experiments combined with dimethyl sulfate protection exper- iments revealed ... vitellogenin gene coincided with the estradiol-receptor com- plex binding site.
Proc. Nail. Acad. Sci. USA Vol. 84, pp. 7453-7457, November 1987 Biochemistry
Interaction of two nonhistone proteins with the estradiol response element of the avian vitellogenin gene modulates the binding of estradiol-receptor complex (gene regulation/DNA binding proteins/synthetic oligonucleotide/dyad symmetry/methylation)
1. M. FEAVERS*, J. JIRICNY*, B. MONCHARMONTt, H. P. SALUZ*, AND J. P. JOST* *Friedrch Miescher Institut, P.O. Box 2543, CH4002 Basel, Switzerland; and chirurgia UniversitA di Napoli, 1-80138 Napoli, Italia
tistituto di Patologia Generale ed Oncologia Prima FacoltA di Medicina e
Communicated by Diter von Wettstein, July 13, 1987 (received for review May 26, 1987)
The DNA sequence corresponding to the ABSTRACT estradiol response element has been synthesized and tested in vitro for the binding of specific proteins. Gel retardation experiments combined with dimethyl sulfate protection experiments revealed that this region binds two nonhistone proteins (NHPs). One of them, NHP-1, has a molecular weight of 70,000 and binds specifically to the dyad symmetry sequence GGTCAGCGTGACC. The NHP-1 can be separated from the estradiol receptor chromatographically; it does not bind estradiol and does not cross-react with an antibody directed against the estradiol receptor. A series of synthetic "mutant" oligonucleotides were tested in a protein-DNA binding competition assay. Deletion of the GCG in the center of the dyad symmetry sequence suppressed the binding of NHP-1 by 90%, and the conversion of any GC pair to an AT pair decreased the affinity of the binding site for NHP-1. Methylation of the two CpGs on both strands of the dyad symmetry sequence decreased the affinity of the binding site for NHP-1 by 60%, whereas hemimethylation of the same structure did not inhibit the binding of NHP-1. NHP-1 and NHP-2, the NHP binding to the DNA next to the dyad symmetry sequence, bind exclusively to double-stranded DNA. NHP-2 has a molecular weight of 60,000. NHP-1 and NHP-2 are neither tissue nor species specific. In vitro reconstitution experiments show that NHP-1 and NHP-2 increase the binding efficiency of the estradiolreceptor complex to the estradiol response element. A sequence situated 600 base pairs upstream of the avian vitellogenin gene preferentially binds purified nuclear estradiol-receptor complex (1). Comparison of the 5'-flanking sequence of Xenopus and chicken vitellogenin genes and very low density apolipoprotein II genes revealed a region of homology that consisted of the dyad symmetry sequence GGTCANNNTGACC (2). Its location upstream of the avian vitellogenin gene coincided with the estradiol-receptor complex binding site. Ligation of the equivalent region of the Xenopus vitellogenin gene to a thymidine kinase promoterchloramphenicol acetyltransferase gene fusion and transient expression in the estradiol-responsive human breast cancer cell line MCF7 has demonstrated that this sequence is an essential part of the estradiol response element (ERE) (3, 4). During activation of the vitellogenin gene by estradiol, the region including the ERE becomes associated with the nuclear matrix (5), and two CpGs within the dyad symmetry sequence are demethylated in a strand-specific manner (6). The functional complexity of this important regulatory region suggested that the ERE may bind other proteins. Moreover, DNase I "footprinting" experiments (1) and the electron microscopy studies of the protein-DNA interactions at the The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
ERE of the Xenopus vitellogenin gene (7) also indicate that the protein-DNA complexes formed at the ERE are large and may include other proteins besides hormone receptor. This paper shows that two nonhistone proteins (NHPs) bind with high affinity to the ERE of the avian vitellogenin gene and enhance the binding of the hormone-receptor complex to the ERE. /1
MATERIALS
AND METHODS
Oligonucleotide and Oligonucleotide-Sepharose Synthesis. The double-stranded oligodeoxyribonucleotides, the upper strands of which are shown in Fig. 1 and in Table 1, were synthesized as described (8). The oligonucleotides were labeled with T4 polynucleotide kinase using [y-32P]ATP (9). Double-stranded oligonucleotide C was covalently linked to CNBr-activated Sepharose (10). DNA-Protein Binding and Competition Assay. The polyacrylamide gel retardation assay was carried out as described (8). Nuclei, nuclear extracts, and all cell lysates were prepared as described (8, 11, 12). Fractionation of Estradiol Receptor Free of NHP-1 and NHP-2. The crude nuclear estradiol receptor from MCF7 cells was precipitated with ammonium sulfate (30% of