Evaluating the effects of temperature, salinity ...

Journal of Experimental Marine Biology and Ecology 464 (2015) 11–17

Contents lists available at ScienceDirect

Journal of Experimental Marine Biology and Ecology journal homepage: www.elsevier.com/locate/jembe

Evaluating the effects of temperature, salinity, starvation and autotomy on molting success, molting interval and expression of ecdysone receptor in early juvenile mud crabs, Scylla paramamosain Jie Gong a, Kun Yu a, Ling Shu a, Haihui Ye a,b,⁎, Shaojing Li a, Chaoshu Zeng b,c,⁎⁎ a b c

College of Ocean and Earth Sciences, Xiamen University, Xiamen 361005, China Center for Marine Biotechnology, Xiamen University, Xiamen 361005, China College of Marine and Environmental Sciences, James Cook University, Townsville, Queensland 4811, Australia

a r t i c l e

i n f o

Article history: Received 20 October 2014 Received in revised form 10 December 2014 Accepted 11 December 2014 Available online xxxx Keywords: Scylla paramamosain Molting success Ecdysone receptor Temperature Starvation Autotomy

a b s t r a c t Newly molted first stage juvenile mud crabs (C1), Scylla paramamosain, were subjected to different temperatures (14, 20, 26, 32 and 39 °C), salinity (5, 10, 20, 30 and 40), starvation conditions and autotomy (for the autotomy experiment, the second stage crabs (C2) were used) to assess their effects on molting success, molting interval and corresponding expressions of the crab's ecdysone receptor (EcR). The results showed that at a low temperature of 14 °C no molt occurred with a subdued EcR mRNA level detected. In contrast, a higher temperature of 32 °C induced a significant increase in the expression of EcR gene and dramatically reduced the C1 molting interval as compared to other treatments. As the temperature further increased to 39 °C and after a period of 6 or more hours the expression of EcR gene dropped abruptly and all C1 crabs died without molt. On the other hand, a low salinity of 5 increased EcR mRNA levels at 72 h and shortened the molting interval significantly whilst high salinity of 40 resulted in the opposite. No significant difference in percentage molting success was detected among salinity from 10 to 40. When C1 crabs were subjected to starvation for longer than 48 h, the expression of EcR was found to be significantly repressed as compared to the feeding control, in which none of the starved crabs successfully molted. Meanwhile, although the molting success of C2 crabs was not significantly affected by autotomy, the molting interval significantly increased from 5.8 days for intact crabs to 6.2 days for the autotomized crabs. Interestingly, when compared to intact crabs, the expression level of EcR gene in autotomized crabs was at first repressed (i.e. during the first 120 h) but increased sharply to a level significantly higher than the control at 134 h (i.e. during premolt stage of the autotomized crabs). Our results showed that temperature, salinity, starvation and autotomy all affected molting of early juvenile mud crabs and changes in their EcR mRNA levels appeared to play an important role in regulating the molting process. The current experiment also showed that S. paramamosain early juveniles could withstand a broad range of temperatures and salinity, therefore highlighting their adaptability to the seasonal variation in salinity and temperature of natural habitat. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Crustaceans and other arthropods experience periodic molting during their lifetime. The primary function of ecdysteroids as the molting hormones is molting regulation. In addition to molting regulation, ecdysteroids are also known to be involved in the regulation of development and reproduction of crustaceans (Buckmann, 1989; Tarrant et al., 2011). Ecdysteroids have also been reported to participate in other biological processes, such as stress resistance, and affect behavior and

⁎ Correspondence to: H. Ye, College of Ocean and Earth Sciences, Xiamen University, Xiamen 361005, China. Tel.: +86 592 2185539. ⁎⁎ Correspondence to: C. Zeng, College of Marine and Environmental Sciences, James Cook University, Townsville, Queensland 4811, Australia. Tel.: +61 7 47816237. E-mail addresses: [email protected] (H. Ye), [email protected] (C. Zeng).

