Letters to the Editor
867 References 1 Pearson TC. Evaluation of diagnostic criteria in polycythemia vera. Semin Hematol 2001; 1 (Suppl 2): 21–24. 2 Westerman D, Juneja S. Reply to authors: ‘re: essential thrombocythemia in young individuals: frequency and risk factors for vascular
events and evolution to myelofibrosis in 126 patients. Alvarez-Larra´n A et al. Leukemia 2007; 21: 1218–1223’, Leukemia 2007. 3 Alvarez-Larra´n A, Cervantes F, Bellosillo B, Giralt M, Julia´ A, Herna´ndez-Boluda JC et al. Essential thrombocythemia in young individuals: frequency and risk factors for vascular events and evolution to myelofibrosis in 126 patients. Leukemia 2007; 21: 1218–1223.
Erythroid variant of chronic myelogenous leukemia
Leukemia (2008) 22, 867–870; doi:10.1038/sj.leu.2404965; published online 22 November 2007
Chronic myelogenous leukemia (CML) is a chronic myeloproliferative disorder that is characterized by leukocytosis, thrombocytosis and anemia with myeloid hyperplasia in the bone marrow.1 It affects 4500 people in the United States each year. Leukocytosis is invariably present with varying numbers of immature myeloid cells in the blood. Usually o5% circulating blasts are noted. Generally, there is a sustained and progressive rise in the white count; however, in a few instances there may be a periodic oscillation in peripheral blood leukocytes with or without antileukemic therapy.2 The platelet count is typically high or normal, but on occasion severe thrombocytopenia may be seen.3 Most patients are anemic and on occasion require red blood cell transfusion. The gold standard for diagnosis of CML is detection of the Philadelphia chromosome (t(9;22) (q34.1;q11.21)) and/or the Bcr–Abl1 hybrid gene. We report a case of a 43-year-old male with a clinical picture resembling a myelodysplastic syndrome who presented with severe thrombocytopenia, mild anemia, normal WBC, splenomegaly and only erythroid hyperplasia in the bone marrow. Surprisingly, he was found to have t(9;22) on cytogenetic analysis. This patient was treated with imatinib mesylate and responded well. All blood counts returned to normal with disappearance of the cytogenetic abnormality. This response has persisted for more than 6 years. To the best of our knowledge, this presentation and response has not been described previously. A 43-year-old man with no significant past medical history, presented on July 13, 2001 with a 10-day history of fatigue and easy bruising. He also described a recent weight loss of 10–15 lb. He denied fever, chills, night sweats or recurrent infections. He denied occupational exposure to toxic fumes or solvents. His family history was significant for lung cancer in his father and breast cancer in his mother. On physical examination, he appeared healthy but anxious. He was mildly icteric. There was no peripheral lymphadenopathy. Abdominal examination revealed 4 cm splenomegaly with no tenderness. Skin examination revealed mild ecchymoses. Rectal exam was unremarkable and stools were negative by Hemoccult testing. On presentation his white blood cell count was 5.6 109 l1 with 38% segs, 19% bands, 3% lymphocytes, 5% monocytes, 3% metamyelocytes, 3% myelocytes, 1% blasts and 36% nucleated red cells. Hemoglobin was 10.3 g dl1 with a striking mean corpuscular volume of 118 and platelets were 16 109 l1. Lactate dehydrogenase was normal at 179. Coombs testing was negative. A liver panel was normal except for a bilirubin of 1.6, which was mostly indirect. Renal function was normal. Human immunodeficiency virus 1 and 2 were negative. An serum protein electrophoresis (SPEP) was normal. Urine protein electrophoresis was negative. Antinuclear
antibodies (ANA) as well as testing for cytomegalovirus, toxoplasmosis and viral hepatitis were negative. On review of his peripheral smear, there was marked macrocytosis with anisocytosis and polychromatophilia. There was an occasional spherocyte and 36% nucleated red cells, some of which were dysplastic. He had rare basophils, myeloblasts and myelocytes. Platelets were markedly reduced but without abnormal forms. A bone marrow aspirate was hypercellular (95%) with reduced megakaryocytes. There was marked erythroid hyperplasia with mild dysplasia but without significant immaturity in the erythroid precursors. The myeloid/ erythroid (M/E) ratio was 0.2:1. Erythroid precursors constituted 85% of cells. There was impaired maturation in the myeloid series but only 1.5% myeloblasts. An iron stain showed 7% of erythroid precursors to be ringed sideroblasts.
