Establishment of a Practical Workflow Using a Next ...

Original Articles Juntendo Medical Journal 2014. 60 (6), 568-575

Establishment of a Practical Workflow Using a Next Generation Sequencer to Search for Novel SNPs Associated with the Anti-HCV Treatment Response TSUTOMU TAKEDA＊1) 2), MASAYA SUGIYAMA＊1), TATSUYA KANTO＊1), MASAAKI KORENAGA＊1), MASASHI MIZOKAMI＊1), SUMIO WATANABE＊2) ＊1) Department

of Hepatic Diseases, The Research Center for Hepatitis & Immunology, National Center for Global Health

and Medicine, Chiba, Japan,

＊2)Department

of Gastroenterology, Juntendo University Faculty of Medicine, Tokyo, Japan

Objective: The single nucleotide polymorphisms (SNPs) close to the IL28B gene are strong predictors of response to interferon-based therapy for chronic hepatitis C patients. However, approximately 20% of patients have discordant responses to the therapy, suggesting that undiscovered variants of the SNPs may be present near to this disease-associated gene. We sought to develop a practical approach to explore rare variants involved in the treatment response, based on next-generation sequencing (NGS) technology. Materials: Eight patients with the favorable genotype of the IL28B SNP (TT of rs8099917) who underwent 48 week of pegylated interferon-α and ribavirin therapy were enrolled in the study. They were categorized in two groups according to their virological response, 5 achieved an early virological response (EVR) while the others had a null virological response (NVR). Methods: PCR primers were developed to amplify specifically IL28B and the relevant IL28A genes. The amplicons were sequenced by an NGS and capillary sequencing was used to validate the variations identified by NGS. Measurements and Results: Target regions around IL28B and IL28A were specifically amplified by the in house primer sets. Real-time PCR was introduced to control the number of sequence reads on each sample before NGS analysis. Four candidate rare variants were identified through comparative NGS analyses of the EVR and NVR groups. In order to validate the results of the NGS, we subsequently used capillary sequencing but failed to confirm the existence of these rare variants. Conclusions: We have established a technical serial sequencing platform with NGS, potentially enabling the discovery of rare variant SNPs in genes of interest, such as IL28B in HCV infection. Key words: next generation sequencer, IL28B, real-time PCR, rare variant, single nucleotide polymorphisms

Abbreviations: HCV, hepatitis C virus; HBV, hepatitis B virus; CHC, chronic hepatitis C; GWAS, genome-wide association study; IL28A, interleukin-28A; IL28B, interleukin-28B; PEG-IFN/RBV, pegylated interferon-α and ribavirin; SNP, single nucleotide polymorphisms; VR, virological response; EVR, early virological response; NVR, null virological response; SVR, sustained virological response; NGS, next-generation sequencing; PCR, polymerase chain reaction; emPCR, emulsion polymerase chain reaction; SOC, standard of care; HCC, hepatocellular carcinoma; DAA, direct-acting antiviral agent; UTR, untranslated region; RNA, ribo-

nucleic acid; DNA, deoxyribonucleic acid; LD, linkage disequilibrium Introduction Hepatitis C virus (HCV) is one of the leading causes of liver cirrhosis and hepatocellular carcinoma, with nearly 170 million people infected worldwide 1). Combination therapy with pegylated IFN-α and ribavirin (PEG-IFN/RBV) has been used for chronic hepatitis C (CHC) patients as the standard of care (SOC) in many countries, achieving sustained virological responses (SVR) in 42-52% of genotype 1 patients 2-5). Even in the

Corresponding author: Masashi Mizokami Department of Hepatic Diseases, The Research Center for Hepatitis & Immunology, National Center for Global Health and Medicine 1-7-1 Kohnodai, Ichikawa-shi, Chiba 272-8516, Japan TEL: + 81-47-372-3501 〔Received

568

FAX: + 81-47-375-4766

Aug. 11, 2014〕〔Accepted

E-mail: [email protected]