http://dx.doi.org/10.1016/j.jembe.2014.12.008 0022-0981/© 2014 Elsevier B.V. All rights reserved.

lifespan of arthropods (Schwedes and Carney, 2012). They also play important roles in responding to environmental stimuli. Hence, changes in both biotic and abiotic environmental conditions and stimuli can affect the ecdysteroid levels in an arthropod (LeBlanc, 2007). For example, high temperature and sleep deprivation enhanced the concentration of ecdysteroids in the fruit fly, Drosophila melanogaster (Ishimoto and Kitamoto, 2010). Similarly, when the courtship advances of an adult male D. melanogaster were rejected by females, the titers of ecdysteroids of the male also elevated (Ishimoto et al., 2009). In many species, nutritional shortage and starvation can also increase the ecdysteroid concentration and restrain ovarian maturation (Terashima et al., 2005). Ecdysteroid signaling also appears to be critical to the limb regeneration in crustaceans (Hopkins, 2001; Subramoniam, 2000). In the fiddler crab, Uca pugilator, when a seriously injured appendage was cast off (autotomy) at a predetermined point for the regeneration of a new limb,

12

J. Gong et al. / Journal of Experimental Marine Biology and Ecology 464 (2015) 11–17

ecdysteroids reportedly were directly involved in the whole limb regeneration process (Chung et al., 1998). Ecdysteroids need to bind to and activate the ecdysone receptor (EcR), which forms a functional heterodimer with the retinoid X receptor (RXR) to interact with DNA regulatory elements (Gaertner et al., 2012; Nakagawa and Henrich, 2009). In crustaceans, the regulation of molting by ecdysteroids is mediated by the EcR, and fluctuations in EcR expression are in general accordance with the titer of ecdysteroid hormones (Das and Durica, 2013; Shen et al., 2013). In D. melanogaster, mutations that inactivated EcR induced defects in larval molting during metamorphosis (Schubiger et al., 1998). Meanwhile, in limb buds of U. pugilator, the highest expression level of EcR occurred during the period of muscle protein synthesis (Hopkins, 2001). The concentration of EcR in the regenerating limb bud also increased during the transition time from intermolt to premolt stage of the molting cycle, which supported the hypothesis that the process was subjected to ecdysteroid regulation (Chung et al., 1998). It was also reported that in the hepatopancreas and muscle tissue of the freshwater prawn Macrobrachium nipponense and the kuruma shrimp Marsupenaeus japonicus, the EcR expression increased at the premolt stages when ecdysteroid synthesis was upregulated (Asazuma et al., 2007; Shen et al., 2013). Therefore, EcR plays an important role in the ecdysteroid signal pathway and is a key indicator for molting and limb regeneration regulation in crustaceans. Temperature, salinity, starvation and the loss of chelipeds can all affect survival, development and molting in crustaceans (Anger et al., 1981; Quinitio and Estepa, 2011; Ruscoe et al., 2004). Temperature is one of the most important environmental factors that influence physiology, behavior and distribution of marine organisms (McGaw and Whiteley, 2012; Ruscoe et al., 2004). Decapod crustaceans routinely experience seasonal, diel or short term changes in temperature and exhibit different physiological reactions depending on whether the temperature change experienced is acute or chronic (McGaw and Whiteley, 2012). Temperature is also known to exert a strong influence on the frequency of molting, which is regulated by ecdysteroids and its receptor, i.e. EcR (Bortolin et al., 2011). For example, in the mud crab Scylla paramamosain, the average larval development time from Zoea I to Zoea V at 30 °C was reportedly shortened by 7 days than at 25 °C while at a lower temperature of 15 °C, Zoea I larvae failed to molt (Zeng and Li, 1992). Salinity is another most important abiotic factor in aquaculture and many crustacean species have some degree of euryhalinity (Pequeux, 1995; Romano and Zeng, 2006). Optimal salinity levels for growth, survival and production efficiency are often species-specific. Furthermore, osmotic stress has been reported to elicit physiological responses (Romano and Zeng, 2006). For instance, high salinity (40) was reported to prolong the intermolt period of juveniles of another mud crab species Scylla olivacea (Jantrarotai et al., 2002). The mud crab S. paramamosain is a large portunid crab found along coasts of southern China and many Indo-Pacific countries. Because of its abundance, fast growth rate and high market acceptance, the species is considered as an important species for both fisheries and aquaculture in China (Ma et al., 2013; Ye et al., 2011). Previous researches have reported the effects of temperature, salinity and starvation on its larval survival and development (Wang et al., 1998; Zeng and Li, 1992; Zeng et al., 2004); however, little is known about their effects on early juveniles. More importantly, there appears to be no research to date investigating the expression of EcR gene in relation to the effects of temperature, salinity, starvation and autotomy on molting success and molting frequency of this commercially important crab species. To fill this knowledge gap and to provide guidelines for suitable culture conditions for S. paramamosain juveniles, the present study investigated the effects of the four factors on molting success and the molting interval of S. paramamosain early juveniles while the mRNA expression level of the inducible EcR gene was concurrently determined to help understand the underlying molecular regulation mechanisms.

