains confirmed that the double-locus sequence typing scheme is suitable for

detection of outbreak strains and/or establishing epidemiological relatedness. Comparison of DLST and MLST The DLST scheme showed excellent congruence to MLST. DLST was compared to MLST using a group of 20 C. jejuni strains, which included 10 human, 4 chicken, and 4 water isolates along with CJ8116 (Table 2) (Taboada et al., 2012) and C. jejuni LMG 8841T. Twenty C. jejuni strains were differentiated into 12 sequence types by both DLST and MLST (Table 2). Both typing schemes were able to identify the same nine strains as singletons (a single isolate representing one sequence type). The singletons were LMG 8841T, C5, CH1, CH6, CJ81116, and all four strains from water (W2-W11). To compare the congruence between type assignments by MLST and DLST, the adjusted Rand and Wallace coefficients were calculated (Wallace, 1983; Pinto et al., 2008). The Wallace coefficient showed that the probability score for a pair of strains classified as the same type by both MLST and DLST typing scheme was 100% (based on the Wallace coefficient 1). The adjusted Rand index (compare the clustering/grouping of isolates sharing similar characteristics according to given methods) for MLST and DLST in this study was 1.000, which means that epidemiological congruence between the two methods was found be excellent; however, an additional comparative study with a large number of strains may be required to reconfirm the congruence. Comparison of DLST and fla-SVR typing DLST and fla-SVR typing were compared using 24 strains including outbreak strains. DLST differentiated 24 strains into 13 types, whereas flaSVR was able to distinguish 10 types (Supplementary Table S3). The DLST scheme identified eight singletons (LMG 8841T, C5, CH6, CJ81116, H15, H18, OV1, OV5, and OV6), while only four singletons (LMG 8841T, C1, CH5, CH9, and H17) have been identified using flaSVR typing (singletons are in bold, Supplementary Table S3). The adjusted Wallace coefficient of DLST to fla-SVR and 95% confidence interval was found to be 0.908 (0.856–0.961) and fla-SVR

198 to DLST was 0.788 (0.717–0.860). These data demonstrate that DLST appeared to be highly discriminatory compared to flaSVR typing. However, further study with a large number of strains may be needed for detailed comparative assessment of the two schemes. Conclusions Using both epidemiologically unrelated and related strains, it is shown that the double-locus sequence typing scheme based on porA and peb1A genes has sufficient discriminatory power (0.964) and capability to identify the same type among related strains and to differentiate unrelated/sporadic strains. It was found that DLST typing was equally discriminatory to MLST and more discriminatory to fla-SVR typing and can be suitable for genotyping of C. jejuni as a rapid and low-cost typing scheme for epidemiological investigations. The DLST scheme should be further compared to other typing schemes using an adequate number of C. jejuni strains in order to be recommended for practical application. Acknowledgments The authors thank Alex Kuzevski and Elise Aplin for technical assistance. This study was supported in part by the Department of Health, Victoria, Australia. Disclosure Statement No competing financial interests exist. References Ahmed MU, Dunn L, Ivanova EP. Evaluation of current molecular approaches for genotyping of Campylobacter jejuni strains. Foodborne Pathog Dis 2012;9:375–385. Chowdhury SA, Arias CA, Nallapareddy SR, Reyes J, Willems RJ, Murray BE. A trilocus sequence typing scheme for hospital epidemiology and subspecies differentiation of an important nosocomial pathogen, Enterococcus faecalis. J Clin Microbiol 2009;47:2713–2719. Cody AJ, Maiden MJC, Dingle KE. Genetic diversity and stability of the porA allele as a genetic marker in human Campylobacter infection. Microbiology 2009;155:4145–4154. Cornelius AJ, Gilpin B, Carter P, Nicol C, On SL. Comparison of PCR binary typing (P-BIT), a new approach to epidemiological subtyping of Campylobacter jejuni, with serotyping, pulsed-field gel electrophoresis, and multilocus sequence typing methods. Appl Environ Microbiol 2010;76:1533– 1544. De Boer P, Duim B, Rigter A, Van Der Plas J, Jacobs-Reitsma WF, Wagenaar JA. Computer-assisted analysis and epidemiological value of genotyping methods for Campylobacter jejuni and Campylobacter coli. J Clin Microbiol 2000;38:1940–1946. Del Rocio Leon-Kempis M, Guccione E, Mulholland F, Williamson MP, Kelly DJ. The Campylobacter jejuni PEB1a adhesin is an aspartate/glutamate-binding protein of an ABC transporter essential for microaerobic growth on dicarboxylic amino acids. Mol Microbiol 2006;60:1262–1275. Dingle KE, Colles FM, Wareing DR, et al. Multilocus sequence typing system for Campylobacter jejuni. J Clin Microbiol 2001;39:14–23. Dingle KE, McCarthy ND, Cody AJ, Peto TE, Maiden MC. Extended sequence typing of Campylobacter spp., United Kingdom. Emerg Infect Dis 2008;14:1620–1622.