Nov. 10, 2014〕

Juntendo Medical Journal 60 (6), 2014

coming era of all oral and IFN-free regimens for the treatment of CHC patients, PEG-IFN/RBV therapy may hold promise for patients with advanced fibrosis and a high risk of hepatocellular carcinoma (HCC). In addition, the cost of DAA is likely to be high compared to that of the SOC, potentially draining the budget for medical care in developing countries. Therefore, from the clinical and costeffective points of view, it is arguably necessary to predict the response to PEG-IFN/RBV, before starting the therapy, and to tailor it individually. Several clinical studies have identified viral and host factors that are associated with treatment failure. The host factors responsible for a poor response to IFN-based treatment have been reported to be older age, male gender, and the degree of liver fibrosis 4) 6). Genome-wide association studies (GWAS), including our own, have demonstrated that single nucleotide polymorphisms (SNPs) upstream of the promoter region within the interleukin-28B gene (IL28B), which encodes a type III interferon (IFN-λ3), are strongly associated with the response to PEG-IFN/RBV by CHC patients 7)-11). The favorable IL28B SNP has been shown to have a positive impact on therapeutic HCV eradication; the rate of SVR in patients with HCV genotype 1 reaches 80% in PEG-IFN/ RBV therapy. On the contrary, 80% of the patients with unfavorable IL28B SNPs given the same therapy fail to eradicate HCV 8). These results indicate that some factors that influence the outcome of anti-HCV treatment may remain undiscovered. In exploring the above-mentioned possibility, Prokunina-Olsson et al. 12) recently identified the SNP rs368234815 (ss469415590), located in the IL28B gene, which is associated with clinical response in HCV infection. This SNP is located in a new variant gene (IFN-λ4) that lies upstream of IFN-λ3 12). McFarland et al. 13) reported that the SNP rs4803217, within the 3ʼUTR of IL28B, regulates the stability of the gene, thus influencing on the expression of IL28B 13). These SNPs are common variants registered in the international database. Recently, other SNPs with lower frequencies, i.e., rare variants, have been attracting much attention, because they have been reported to be involved in the clinical outcomes of various diseases 14). However, it remains to be

determined whether such rare variants are present in the IL28B gene and may be associated with the discordant response to PEG-IFN/RBV therapy for CHC patients. In order to establish a platform for such an analysis, we aimed to verify a practical workflow for exploring novel rare variants in the IL28A and IL28B genes, based on next generation sequencing (NGS) in combination with conventional sequencing techniques. In this study, we confirmed the value, as well as the limitations, of the NGS-based approach for hunting rare variants. Patients and methods 1. Study population In order to compare the sequences of the IL28A and IL28B genes between responders and nonresponders, we enrolled 8 Japanese CHC patients (genotype 1b and high viral load) with favorable IL28B SNPs. Among such patients who underwent the PEG-IFNα2b or PEG-IFN-α2a and RBV treatment for 48 weeks in Kohnodai Hospital, we examined 8 patients who received at least 80% of the recommended doses of PEG-IFN and RBV. All subjects were negative for HBV and human immunodeficiency virus and none had HCC 15). They were treated with PEG-IFN-α2b (1.5 μg per kg body weight (μg/kg), injected subcutaneously once per week) or PEG-IFN-α2a (180 μg, injected once per week) plus RBV (600-1,000 mg daily, depending on body weight) for 48 weeks in Kohnodai Hospital. The study protocol conformed to the ethical guidelines set out in the Declaration of Helsinki (2013) and was approved by the ethical committee of the National Center for Global Health and Medicine. Written informed consent was obtained from all patients. 2. Definition of virological response to PEG-IFN/ RBV therapy In PEG-IFN/RBV therapy, virological response was assessed according to the practical guidelines of American Association for the Study of Liver Diseases (AASLD) for the treatment of CHC, In brief, an EVR was defined as undetectable serum HCV RNA by week 12 of treatment. A null-VR was defined as detectable HCV RNA throughout and after the cessation of therapy.