2. Materials and methods 2.1. Source of juvenile crabs Healthy adult female S. paramamosain (carapace length: 9.0 ± 0.6 cm; body weight: 390 ± 45 g) were purchased from a commercial farm in Zhangzhou county, Fujian province, China. The crabs were disinfected in a potassium permanganate (50 ppm) bath for 15 min and transferred to two concrete tanks (L × W × D = 8 × 3 × 0.7 m) with half of the tank bottom covered by 10 cm sand as the substrate. The tanks were filled with sand filtered seawater and aerated continuously. The crabs were held under a 14 h L:10 h D photoperiod at salinity and temperature of 26–28 and 26–29 °C, respectively, and fed with live clam, Ruditapes philippinarum, at a ration of ~ 30% of the crab body weight per day. A daily 100% water exchange was carried out. When spawning of a female was found, it was disinfected again in potassium permanganate (50 ppm) bath for 10 min, and then transferred into a separate incubation tank without sand substrate. Every day, a 30% seawater exchange was conducted and any discarded eggs and feces were removed. Eggs took 12–13 days to hatch at 26–29 °C. At the time of hatching the color of the eggs turned dark grey and the berried female was transferred to a cement tank (L × W × D = 6 × 4 × 1.2 m). The newly hatched larvae were then cultured at a density of 100–120 larvae L − 1 and were fed rotifers Brachionus sp. first before their prey were switched to Artemia nauplii. The culture water was treated with 1–3 ppm streptomycin sulfate. The salinity and water temperature were maintained between 25 and 27 and 26 and 28 °C. A 15% daily water exchange was carried out for early larvae but was increased to 30% from Zoea III onward. Upon the larvae reaching megalopal stage (i.e. postlarval stage), about 5000 megalopae from the same batch of larvae were randomly collected and transferred to five 100 L containers. Nets were hanged inside these containers to reduce cannibalism of the megalopae by providing substrate and refuge. On-grown Artemia were fed ad libitum daily to the megalopae. Water temperature and salinity were kept at 26 ± 0.5 °C and 22 ± 1, respectively, and a daily water exchange of 50% was carried out every morning. To ensure that the first stage crabs (C1) used for the experiment were newly molted and very similar during their molting cycle, over the peak time of megalopae molting to C1, the culture vessels were checked at 00:00 am daily to remove any C1 crabs found, and then again at 06:00 am. Newly settled C1 crabs that had molted within the 6 h period 00:00–06:00 am were then collected for the experiment. For the autotomy experiment, C2 crabs were used and the procedure for collecting newly molted crabs was the same as for C1 crabs. 2.2. Temperature and salinity experiment For the temperature experiment, the newly molted C1 crabs were transferred to 5 temperature conditions of 14, 20, 26, 32 and 39 °C (±0.5 °C). The salinity experiment also had 5 treatments of 5, 10, 20, 30 and 40 (± 1). Each treatment was triplicated and each replicate consisted of 25 crabs individually cultured in round plastic culture vessels (diameter: 5 cm; height: 10 cm) to avoid cannibalism. For the temperature experiment, salinity was maintained at 22 ± 1 while for the salinity experiment, the temperature was maintained at 26 ± 0.5 °C. A 100% water exchange was carried out daily in the morning and after the water exchange, on-grown Artemia and chopped clams (R. philippinensis) were added ad libitum to each culture unit to feed the crabs. The survival and molts of the crabs were monitored and recorded daily. Both temperature and salinity experiments terminated when all C1 crabs had either molted or died. In addition to the 3 replicates for each treatment, an additional replicate consisting of 45 crabs under exactly the same conditions cultured for the RNA extraction. To measure the EcR mRNA level, sampling of C1 crabs for each treatment occurred at 0, 6, 12, 24, 48, and 72 h. This was