Figure 1 diagnosis.
Bone marrow aspirate and biopsy at the time of
Leukemia
Letters to the Editor
868 9 WBC 8 7
K/uL
6 5 4 3 2 1
Ju l-0 1 Au g01 Ja n02 Ju l-0 2 No v02 Ja n03 Ap r-0 3 Ju l-0 3 De c03 Ju n04 De c04 Ju n05 De c05 M ay -0 No 6 v06 M ay -0 7
0
Figure 2
White blood cells over the last 6 years.
300 Platelets 250
K/uL
200
150
100
50
0 7 6 1 2 6 3 5 4 5 4 3 2 3 3 2 1 l-0 ug-0 n-0 ul-0 ov-0 n-0 pr-0 ul-0 ec-0 n-0 ec-0 n-0 ec-0 ay-0 ov-0 ay-0 a a u u J J A J J J J D D D N N A M M
Ju Figure 3
Platelets over the last 6 years.
On the basis of peripheral blood and marrow findings, the patient was believed to have a myelodysplastic syndrome. Subsequently, the platelet count fell to 12k and he received one dose of intravenous Solumedrol and platelet transfusions. He was urgently referred to the Western Pennsylvania Cancer Institute (WPCI) for consideration of stem cell transplantation. In the interim, the patient received platelet transfusions on three occasions but did not require any RBC transfusions. When seen in Pittsburgh on July 23 (10 days after the initial presentation), the WBC was 6.9 109 l, hemoglobin was 11.2 with a mean corpuscular volume of 118 and platelet count was 34k (1 day posttransfusion). A review of these data and marrow aspirate and biopsy was consistent with a myelodysplastic syndrome. Surprisingly, a fluorescent in situ hybridization analysis for Bcr–Ab1 fusion gene was positive in 94% of cells. Subsequent cytogenetic analysis of the peripheral blood on July 23 was positive for t(9;22) in 50% of the cells and reverse transcriptionLeukemia
PCR was positive for the P210 Bcr–Abl protein. Thus, the patient appeared to have a myelodysplastic picture clinically, yet had a cytogenetic finding indicative of CML. It was decided to initiate a trial of imatinib mesylate, although there was no known precedent for this approach in a patient whose disease manifestation was severe thrombocytopenia, without leukocytosis. The patient was started on imatinib mesylate 400 mg once daily on August 3 (20 days after the initial presentation). Imatinib was increased to 600 mg a day within a period of 4 weeks. Six weeks after starting imatinib mesylate, the WBC was 1.7 109 l1, hemoglobin was 9.9 g dl1 and platelet count was 8 109 l1. He continued to require platelet transfusions for 2 months. At that point, it was uncertain if the decline in counts was secondary to imatinib or disease progression. After 2 months of treatment, a few nucleated red cells and myeloid precursors were present in the peripheral blood; however,
Letters to the Editor
869 16 Hemoglobin 15 14
G/dL
13 12 11 10 9 8 7 6 1 6 2 5 4 3 5 4 3 2 3 3 2 1 l-0 ug-0 an-0 ul-0 ov-0 an-0 pr-0 ul-0 ec-0 n-0 ec-0 n-0 ec-0 ay-0 ov-0 ay-0 J J A J J Ju D Ju D D N N A M M
Ju Figure 4
Hemoglobin over the last 6 years.