saturation at 4°C). After centrifugation the protein sediment was dissolved in a solution containing 100 mM Tris-HCI (pH 8), 50 mM KCI, 1 mM MgCl2, 1 AM ZnC12, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and 10% (vol/vol) glycerol and dialyzed at 4°C against several changes of the same buffer. The protein solution was passed over an 8-ml heparinSepharose column equilibrated with the same buffer. The activated estradiol receptor flowed through the column (13), whereas NHP-1 and NHP-2 were retained. The receptor preparation had 250-500 fmol of receptor per mg of protein with no detectable NHP-1 or NHP-2. Analysis of the Protein from the Protein-DNA Complexes. Following autoradiography of the gel retardation assay, the bands representing the specific DNA-protein complex were cut out of the gel. An equivalent gel slice was also excised from the same region of control lanes containing the protein but no protein-DNA complex. The proteins in both slices were electroeluted and precipitated with 9 volumes of ethanol at -70°C for 2 hr. Proteins were analyzed on a 10% NaDodSO4/polyacrylamide gel, and the protein bands were silver stained (14). Dimethyl Sulfate Protection Experiments. Dimethyl sulfate protection experiments were carried out essentially as described by Ogata and Gilbert (15). Labeled DNA was incubated with purified HeLa cell lysate, and the same amount of bovine serum albumin or cell lysate from the chicken hepaAbbreviations: NHP, nonhistone protein; ERE, estradiol response element.
7453
7454
Proc. Natl. Acad. Sci. USA 84 (1987)
Biochemistry: Feavers et al.
toma cell line DU249/5 was used as control. The cell line DU249/5 is a clone isolated from cell line DU249 (16). DNA-Sepharose Binding and Competition Assays. The DNA-Sepharose binding and competition assays were performed according to Mulvihill et al. (17) as modified by Jost et al. (1). Immunochemical Techniques. Immunoprecipitation was carried out with a 10-fold excess of the monoclonal antibody JS-34/32 (18, 19) as described (8). The receptor concentration was determined as described by Best-Belpomme et al. (20). Materials. T4 polynucleotide kinase was obtained from Biofinex (Praroman, Switzerland). CNBr-activated Sepharose and heparin-Sepharose were purchased from Pharmacia. The triethylammonium salt of deoxyadenosine 5'-[a- 32P or y-32P]triphosphate (3000 Ci/mmol; 1 Ci = 37 GBq) and [2,4,6,7,10,17-3H]estradiol (130 Ci/mmol) were from Amersham.
RESULTS The Protein That Binds to the Dyad Symmetry Sequence GGTCAGCGTGACC of the ERE Is Not the Estradiol Receptor. Preliminary experiments using a gel retardation assay to identify possible protein-DNA interaction at the ERE revealed that two proteins bound the synthetic double-stranded oligonucleotide C of Fig. 1 in an excess of nonspecific DNA (data not shown). One, designated NHP-1, recognized a sequence represented in oligonucleotide A, and the other, NHP-2, bound a sequence in oligonucleotide B. The NHP-1 could be separated from activated estradiol receptor by heparin-Sepharose chromatography (Fig. 2, lane 2). The estradiol binding activity was not retained on a heparin-Sepharose column, whereas the DNA binding protein was eluted in a 0.15 to 0.4 M KCI fraction. This evidence that NHP-1 and the estradiol receptor are different from one another is supported by the finding that the 0.15 to 0.4 M KCI protein fraction did not react with anti-estradiol receptor antibody (Fig. 2, lanes 3 and 4). Had the antibody bound to NHP-1 it would have either prevented protein-DNA complex formation by blocking the DNA-binding domain or increased the size of the protein-DNA complex. Fig. 2 shows that neither of these effects was observed. The molecular weights of NHP-1 and NHP-2 were determined by NaDodSO4/polyacrylamide gel electrophoresis of the proteins eluted from the protein-DNA complex obtained in the gel retardation assay. The protein bands (Fig. 3, lanes 1) were compared with those obtained from control reactions in which the oligonucleotide had been omitted (Fig. 3, lanes - 600 3' _ 5'
1
2 3 4
5 6
f
FIG. 2. NHP-1, which binds to the dyad symmetry sequence GGTCAGCGTGACC, is not the estradiol receptor. End-labeled oligonucleotide A (0.5 ng) and 2.5 ,ug of nonspecific, competing Escherichia coli DNA were incubated with the following components. Lanes: 1, 10 ,ug of unfractionated MCF7 lysate; 2, 4 Ag of the fraction of MCF7 lysate eluted from heparin-Sepharose with 0.15 to 0.4 M KCI; 3, 4 ,Ag of the same fraction after a 5-hr preincubation on ice with a 10-fold excess of anti-estradiol receptor antibody; 4, 4 ,ug of the fraction incubated with a 10-fold excess of anti-estradiol receptor antibody during protein-DNA complex formation; 5, antibody in the absence of NHP-1; 6, no added protein. Bands b and f are the bound and free DNA, respectively.