made on the basis that under normal culture conditions and up to a period of 72 h, newly molted C1 of S. paramamosain appeared to molt. Furthermore, under the 39 °C treatments, beyond 72 h sampling was virtually impossible due to high mortality. For each sample taken, three C1 crabs were randomly selected for RNA extraction and to determine the expression level of EcR gene (see 2.5).

13

2.6. Data treatment and statistical analysis Percentage molting success (i.e. survival) and the molting interval of each replicate in a treatment were calculated by: Molting success % = 100% × no. of C1 (C2 for autotomy experiment) successfully molted to C2 (C3 for autotomy experiment)/25 C1 (C2 for autotomy experiment) molting interval = (N1 × D1 + N2× D2. + .... + Nn × Dn) / (N1 + N2 + … + Nn)

2.3. Starvation experiment The newly molted C1 crabs were subjected to starvation while a feeding treatment in which on-grown Artemia and chopped clams were added ad libitum daily was also set up as the control. Throughout the experiment, temperature and salinity were maintained at 26 ± 0.5 °C and 22 ± 1, respectively. Other aspects of experiment design and procedure were consistent with the temperature and salinity experiment (see 2.2).

2.4. Autotomy experiment In this experiment, second stage crabs (C2) were used, since their bigger size allowed easier autotomy manipulation. There were two treatments: autotomy and untreated control. The autotomy of newly molted C2 crabs was induced by crushing one of the chelipeds at the merus using a pair of tweezers (Quinitio and Estepa, 2011). After the operation, the autotomized crabs were kept individually in round culture units under the same culture conditions as the starvation experiment (Section 2.3). Other aspects of experiment design and procedure were also the same as the starvation experiment except that three C2 crabs were further sampled at 96, 120, 134 h and 140 h.

where D1, D2…, Dn represent days from the commencement of an experiment with the first day of the experiment defined as Day 1 while N1, N2…, Nn are the number of crabs found molted on day 1, 2…, n, respectively. The data obtained on gene expression were calculated using 2−△△Ct as described by Livak and Schmittgen (2001) and then subjected to statistical analysis. One-way analysis of variance (ANOVA) was performed to determine statistical significance of the expression of EcR gene, percentage molting success and molting interval data of the temperature and salinity experiment. For the data obtained from the starvation and autotomy experiment, Student's t-test was used. Prior to ANOVA analysis, Kolmogorov– Smirnov and Cochran tests were performed to test the normality and homogeneity of variances of the data, respectively, and p b 0.05 were considered significant. All statistics were carried out on the SPSS software, version 16.0 (SPSS, Chicago, IL. USA).