fluorescent in situ hybridization testing remained 80% positive for the t(9;22) translocation. After 5 months, there was a near complete hematological response with a WBC of 3.2 109 l1, hemoglobin of 13 g dl1 and platelet count of 158 109 l1. Fluorescent in situ hybridization testing revealed complete cytogenetic remission. After 6 months of therapy, a peripheral smear showed normocytic, normochromic RBCs without significant poikilocytosis or polychromasia. There were no nucleated RBCs and WBC morphology and maturation were normal. Platelet number and morphology were also normal. At that time, a repeat bone marrow biopsy showed improved cellularity of 70%. There was mild megakaryocytic hyperplasia with normal morphology. All three cell lines were well represented. The M/E ratio was 1.9:1. Erythroid precursors constituted approximately 29% of cells. Iron stores were slightly increased with few siderocytes and occasional ringed sideroblasts (less than 5% of all nucleated RBCs). Fluorescent in situ hybridization analysis remained negative. After achieving complete remission, the dose of imatinib was reduced to 400 mg daily. Six years after starting treatment with imatinib, the patient remains in molecular remission by reverse transcription-PCR testing of the peripheral blood. The counts at this time are a WBC of 7.00 109 l1, hemoglobin of 14.2 g dl1 and platelet count of 226k. The chronic phase of CML is characterized by a marked increment in the pool of committed myeloid progenitors, leading to peripheral blood leukocytosis and often thrombocytosis with a prominent left shift in the differential count. Typical findings include anemia, WBC above 100 109 l1 and platelet count above 600 109.4,5 Our patient, however, presented with a striking macrocytic anemia, a normal leukocyte count with mild left shift and marked thrombocytopenia with easy bruising. There were also numerous nucleated RBCs, which is uncommon for CML. Moreover, there was no basophilia, eosinophilia or monocytosis. The typical bone marrow appearance in CML reveals hypercellularity (75–100%) with marked myeloid and megakaryocytic hyperplasia. An increased M/E ratio of 10–30:1 is noted in almost all patients. Our case, in contrast, showed hypercellularity with marked erythroid hyperplasia and a M/E ratio of 0.2:1. Usually, there is marked shift toward myeloid
Figure 5 Bone marrow aspirate and biopsy 6 months after starting treatment with imatinib.
immaturity with the marrow blast percentage being generally normal or slightly elevated, whereas in our case, we found 1.5% blasts and 85% erythroid precursors. A unique feature of CML has been the occasional marked cyclic oscillation in the leukocyte count without antileukemic therapy, especially during the early or evolutionary stages of CML.2 It is possible that our patient had oscillation in his WBC at the time of presentation that may have led to confusion in the diagnosis. However, this seems unlikely as the Leukemia
Letters to the Editor
870 marrow does not develop myeloid hypoplasia, during a nadir in the WBC as noted in the previously reported cases with cyclic oscillation.2 As noted, the severe thrombocytopenia and macrocytic anemia are unusual in the chronic phase of CML. Moreover, the marrow findings of intense erythroid hyperplasia and a reduction of myeloid cells in the marrow are atypical for a diagnosis of CML. However, given the presence of the Philadelphia chromosome and typical picture Bcr–abl translocation with a striking response to imatinib mesylate, this case represents what we have termed an ‘erythroid variant’ of CML. To our knowledge, this appears to be the first case that has been observed and has responded to imatinib mesylate. The patient remains in complete hematologic and molecular remission for more than 6 years on continued treatment with imatinib (Figures 1–5).
N Talreja1, H Abdulhaq1, RK Shadduck1, J Rossetti1, A Jalil1, A Makary2 and J Lister1 1 Division of Hematology–Oncology, Department of Medicine, Western Pennsylvania Cancer Institute, Pittsburgh, PA, USA and
2
Department of Hematology–Oncology, Geisinger Medical Center, Danville, PA, USA E-mail:
[email protected]
References 1 Charles L, Sawyers MD. Chronic myeloid leukemia. N Engl J Med 1999; 340: 1330–1340. 2 Shadduck RK, Winkelstein A, Nunna NG. Cyclic leukemic cell production in CML. Cancer 1972; 29: 399–401. 3 Quintas-Cardama A, Cortes JE. Chronic myeloid leukemia: diagnosis and treatment [symposium on oncology practice: hematological malignancies], Mayo Clinical Proceedings, July 2006 81, pp 973–988. 4 Faderl S, Talpaz M, Estrov Z, O’Brien S, Kurzrock R, Kantarjian HM. The biology of chronic myeloid leukemia. N Engl J Med 1999; 341: 164–172. 5 Savage DG, Szydlo RM, Goldman JM. Clinical features at diagnosis in 430 patients with chronic myeloid leukaemia seen at a referral centre over a 16-year period. Br J Haematol 1997; 96: 111–116.