2). In each case only one additional band was observed. Comparing these bands with known size markers revealed that NHP-1 and NHP-2 had molecular weights of 70,000 and 60,000, respectively. The Proteins NHP-1 and NHP-2 Are Neither Tissue nor Species Specific. Nuclear extracts prepared from liver, oviduct, kidney, and spleen from egg-laying hens all formed protein-DNA complexes with both double-stranded oligonucleotides A and B (Fig. 4 Upper). Similar experiments carried out with whole cell lysates of cultured cells from different animal species indicate that NHP-1 and NHP-2 are not species specific. The chicken hepatoma cell line DU249/5 was an exception (Fig. 4 Lower). Structural Requirements of the NHP-1 and NHP-2 Binding Sites. Fig. 5 shows the effect of dimethyl sulfate on the NHP-1- and NHP-2-DNA complexes. Methylation of guanines at positions -625, -624, and -620 on oligonucleotide A was enhanced by binding NHP-1, whereas on the complementary strand the guanine residues at positions -613, -614, -619, and -622 were protected. These results suggest that NHP-1 binds to the dyad symmetry sequence GGTCAGCGTGACC. Binding of NHP-2 to oligonucleotide B only affects the level of methylation in the upper strand, enhancing the bands corresponding to guanines at positions -606, -602, and -593. This region encompasses a sequence similar 1
2
st
kd
st
2
1
-
200 116 92
5 GGTCANNNTGACC 3
5GCGTGACCGGAGCTGAAAGAACAC 3 TTC TTG TGTAACTAGGCAC5 GR preferential binding site of estradiol R. A.
66 45
5 TCCTGGTCAGCGTGACCGGA3 B.
ryt
5 AGCTGAAAGAACACATTGAT3
C. 5ATTCCTGGTCAGCGTGACCGGAGCTGAAAGAACACATTGATCCCC3
FIG. 1. The ERE as determined by the preferential binding of estradiol-receptor complex to DNA (1), by computer search (using the consensus sequence GGTCANNNTGACC) (2), and by functional assays of gene fusions with 5' deletions after transfection into MCF7 cells (3, 4). GR, glucocorticoid receptor binding site; R, receptor. The synthetic oligonucleotides A, B, and C used in this study are shown.
NHP 1
NHP2
FIG. 3. NaDodSO4/polyacrylamide gel electrophoresis of proteins associated with the dyad symmetry sequence of oligonucleotide A (Fig. 1A) and its 3'-flanking sequence, oligonucleotide B (Fig. 1B). Lanes: 1, the protein recovered from the protein-DNA complex; 2, the protein recovered from control lanes containing no oligonucleotide and hence no protein-DNA complex; st, protein molecular weight standards in kDa (kd). Arrows show NHP-1 and NHP-2.
Proc. Natl. Acad. Sci. USA 84 (1987)
Biochemistry: Feavers et al. B
A
L 0 K S
a
A.
L O K S
0 -j
a
0
N
ON
0
m
(N cn4 . LLO _Lo LflccnCN M co m
I.
r
w
m
Ji
0
C
:::W "o
cc 0.
a It
pId
B.
w
:3
45
7455
En
0
0
-593
-608
-602
W eam -599
I 0.. 8 22
-818 _bEI
Ub l619
-6204n FIG. 4. Neither NHP-1 nor NHP-2 is tissue or species specific. The protein-DNA binding assay was performed as in Fig. 2 with 20 ,ug of protein from nuclear extracts. Lanes A and B are oligonucleotides A and B, respectively, and are shown in Fig. 1. (Upper) The liver (L), oviduct (0), kidney (K), and spleen (S) nuclear extracts were prepared from the same pair of egg-laying hens. (Lower) The following cell lysates were tested: Hela, a human cervix carcinoma; MCF7, a human breast carcinoma; H35, a rat hepatoma; NB2A, a mouse neuroblastoma; 3T3, a mouse transformed fibroblast; DU249/5, a chicken hepatoma. Free DNA is not shown.