AHMED ET AL. Eberle KN, Kiess AS. Phenotypic and genotypic methods for typing Campylobacter jejuni and Campylobacter coli in poultry. Poult Sci 2012;91:255–264. Foxman B, Zhang L, Koopman JS, Manning SD, Marrs CF. Choosing an appropriate bacterial typing technique for epidemiologic studies. Epidemiol Perspect Innov 2005;2:10. Friedman CR, Hoekstra RM, Samuel M, et al. Risk factors for sporadic Campylobacter infection in the United States: A casecontrol study in FoodNet sites. Clin Infect Dis 2004;38(Suppl 3):S285–S296. Guerry P, Alm RA, Power ME, Logan SM, Trust TJ. Role of two flagellin genes in Campylobacter motility. J Bacteriol 1991;173: 4757–4764. Harrington CS, Thomson-Carter FM, Carter PE. Evidence for recombination in the flagellin locus of Campylobacter jejuni: Implications for the flagellin gene typing scheme. J Clin Microbiol 1997;35:2386–2392. Huang S, Luangtongkum T, Morishita TY, Zhang Q. Molecular typing of Campylobacter strains using the cmp gene encoding the major outer membrane protein. Foodborne Pathog Dis 2005;2:12–23. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: An application of Simpson’s index of diversity. J Clin Microbiol 1988;26:2465–2466. Jay-Russell MT, Mandrell RE, Yuan J, et al. Using major outer membrane protein typing as an epidemiological tool to investigate outbreaks caused by milk-borne Campylobacter jejuni isolates in California. J Clin Microbiol 2013;51:195–201. Konkel ME, Christensen JE, Keech AM, Monteville MR, Klena JD, Garvis SG. Identification of a fibronectin-binding domain within the Campylobacter jejuni CadF protein. Mol Microbiol 2005;57:1022–1035. Konkel ME, Garvis SG, Tipton SL, Anderson DE Jr, Cieplak W Jr. Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacter jejuni. Mol Microbiol 1997;24:953–963. Korczak BM, Zurfluh M, Emler S, Kuhn-Oertli J, Kuhnert P. Multiplex strategy for multilocus sequence typing, fla typing, and genetic determination of antimicrobial resistance of Campylobacter jejuni and Campylobacter coli isolates collected in Switzerland. J Clin Microbiol 2009;47:1996–2007. Krause-Gruszczynska M, Van Alphen LB, Oyarzabal OA, et al. Expression patterns and role of the CadF protein in Campylobacter jejuni and Campylobacter coli. FEMS Microbiol Lett 2007;274:9–16. Kuhn G, Francioli P, Blanc DS. Double-locus sequence typing using clfB and spa, a fast and simple method for epidemiological typing of methicillin-resistant Staphylococcus aureus. J Clin Microbiol 2007;45:54–62. Li W, Raoult D, Fournier PE. Bacterial strain typing in the genomic era. FEMS Microbiol Rev 2009;33:892–916. Maiden MC, Bygraves JA, Feil E, et al. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci U S A 1998;95:3140–145. Meinersmann R, Helsel L, Fields P, Hiett K. Discrimination of Campylobacter jejuni isolates by fla gene sequencing. J Clin Microbiol 1997;35:2810–2814. Meinersmann RJ, Phillips RW, Hiett KL, Fedorka-Cray P. Differentiation of Campylobacter populations as demonstrated by flagellin short variable region sequences. Appl Environ Microbiol 2005;71:6368–6374. Mellmann A, Mosters J, Bartelt E, et al. Sequence-based typing of flaB is a more stable screening tool than typing of flaA for