569

Takeda, et al: Establishment of a practical workflow using a next generation sequencer to search for novel SNPs

3. Genotyping Human genomic DNA was extracted from the buffy coat fraction of whole blood using a GENOMIX kit (Promega, Madison, WI). Genotyping of the rs8099917 and rs1279860 SNPs was performed using the Invader Plus assay. The enzymes used in the Invader Plus are native Taq polymerase (Promega, Madison, WI) and Cleavase (Third Wave Technologies, Madison, WI). The primers and probes are listed in supporting Table-S1. The PCR primers had a melting temperature (Tm) of 72℃ and the Invader detection probes had a target-specific Tm of 63℃ 16). The PCR was performed in a LC480II (Roche Diagnostics, Basel, Switzerland) and the results were analyzed using Endpoint genotyping software (Roche Diagnostics, Basel, Switzerland). 4. Amplification of targeted genomic regions Re-sequencing of the IL28A and IL28B promoter regions was performed using two primer sets (set 2 and set 3, Table-S1). PCR was performed using GXL DNA polymerase (Takara, Japan) under the following cycling conditions: denaturation at 98℃ for 5 min, followed by 35 cycles of 98℃ for 10 s, 68℃ for 15 s, and 68℃ for 12 min (set 2) or 18 min (set 3), and a final extension step at 68℃ of 7 min. The PCR products were visualized on a 0.5% Gold Agarose gel and purified with a QIAquick PCR purification kit (QIAGEN, Valencia, CA). DNA samples were fragmented (500 bp) in a Covaris acoustic solubilizer (Covaris, Woburn, MA) and quantified using a Bioanalyzer (Agilent Technologies, Palo Alto, CA). Finally, these products were purified using the MinElute PCR purification kit (QIAGEN) and eluted in 16 μl of TE buffer. 5. Re-sequencing analysis using next-generation sequencing (NGS) The sequencing library was prepared according to the Rapid Library Preparation Method Manual (Roche). For emulsion PCR (emPCR), DNA libraries were pooled in equimolar amounts, assessed by real-time PCR (KAPA, Wilmington, MA), and processed according to the emPCR Amplification Method Manual (Lib-L kit, Roche). Re-sequencing was performed using the GS Junior System according to the standard protocol (Roche).

570

6. NGS data analysis Re-sequencing data were analyzed using the GS reference mapping software (Roche). Nucleotide sequence reads were aligned with consensus sequences from the hg19 assembly. SNPs that differed from the consensus sequences of hg19 were identified for each patient. The genotypes of rs368234815 (ss469415590) and rs4803217 12) 13) were determined from the sequence data. Capillary sequencing was applied to confirm the candidate variants (3130xl sequencer, Thermo Fisher Scientific, Waltham MA). 7. Statistical analysis Continuous variables were compared using the Studentʼs t-test and categorical variables were compared using Fisherʼs exact test. P-values < 0.05 were considered significant. Results 1. Clinical background and IL28B genotype of the study patients In this study, we examined 8 patients with CHC with the favorable genotype of rs8099917 who underwent 48 weeks of PEG-IFN/RBV therapy (Table-1). Three patients achieved EVR and the remaining five had NVR. The SNPs known to be associated with responses to PEG-IFN/RBV were analyzed prior to treatment. The rs8099917 and rs12979860 genotypes are listed in Table-1.