_S -606 -80fS _4,
..
-624
7625
-597
;:
614
to the consensus sequence of the glucocorticoid receptor
binding site (Fig. 1) situated between positions -603 and -598. As the binding site of NHP-1 coincided with the proposed ERE, we examined this protein-DNA interaction in more detail. A series of synthetic "mutant" derivatives of the "wild-type" oligonucleotide A (Table 1) were tested for their ability to compete with the wild-type sequence for NHP-1 binding. Experiments 1 and 3 of Table 1 and Fig. 6 demonstrated that single-stranded DNA was not a suitable substrate for NHP-1 binding. The spacing of the dyad symmetry sequence appears to be critical for NHP-1 binding. Deletion of the 3-base-pair spacer (Table 1, experiment 2) almost abolished the ability of the sequence to bind NHP-1, whereas the addition of 2 adenosines to the spacer (experiment 3) increased NHP-1 binding substantially. Replacing the GCG spacer with the trinucleotide ATA also reduced NHP-1 binding, reinforcing the importance of this central portion of the sequence. Pairwise base substitutions in the symmetrical component of the sequence (experiments 5-7) produced less dramatic reductions in protein binding and, although not all the possibilities have been exhausted, underlined the role of the dyad symmetry in NHP-1 binding. Since demethylation of cytosines in the two CG sites in the upper strand of the NHP-1 binding sequence correlated with vitellogenin gene expression in vivo (6), we tested whether the fully methylated (i.e., 5-methylcytosines in both CGs on both strands) and hemimethylated (5-methylcytosines in only one strand) oligonucleotide A competed with unmethylated DNA for NHP-1 binding. The results, shown in Fig. 6 and summarized in Table 1, revealed that the fully methylated sequence was a relatively poor substrate for NHP-1 binding, whereas the hemimethylated sequence bound NHP-1 more avidly than its unmethylated counterpart. Two other oligonucleotides were tested in the competition assay. Oligonucleotide B, which contains the NHP-2 binding site, competed weakly with oligonucleotide A for NHP-1 binding. An oligonucleotide containing an unrelated dyad symmetry sequence of the avian vitellogenin gene (8) failed to compete with oligonucleotide A for NHP-1 binding.
C.
B A T,
W V
v
v
v
TCCTGGTCAGCGTGACCGGAGCTGAAAGA ACACAT TG AT ----620 -
610
600
AGGAC CAG TC GCACTGGCC TC GACT T T C T TGTG TA AC TA A A &AA
FIG. 5. (A and B) Dimethyl sulfate protection experiment with oligonucleotides A and B, respectively. Protein-DNA complexes were assembled and then treated with a final concentration of 1% dimethyl sulfate for 2 min. Hela cell extract was used as the source of NHP-1 and NHP-2, while DU249/5 extract was used as a control. Coordinates of the bases are at the sides of the gels. (C) Nucleotide sequence of the ERE. Solid triangles, bases where methylation was enhanced by protein binding; open triangles, bases that were protected. The coordinates of the bases are given relative to the transcription start site. The Possible Role of NHP-1 and NHP-2 in Gene Expression. The involvement of NHP-1 and NHP-2 in the binding of estradiol-receptor complex to the ERE was examined in two ways. Fig. 7 shows the results of a competition assay to determine which DNA sequences were crucial in binding the estradiol-receptor complex. The partially purified estradiol receptor from chicken oviduct that was used for these experiments still contained NHP-1 and NHP-2. Oligonucleotide C was covalently bound to Sepharose beads, and the amount of labeled estradiol-receptor complex able to bind this DNA-Sepharose was determined in the presence of an increasing concentration of competing DNA. Oligonucleotides A and C were effective competitors of estradiol-receptor complex binding, whereas the spacer mutant of oligonucleotide A (Table 1, experiment 2) and an imperfect dyad symmetry sequence did not compete. This implicates oligonucleotide A, containing the sequence that binds NHP-1, in the binding of the estradiol-receptor complex. Oligonucleo-
Biochemistry: Feavers et al.