Two novel JAK2 exon 12 mutations in JAK2V617F-negative polycythaemia vera patients
Leukemia (2008) 22, 870–873; doi:10.1038/sj.leu.2404971; published online 4 October 2007
The Philadelphia chromosome-negative myeloproliferative diseases (MPD) are a group of late-onset, chronic haematopoietic disorders characterized by the clonal proliferation of stem and progenitor cells resulting in an increased output of mature cells of one or more blood cell lineages. A specific acquired mutation in the key haematopoietic kinase, Janus kinase-2 (JAK2), JAK2V617F, occurs within the regulatory pseudokinase JAK homology-2 (JH2) domain of the JAK2 molecule and is proposed to result in release of autoinhibition of the JAK homology-1 (JH1) kinase domain. This lesion, which occurs in exon 14 of JAK2, is associated with 495% of polycythaemia vera (PV) cases and approximately 50% of patients diagnosed with essential thrombocythaemia (ET) and idiopathic myelofibrosis (IMF), (reviewed by Kaushansky 2007).1 The JAK2V617F mutation arises in the stem cell compartment consistent with the clonal proliferation of a multipotent progenitor that maintains longterm clonal haematopoiesis.2 Further, the identification of a mutation in a kinase that is associated with multiple cytokine receptors (CR) is consistent with altered growth factor responses observed in PV. For example, the growth of erythropoietin (Epo)-independent ‘endogenous’ erythroid colonies (eBFUE) from bone marrow (BM) and peripheral blood (PB) samples in vitro is a key feature of PV and ET and can be utilized as a diagnostic tool. Further somatic mutations have been reported in JAK2V617Fnegative MPD patients, including a transmembrane mutation in Mpl (Thrombopoietin receptor) in a small proportion of IMF and ET patients,3 and more recently, a cluster of four different mutations in exon 12 of JAK2 has been described in JAK2V617Fnegative PV and idiopathic erythrocytosis patients.4,5 This group of mutations, affecting amino-acid residues F537–E543, lies in a highly conserved region proximal to the JH2 domain of JAK2 and results in altered growth factor responses in vitro and a myeloproliferative phenotype in a murine bone marrow transplant model.4 Leukemia
Through a network of clinical haematologists in South Australia, we have obtained written informed consent (Royal Adelaide Hospital Research Ethics Approval #991104a), PB and/ or BM samples, and clinical information from a cohort of 62 patients, all of whom presented with unexplained erythrocytosis. We have screened peripheral blood mononuclear cell (PBMNC) or bone marrow mononuclear cell (BMMNC) samples from the majority of patients for the presence of eBFUE, and from all patients for the presence of the JAK2V617F mutation. We initially used PCR amplification and sequencing of JAK2 exon 14 in individually isolated eBFUE as described.6 Subsequently, we screened for the mutation in PBMNC, BMMNC and/ or eBFUE patient samples using a sensitive allele-specific PCR technique (AS-PCR)6 or the single-nucleotide primer-extension genotyping assay system, iPLEXt (Sequenom, San Diego, CA, USA). Using these approaches, we have shown in all 62 patients with erythrocytosis either the presence of eBFUE (n ¼ 40) or the JAK2V617F mutation (n ¼ 59) or both, in agreement with the recently proposed World Health Organization revised criteria for the diagnosis of PV.7 We detected the JAK2V617F allele in 59 out of 62 patients (95.16%), consistent with reported frequencies of JAK2V617F in PV, where sensitive detection methods have been employed.6 Three female patients (PV31, PV63 and PV64) were positive for eBFUE formation from PBMNC or BMMNC samples, confirming PV diagnosis. However, all three patients were negative for the JAK2V617F mutation measured using direct PCR amplification and sequencing of JAK2 exon 14 from individual eBFUE (PV31 n ¼ 7; PV63 n ¼ 1), and PBMNC (PV31 and PV63) or BMMNC (PV64) samples (determined by JAK2V617F AS-PCR or iPLEX assay, data not shown). Further to the report of four somatic inframe deletions or tandem point mutations in exon 12 of JAK2 in patients with JAK2V617F-negative PV or idiopathic erythrocytosis,4 we screened genomic DNA from individual eBFUE isolated from patients PV31, PV63 and PV64, and control samples, for mutations in this exon using a PCR-based sequencing approach (forward primer: CTCCTCTTTGGAG CAATTCA; reverse primer: TATCGCAACTCCCTTGTTCTC;