Table-1

Patientsʼ characteristics NVR (n = 3)

EVR (n = 5)

Age

57 ± 1

63 ± 9

M:F

0:3

0:5

BMI

22 ± 2

26 ± 2

AST (IU/l)

62 ± 15

31 ± 9

ALT (IU/l)

50 ± 18

30 ± 8

WBC (/ml)

4,500 ± 989

4,240 ± 1,156

Hb (g/dl)

14.1 ± 0.1

13.5 ± 0.5

4

Plt (× 10 /ml)

16.2 ± 5.9

15.9 ± 6.4

T-chol (mg/dl)

162 ± 32

186 ± 45

20.6 ± 21.5

6.25 ± 2.6

7.2 ± 0.5

6.8 ± 0.2

AFP (ng/dl) HCV RNA (log IU) FIB-4

33.4 ± 10.9

30.58 ± 28.9

rs8099917 (TT)

3

5

rs12979860 (CC)

3

5

Juntendo Medical Journal 60 (6), 2014

A

B

Figure-1

Schematic illustration of the genomic region around IL28B and IL28A

(A) Annotated data retrieved from the USCS genome browser. Set 2 and set 3 denote the amplified fragments. The sequences of known genes were retrieved from Refseq data. Black rsIDs are SNPs reported to have a significant association with responses to PEG-IFN/RBV therapy. Red font indicates the candidate variants in this study. (B) The LD blocks of the Japanese population were retrieved from the HapMap database. The locations of the SNPs shown in the upper bar correspond to the scale shown in (A).

2. NGS analysis of CHC patients with the favorable IL28B genotype To find rare variants associated with treatment responses, we carried out NGS analysis of the regions spanning from IL28B to IL28A. Because the gene regions peripheral to IL28B and IL28A share high sequence similarity, long PCR could confuse the sequence of IL28B with that of IL28A during mapping analysis. Therefore, to amplify the sequences around IL28B and IL28A, we designed PCR primers that recognize unique sites distant from the highly similar regions (Figure-1A). After PCR amplification, the PCR products were confirmed by sequencing analysis to avoid amplification of only one allele. The rs8099917, rs12979860, rs4803217 and rs368234815 genotypes were exam-

Table-2

Summary of SNPs around IL28B

SNPs

NVR (n = 3)

EVR (n = 5)

rs8099917 (T/T)

3

5

rs12979860 (C/C)

3

5

rs4803217 (C/C)

3

5

rs368234815 (TT/TT)

3

5

ined to confirm the results of the Invader assay by sequencing (Table-2) and no discrepancies were detected between SNP typing and sequencing. Because the SNPs rs368234815 and rs4803217 lie within IFN-λ4 and the IL28B 3ʼ-UTR, respectively, and are thought to be correlated with treatment responses 12) 13), we identified them from the sequence data. Because the haplotype of the enrolled

571

Takeda, et al: Establishment of a practical workflow using a next generation sequencer to search for novel SNPs

Table-3 Primer Sample No. Average reads

Average reads of NGS data

Set2 1

2

3

4

Set3 5

6

7

8

170.3 126.1 137.3 158.5 168.8 155.0 151.8 150.0

Table-4

1

2

3

4

6

7

8

Detected variations around IL28B and IL28A between EVR vs. NVR

Genome position a 1 chr19 : 39733597-39733624

5

159.3 135.2 136.7 129.7 118.5 155.9 146.8 143.6

Reference

EVR

NVR

P value

4/5

0/3

0.14

3/5

0/3

0.19

3/5

0/3

0.19

0/5

2/3

0.11

TGGGATTATGGGCTTGTGCCACCACACC Query TGGGATTACAGGCATGTGCCACCACACC TGGGATTATAGGTGTGTACCACCACACC 2 chr19 : 39741520-39741552

Reference AATTGCAGTGAGCCAAGGTTGCGCCACTGCACT Query AATTGCAGTGAGCCATGTTTGTGCCACTGCACT

3 chr19 : 39742132-39742170

Reference TGGGCGACAGAGTGAGAGACTGTCTCAAAAAAAAAAAAA Query TGGGCGACAGAGTGAGAGACAGTCTCAAAAAAAAAAAAA

4 chr19 : 39742455-39742498

Reference AAACTCCGTCTCAAAAAAAAAAAAAGACACAAAAGGGAGGTTCT Query AAACTCCGTCTCAAAAAAAAAAAACGACACAAAAGGGAGGTTCT

a, chromosome 19 position; underbars show nucleotides variations were detected. Bold is variations detected in the present NGS analysis. Fisherʼs exact test was determined for p value.