7456
Proc. Natl. Acad. Sci. USA 84 (1987)
Table 1. Summary of the results obtained from the competition assays Exp.
Competing DNA
Competition,
Form
% of wild type
ds ss
100 0
ds ds ds
12 170 0 40
ds ds ds
62 62 67
ds ds
41 150
ds ds
35 3
Wild type 1
5'TCCTGGTCAGCGTGACCGGA 3'
2 3
Mutation in spacer 5' TCCTGGTCATGACCGGA 3' 5' TCCTGGTCAAGCGATGACCGGA 3'
ss
4
5' TCCTGGTCAATATGACCGGA 3' Mutation in symmetry 5' TCCTAGTCAGCGTGACTGGA 3' 5' TCCTGATCAGCGTGATCGGA 3' 5' TCCTGGTTAGCGTAACCGGA 3' Methylation of CpG 5' TCCTGGTCAGmCGTGACmCGGA 3' Fully methylated
5 6 7 8
Hemimethylated Other sequence 5' AGCTGAAAGAACACATTGAT 3' 5' GATCGATGTCTTGTTCCAAACGC 3'
9 10
Results are from assays shown in Fig. 6. ds and ss, Double- and single-stranded DNA, respectively. Results 9 and 10 were obtained with oligonucleotide B (Fig. 1) and the imperfect dyad symmetry sequence from the third intron of the avian vitellogenin II gene (8), respectively.
tide B was able to compete weakly for estradiol-receptor complex binding, suggesting that the NHP-2 may also play a role in binding the hormone-receptor complex. In the second approach the binding of estradiol-receptor complex free of NHP-1 and NHP-2 was measured after pretreatment of the DNA-Sepharose with Hela cell extract or, as controls, with DU249/5 cell extract or with bovine serum albumin. Hela cell extract did not contain estradiol receptor but had large quantities of NHP-1 and NHP-2, whereas DU249/5 extract and bovine serum albumin lacked 0
A
3
8
Q0O5
these proteins. The results (Table 2) show that preincubation of the DNA-Sepharose with Hela extract, but not DU249 extract or bovine serum albumin, distinctly enhanced the binding of labeled estradiol-receptor complex in these reconstitution experiments.
DISCUSSION Using transient expression of a series of deletions within the 5'-flanking region of the Xenopus vitellogenin gene fused to a bacterial chloramphenicol acetyltransferase gene, it has been possible to locate the region of DNA that is functionally responsible for the estradiol response of this gene (3, 4).
QOS0
O
0.04
0.04
6c
1
9D-2
0.02 4
02
0. 0M0KC0f. 02 0o 6 pmoles of competing DNA
~~~~~~8
lol o
FIG. 6. Determination of the structural requirement of the DNA for the binding of NHP-1 by a competition assay. The labeled double-stranded oligonucleotide A (0.5 ng) and 2.5 szgof E. coli DNA were incubated with purified NHP-1 from chicken oviduct nuclear extract (0.15 to 0.4 M KCI fraction from heparin-Sepharose). Increasing concentrations of the synthetic unlabeled competing oligonucleotides (numbered from imto 10) listed in Table 1 were then added to the incubation mixture, and the reaction products were analyzed as described (8). The ordinate is the reciprocal of the percentage of specific protein~-DNA complex. Curves 1' and 3' are for the single-stranded (upper strand) oligonucleotides of DNA from curve 1 and 3. Curve 8' corresponds to curve 8 except that the oligonucleotide used was hemimethylated (methylated at both CpGs in the lower strand).
pmoles competing DNA
FIG. 7. Competition assay with synthetic oligonucleotides using labeled estradiol-receptor complex (ER) bound to DNA-Sepharose. The DNA covalently bound to the Sepharose beads is oligonucleotide C (Fig. 1). All of the experiments illustrated have been carried out with the same chicken oviduct receptor preparation containing NHP-1 and NHP-2. The competition assay was carried out as described (1). Curve 1 represents competition with double-stranded oligonucleotide A containing the dyad symmetry sequence (Fig. 1). Curve 2 is the competition with oligonucleotide B, the 3'-flanking sequence of A. Curve 3 is with oligonucleotide C. Curve 4 represents the competition with the double-stranded mutant 5' TCCTGGTCATGACCGGA 3'. Curve 5 is with the imperfect dyad symmetry sequence 5' GATCGATGTCTTGTTCCAAACGC 3' (8).