DOUBLE-LOCUS SEQUENCE TYPING OF CAMPYLOBACTER JEJUNI monitoring of Campylobacter populations. J Clin Microbiol 2004;42:4840–4842. Moser I, Schroeder W, Salnikow J. Campylobacter jejuni major outer membrane protein and a 59-kDa protein are involved in binding to fibronectin and INT 407 cell membranes. FEMS Microbiol Lett 1997;157:233–238. Mu¨ller A, Leo´n-Kempis MdR, Dodson E, Wilson KS, Wilkinson AJ, Kelly DJ. A bacterial virulence factor with a dual role as an adhesin and a solute-binding protein: The crystal structure at 1.5 a˚ resolution of the peb1a protein from the food-borne human pathogen Campylobacter jejuni. J Mol Biol 2007;372:160–171. Olive DM, Bean P. Principles and applications of methods for DNA-based typing of microbial organisms. J Clin Microbiol 1999;37:1661–1669. Pei Z, Blaser MJ. PEB1, the major cell-binding factor of Campylobacter jejuni, is a homolog of the binding component in gramnegative nutrient transport systems. J Biolog Chem 1993;268: 18717–18725. Pinto FR, Melo-Cristino J, Ramirez M. A confidence interval for the Wallace coefficient of concordance and its application to microbial typing methods. PLoS ONE 2008;3:e3696. Senok AC, Botta GA. Campylobacter enteritis in the Arabian Gulf. J Infect Dev Ctries 2009;3:74–82. Steele TW, Owen RJ. Campylobacter jejuni Subsp Doylei Subsp Nov, a subspecies of nitrate-negative campylobacters isolated from human clinical specimens. Int J Syst Bacteriol 1988;38: 316–318. Struelens MJ. Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems. Clin Microbiol Infect 1996;2:2–11. Struelens MJ, Bauernfeind A, Van Belkum A, et al. Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems. Clin Microbiol Infect 1996;2:2–11. Taboada EN, Ross SL, Mutschall SK, et al. Development and validation of a comparative genomic fingerprinting method

199

for high-resolution genotyping of Campylobacter jejuni. J Clin Microbiol 2012;50:788–797. Urwin R, Maiden MC. Multi-locus sequence typing: A tool for global epidemiology. Trends Microbiol 2003;11:479–487. van Belkum A, Tassios PT, Dijkshoorn L, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect 2007a;13:1–46. van Belkum A, Tassios PT, Dijkshoorn L, et al. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin Microbiol Infect 2007b;13:1–46. Veron M, Chatelai R. Taxonomic study of genus Campylobacter Sebald and Veron and designation of neotype strain for type species, Campylobacter-Fetus (Smith and Taylor) Sebald and Veron. Int J Syst Bacteriol 1973;23:122–134. Wallace DL. A method for comparing 2 hierarchical clusterings: Comment. J Am Stat Assoc 1983;78:569–576. Wassenaar TM. Following an imaginary Campylobacter population from farm to fork and beyond: A bacterial perspective. Lett Appl Microbiol 2011;53:253–263. Wassenaar TM, Newell DG. Genotyping of Campylobacter spp. Appl Environ Microbiol 2000a;66:1–9. Wassenaar TM, Newell DG. Genotyping of Campylobacter spp. Appl Environ Microbiol 2000b;66:1–9. Zhang W, Jayarao BM, Knabel SJ. Multi-virulence-locus sequence typing of Listeria monocytogenes. Appl Environ Microbiol 2004;70:913–920.

Address correspondence to: Elena P. Ivanova, PhD, ScD, JD Faculty of Life and Social Sciences Swinburne University of Technology P.O. Box 218 Hawthorn, Victoria 3122, Australia E-mail: [email protected]