patients was same, they showed strong linkage disequilibrium (LD) in these samples. 3. Comparison between the two groups Next, all amplicons were prepared for the NGS analysis. Real-time PCR was used for quantification of the DNA in the final step of sample preparation. Based on real-time PCR data, each sample was mixed into one tube at a fixed concentration. Thus, the average genome coverage of NGS data was constant, with approximately 146.5 reads in the samples (Table-3). The SNPs data specific for each sample were obtained by comparing the sequences of each sample with a reference sequence (hg19). These individual data were summarized for each group. A comparison analysis of rs8099917 TT genotype group, EVR vs. NVR, was performed to find the variations affecting the response to PEG-IFN/RBV therapy and four candidate variations were detected between EVR and NVR

572

(Table-4). The candidate variations identified in this study are shown in red in Figure-1A (SNP-1 to -4). 4. Linkage disequilibrium Because it is not possible to calculate the LD from a small number of samples, we obtained LD data for the Japanese population from HapMap (Figure1B). The positions of the SNPs shown in Figure-1B correspond with those in Figure-1A. There is strong LD between rs8099917, rs12979860, rs368234815, and rs4803217 among the Japanese population. Based on the LD block derived from the HapMap, the genomic region containing the candidate variations is shown in the LD block. These variations are not registered in the international database, implying that the candidates could be rare variants associated with EVR or NVR to PEG-IFN/RBV therapy.

Juntendo Medical Journal 60 (6), 2014

1 Refseq Query

2

Refseq Query

3

Refseq Query

4

Refseq Query

Figure-2

Validation by direct sequencing

The four candidate variations were sequenced using a capillary sequencer and the sequence data from all samples are shown in each figure. Arrows indicate the location of the candidates. Nos. 1-4 correspond to Table-4.

5. Validation of the candidate variations using capillary analysis It has been suggested that NGS data frequently contain some mistakes of base calling for the detection of genetic variation. In order to confirm the existence of the candidate variations, we used capillary sequencing for the analysis of the 8 samples above. The regions spanning the 4 variations were compared with the reference sequence data and the NGS data. All regions of the candidate variations were in accordance with the reference sequence (Figure-2), suggesting that the presumed rare variants detected in the NGS analysis were false positives. Discussion In this study, we sought to identify rare variant SNPs in the IL28A and IL28B genes that are associated with the response to PEG-IFN/RBV therapy for CHC patients. We performed serial sequencing using NGS and the conventional capillary method. First, we enrolled CHC patients with the favorable IL28B SNPs but who responded

distinctly to the SOC, one group with NVR and the other EVR. Second, genomic DNA from the patients was analyzed by NGS. A comparative analysis of two such groups has been found to be ideal to find a new rare variation associated with the treatment response of patients with the IL28B favorable genotype 14). As a result, we detected four candidate variations, which were located around the IL28B gene, within a region of the LD block harboring rs8099917. Third, we re-sequenced these candidate variants, using the capillary sequencing method, for validation. Consequently, these presumed variations were determined to be false positives and we had failed to detect rare variants that could account for the discordant virological response to PEG-IFN/RBV therapy in patients with the favorable IL28B genotype. NGS enables the detection of genetic variants with very low frequencies by multiple read coverage. From its application to issues of clinical relevance, certain rare variants have been reported to be involved in the pathogenesis of various diseases. Recently, the combined use of NGS and conventional capillary sequencing, the approach used in this study, discovered rare variants associated with the outcome of neuropsychiatric disease 17) 18). However, such successful cases of discovery of target variations are limited. Our approach also failed, the reason for which seems to be the small sample size in the study. Data from NGS using a mixture of multi-samples tends to be discordant, with different reads and depths on each sample. Such problems were resolved by introducing the real-time PCR method before NGS analysis. Only prepared DNA samples with the sequence adapters on the 5ʼ and 3ʼ terminal were used for the NGS analysis. The primer set for the real-time PCR detects DNA molecules with the two adapters, whilst other methods such as electrophoresis or absorption detect DNA molecules with and without the adapters. Therefore, a real-time PCR method provides accurate sample quantification. We used the GS Jr. System NGS, which employs pyro-sequencing technology, for the analysis. Pyro-sequencing produces relatively long data reads, approximately 500-800 bp, compared to the other NGS devices. Nevertheless, it is well known that the error rate of NGS is relatively high