Biochemistry: Feavers et al. Table 2. Reconstitution of the binding of labeled estradiol-receptor complex on DNA-Sepharose Bound [3H]ER First incubation complex, dpm % bound ND 0 BSA 294 4 Hela extract 2292 33 ND DU249/5 extract 0 The Sepharose-bound DNA was double-stranded oligonucleotide C (Fig. 1). DNA-Sepharose beads (100 ,uL) were first incubated with 100 ,ug of bovine serum albumin (BSA), of Hela cell extract (containing NHP-1 and NHP-2), or of DU249/5 extracts (containing no NHP-1 and NHP-2) in a total volume of 300 Al. After a 30-min incubation at 20'C, the excess unbound protein was washed away. The protein-DNA matrix was incubated for a further 30 min at 20'C with 7000 dpm of labeled estradiol-receptor complex (ER) free of NHP-1 and NHP-2. The reaction was terminated with three 1-ml washes of cold binding buffer, and the radioactivity was determined. Experiments were carried out in duplicate and included a parallel control of Sepharose beads only. ND, not detectable.
Transient expression systems, however, give little information concerning events occurring at the molecular level. The present study investigates protein-DNA interactions at the ERE. We show that at least two proteins bind the ERE and that this interaction with the DNA ultimately enhances the binding of the estrogen-receptor complex. The NHP-1 binds to the dyad symmetry sequence GGTCAGCGTGACC, and it is implicit from both the competition assays (Fig. 7) and the reconstitution experiments (Table 2) that this site is indispensable for binding the hormone-receptor complex. Nevertheless NHP-1 is not the estradiol receptor itself: it does not cross-react with monoclonal antibody directed against estradiol receptor, it can be separated from estradiol binding activity on heparin-Sepharose chromatography, and it is not restricted to the same tissue as the estradiol receptor. Although it is generally assumed that steroid hormone-receptor complexes bind directly to DNA regulatory elements of the responsive genes (21, 22), so far there has been no conclusive proof that estradiol-receptor complex binds directly to the ERE. Chambon and co-workers (23) have shown that the estradiol receptor has a domain required for it to bind tightly to the nucleus and that this has the potential to form the so-called DNA binding fingers. It was not shown whether this domain mediates binding of the receptor directly to naked DNA, and we have not been able to establish that receptor purified by steroid ligand chromatography binds directly to the dyad symmetry sequence (unpublished observations). There appear to be two possible explanations for these findings. The first assumes that the binding affinity of the hormone-receptor complex for the DNA is so low that the protein-DNA interaction cannot be demonstrated by conventional in vitro methods such as the gel retardation assay or the use of sucrose density gradients; in this case the role of the NHP may be to stabilize binding of the complex to the ERE. The second is that the hormone-receptor complex binds not to the DNA but to NHP41, and that this binding is mediated by the nucleus binding domain of the estradiol receptor. Wahli and co-workers (3) have established that the sequence situated immediately on the 3' side of the dyad symmetry of the ERE also plays a role in stimulating the transcription of the Xenopus vitellogenin gene in the presence of estradiol. The equivalent region of the avian vitellogenin gene has no sequence homology with its counterpart in Xenopus, but it does specifically bind NH4P-2. The close proximity of this binding site to that of NHP-1 suggests that it too may be part of the ERE. Indeed, it is quite possible that
Proc. Natl. Acad. Sci. USA 84 (1987)
7457