573

Takeda, et al: Establishment of a practical workflow using a next generation sequencer to search for novel SNPs

compared to capillary sequencing 19). Thus, validation with another method, as we used in this study, is needed to confirm that any candidate variations are real. One of the plausible causes of sequencing error in the GS Jr. System NGS is attributable to the pyro-sequencing method. It is recognized that pyro-sequencing is accompanied by homopolymerlength inaccuracies. Although, the“false positive” bases we found in this study were not homopolymer-length errors, several other causes of sequencing errors have been reported for the pyrosequencing method 20). Other NGS devices have been launched by several manufactures. The GA2x or Hiseq sequencer (Illumina, USA) has provided the most accurate sequencing data but the read lengths of those sequence are the shortest among the NGS devices 21) 22). Theoretically, it would be possible to sequence the amplicon using the GA2x or Hiseq devices. However, the huge amounts of short read-length data that might be obtained from the GA2X or HiSeq would make it more difficult to analyze the variation. In addition, because the data read by conventional capillary sequencing is more accurate than that of all the NGS devices, validation using capillary sequencing is indispensable. It is therefore crucial to comprehend the advantages and disadvantages of each NGS device for the application. In conclusion, we have developed a technical workflow of NGS and subsequent capillary sequencing to analyze rare variant SNPs in disease-associated genes. As representatives of essential factors affecting treatment responses in CHC patients, we examined the IL28B and IL28A genes but failed to detect significant variations in this study. Because rare variants are present in less than 1% of the general population, further study is warranted using different cohorts with larger sample sizes. References 1) Houghton M, Abrignani S: Prospects for a vaccine against the hepatitis C virus. Nature, 2005; 436: 961-966. 2) Fried MW, Shiffman ML, Reddy KR, et al: Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med, 2002; 347: 975-982. 3) Hadziyannis SJ, Sette H Jr, Morgan TR, et al: Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med, 2004; 140: 346-355.

574

4) Manns MP, McHutchison JG, Gordon SC, et al: Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet, 2001; 358: 958965. 5) Tsubota A, Arase Y, Someya T, et al: Early viral kinetics and treatment outcome in combination of high-dose interferon induction vs. pegylated interferon plus ribavirin for naive patients infected with hepatitis C virus of genotype 1b and high viral load. J Med Virol, 2005; 75: 27-34. 6) Shirakawa H, Matsumoto A, Joshita S, et al: Pretreatment prediction of virological response to peginterferon plus ribavirin therapy in chronic hepatitis C patients using viral and host factors. Hepatology, 2008; 48: 17531760. 7) Thompson AJ, Muir AJ, Sulkowski MS, et al: Interleukin-28B polymorphism improves viral kinetics and is the strongest pretreatment predictor of sustained virologic response in genotype 1 hepatitis C virus. Gastroenterology, 2010; 139: 120-129 e18. 8) Tanaka Y, Nishida N, Sugiyama M, et al: Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet, 2009; 41: 1105-1109. 9) Ge D, Fellay J, Thompson AJ, et al: Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature, 2009; 461: 399-401. 10) Suppiah V, Moldovan M, Ahlenstiel G, et al: IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet, 2009; 41: 1100-1104. 11) Thomas DL, Thio CL, Martin MP, et al: Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature, 2009; 461: 798-801. 12) Prokunina-Olsson L, Muchmore B, Tang W, et al: A variant upstream of IFNL3 (IL28B) creating a new interferon gene IFNL4 is associated with impaired clearance of hepatitis C virus. Nat Genet, 2013; 45: 164-171. 13) McFarland AP, Horner SM, Jarret A, et al: The favorable IFNL3 genotype escapes mRNA decay mediated by AU-rich elements and hepatitis C virus-induced microRNAs. Nat Immunol, 2014; 15: 72-79. 14) Lee S, Abecasis GR, Boehnke M, Lin X: Rare-variant association analysis: study designs and statistical tests. Am J Hum Genet, 2014; 95: 5-23. 15) McHutchison JG, Manns M, Patel K, et al: Adherence to combination therapy enhances sustained response in genotype-1-infected patients with chronic hepatitis C. Gastroenterology, 2002; 123: 1061-1069. 16) Ito K, Higami K, Masaki N, et al: The rs8099917 polymorphism, when determined by a suitable genotyping method, is a better predictor for response to pegylated alpha interferon/ribavirin therapy in Japanese patients than other single nucleotide polymorphisms associated with interleukin-28B. J Clin Microbiol, 2011; 49: 1853-1860. 17) Purcell SM, Moran JL, Fromer M, et al: A polygenic burden of rare disruptive mutations in schizophrenia. Nature, 2014; 506: 185-190. 18) Girard SL, Gauthier J, Noreau A, et al: Increased exonic de novo mutation rate in individuals with schizophrenia. Nat Genet, 2011; 43: 860-863. 19) Lee H, Tang H: Next-generation sequencing technolo-

Juntendo Medical Journal 60 (6), 2014

gies and fragment assembly algorithms. Methods Mol Biol, 2012; 855: 155-174. 20) Balzer S, Malde K, Jonassen I: Systematic exploration of error sources in pyrosequencing flowgram data. Bioinformatics, 2011; 27: i304-i309. 21) Zagordi O, Daumer M, Beisel C, Beerenwinkel N: Read

Table-S1

length versus depth of coverage for viral quasispecies reconstruction. PLoS One, 2012; 7: e47046. 22) Imelfort M, Edwards D: De novo sequencing of plant genomes using second-generation technologies. Brief Bioinform, 2009; 10: 609-618.

Primer list

SNPs

Primer and Probe

rs8099917

Forward 5ʼ-TCATCCCTCATCCCACTTCTGGAACA-3ʼ Reverse 5ʼ-CGGGCCATCTGTTTCCTGCTG-3ʼ Probe 1 5ʼ-AGGCCACGGACGAATTGCTCACAGAAAGGAA-3ʼ Probe 2 5ʼ-CGCGCCGAGGCATTGCTCACAGAAAGGA-3ʼ

rs12979860

Forward 5ʼ-GGATGGGTACTGGCAGCGC-3ʼ Reverse 5ʼ-AGGCGCCTCTCCTATGTCAGC-3ʼ Probe 1 5ʼ-CGCGCCGAGGCGAACCAGGGTTGAAT-3ʼ Probe 2 5ʼ-AGGCCACGGACGTGAACCAGGGTTGAATT-3ʼ Invader oligo 5ʼ-CCAGGGAGCTCCCCGAAGGCGA-3ʼ

Set2

Forward 5ʼ-TCTCAGCTTCCACCAGTAGCTGGGATTATG-3ʼ Reverse 5ʼ-ATCCGACCCCTTCCTTAACCTCTGTCAACC-3ʼ

Set3

Forward 5ʼ-CTGGGGCCCAGAGTAGGTTGGAGAAGCAG-3ʼ Reverse 5ʼ-GGAGGACATGAATCAGCCCCTATAGTAGGAGCATG-3ʼ

575