NHP-1 and NHP-2 interact with one another as well as with the DNA. The fact that oligonucletide B, containing the NHP-2 binding site, can displace NHP-1 from its proteinDNA complex in competition experiments (Table 1 and Fig. 6), despite the lack of homology between the two sequences, may be evidence of such protein-protein interaction. A number of groups have presented evidence that specific NHPs together with the DNA were in some way involved in specifically binding the hormone-receptor complex to the chromatin and that naked DNA was unable to bind purified steroid receptors (24-28). Unfortunately, all these studies used only bulk chromatin and did not examine the role of specific DNA sequences in receptor binding. Now, by using recombinant and synthetic DNA, we have been able to establish that certain NHPs bind in a specific fashion to the regulatory region of a gene. It remains to be seen whether NHP-1 and NHP-2 are related to any characterized DNA binding proteins. We are grateful to Patrick Bugnon, Silvia Dressel, and Yan-Chim Jost for technical assistance; to Werner Zuercher for the synthesis of oligonucleotides, and to B. B. Rudkin for critically reading the manuscript. 1. Jost, J. P., Seldran, M. & Geiser, M. (1984) Proc. Natl. Acad. Sci. USA 81, 429-433. 2. Walker, P., Germond, J. E., Brown-Luedi, M., Givel, F. & Wahli, W. (1984) Nucleic Acids Res. 12, 8611-8626. 3. Seiler-Tuyns, A., Walker, P., Martinez, E., Mdrillat, A. M., Girel, F. & Wahli, W. (1986) Nucleic Acids Res. 14, 8755-8770. 4. Klein-Hitpass, L., Schorpp, M., Wagner, U. & Ryffel, G. U. (1986) Cell 46, 1053-1061. 5. Jost, J. P. & Seldran, M. (1984) EMBO J. 3, 2005-2008. 6. Saluz, H. P., Jiricny, J. & Jost, J. P. (1986) Proc. NatI. Acad. Sci. USA 83, 7167-7171. 7. Heggeler-Bordier, B., Hipskind, R., Seiler-Tuyns, A., Martinez, E., Cortesy, B. & Wahli, W. (1987) EMBO J. 6, 1715-1720. 8. Jost, J. P., Saluz, H. P., Jiricny, J. & Moncharmont, B. (1987) J. Cell. Biochem., in press. 9. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), pp. 113-127. 10. Kadonaga, J. T. & Tjian, R. (1986) Proc. Natl. Acad. Sci. USA 83, 5889-5893. 11. Panyim, S., Ohno, T. & Jost, J. P. (1978) Nucleic Acids Res. 5, 1353-1370. 12. Manley, J. L., Fire, A., Cano, A., Sharp, P. A. & Gefter, M. L. (1980) Proc. Natl. Acad. Sci. USA 77,. 3855-3859. 13. Molinari, A. M., Medici, N., Moncharmont, B. & Puca, G. A. (1977) Proc. Natl. Acad. Sci. USA 74, 4886-4890. 14. Burk, R. R., Eschenbruch, M., Leuthard, P. & Steck, G. (1983) Methods Enzymol. 91, 247-254. 15. Ogata, R. T. & Gilbert, W. (1978) Proc. Natl. Acad. Sci. USA 75, 5851-5854. 16. Langlois, A. J., Lapis, K., Ishizaki, R., Beard, J. W. & Bolognesi, D. P.
(1974) Cancer Res. 34, 1457-1464. 17. Mulvihill, E. R., LePennec, J. P. & Chambon, P. (1982) Cell 28, 621-632. 18. Moncharmont, B., Su, J. L. & Parikh, I. (1982) Biochemistry 21, 6916-6921. 19. Moncharmont, B., Anderson, W. L., Rosenberg, B. & Parikh, I. (1984) Biochemistry 23, 3907-3912. 20. Best-Belpomme, M., Mester, J., Weintraub, H. & Baulieu, E. E. (1975) Eur. J. Biochem. 57, 537-547. 21. Yamamoto, K. R. (1985) Annu. Rev. Genet. 19, 209-252. 22. Beato, M., Scheidereit, C., Krauter, P., von der Ahe, D., Janich, S., Cato, A. C. B., Suske, G. & Westphal, H. M. (1985) in Chromosomal Proteins and Gene Expression, eds. Reeke, G. R. & Puigdomenech, P. (Plenum, New York), pp. 121-143. 23. Kumar, V., Green, S., Staub, A. & Chambon, P. (1986) EMBO J. 5, 2231-2236. 24. Puca, G. A., Sica, V. & Nola, E. (1974) Proc. Natl. Acad. Sci. USA 71, 979-983. 25. Puca, G. A., Nola, E., Hibner, U., Cicala, G. & Sica, V. (1975) J. Biol. Chem. 250, 6452-6459. 26. Ruh, T. S., Ross, P., Wood, D. M. & Keene, J. L. (1981) Biochem. J. 200, 133-142. 27. Ruh, T. S. & Spelsberg, T. C. (1983) Biochem. J. 210, 905-912. 28. Hora, J., Horton, M. J., Toft, D. 0. & Spelsberg, T. C. (1986) Proc. Natd. Acad. Sci. USA 83, 8839-8843.