3. Results 3.1. Temperature experiment

2.5. Expression of EcR gene Total RNA of each crab sample was extracted using the trizol reagent according to the manufacturer's instruction (Invitogen, USA) and then genomic contamination was eliminated by DNase I. The quality was determined by agarose gel electrophoresis and quantified with a ND-1000 NanoDrop UV spectrophotometer (NanoDrop technologies, Inc. USA). The RNA was reversely transcribed using the reversed first strand cDNA synthesis kit (Fermentas, USA) and stored at −20 °C. The level of EcR mRNA was detected by real-time quantitative PCR. The primers used for real-time quantitative PCR, EcR F and EcR R (Table 1), were designed based on the EcR cDNA sequence of S. paramamosain (GenBank accession no. JQ821372.1). The PCR was performed in a 20 μl reaction volume containing 10 μl of SYBR premix, 2 μl of cDNA template, 0.8 μl of each primer (10 μM) and 6.4 μl of PCRgrade water. The PCR conditions were as follows: 94 °C for 10 min; 40 cycles of 94 °C for 20 s, 56 °C for 30 s and 72 °C for 40 s. RNA was extracted from each of the three crabs sampled from a treatment with each sample performed in triplicate. A β-actin fragment of S. paramamosain amplified by two β-actin primers, β-actin F and β-actin R (Table 1), was used as the internal control. The negative control was performed with PCR-grade water for the replacement of cDNA template.

Table 1 Summary of primers used for profiling the expression of EcR gene in S. paramamosain early juveniles. Primer

Primer Sequence (5′-3′)

Purpose

EcR F EcR R β-actin F β-actin R

AAGAACAAAAGACTCCCACCATT TCTCTCACTTACAGCCGACAGG GAGCGAGAAATCGTTCGTGAC GGAAGGAAGGCTGGAAGAGAG

Real time quantitative PCR for EcR Real time quantitative PCR for EcR Internal control Internal control

Temperature was shown to significantly affect both the molting interval and molting success of S. paramamosain C1 juveniles (Table 2). All C1 crabs subjected to the high temperature of 39 °C died within 96 h and no crabs molted to C2. At the low temperature of 14 °C, crabs were inactive with substantially reduced food consumption and again, no molt was found during the experiment duration. For the temperature treatments of 20, 26 and 32 °C, molting success rates were all very high (86.7% to 94.7%) and no significant difference was detected among them (p N 0.05). On the contrary, the mean molt interval for the treatments were all significantly different from each other (p b 0.01), and in ascending order of interval duration 32 °C (3.8 ± 0.1 days), 26 °C (4.8 ± 0.1 days), 20 °C (9.3 ± 0.2 days) (Table 2). The result of real-time quantitative PCR demonstrated that at 6, 12, 24, and 72 h, EcR mRNA expression followed a clear trend, increasing with the water temperature from 14 °C to 32 °C, where a peak was reached. As the temperature rose further to 39 °C, it dropped abruptly to the lowest level. Statistical analysis revealed that at 72 h the C1 crabs kept at 32 °C showed a significantly higher level of EcR mRNA expression than the crabs of the other treatments (p b 0.05) while the mRNA level at the 26 °C treatment was also significantly higher than the 14, 20 and 39 °C treatments (Fig. 1).

Table 2 Percentage molting success and molting interval of C1 crabs of S. paramamosain kept under different temperatures. Values with different letters within a same column are significantly different (p b 0.05). Temperature

Percentage molting success (%)

Molting interval (days)

14 °C 20 °C 26 °C 32 °C 39 °C

0 86.7 ± 6.1a 94.7 ± 2.3a 90.7 ± 2.3a 0

– 9.3 ± 0.2a 4.8 ± 0.1b 3.8 ± 0.1c –

14


Fig. 1. EcR mRNA transcripts of S. paramamosain newly molted C1 juveniles kept at different temperatures. Expression of β-actin gene was used as the control. The relative abundance of EcR transcripts was presented as mean ± S.E. (N = 3). The dotted line shows the relative EcR mRNA expression level of newly molted C1 juveniles at 0 h prior to the start of the experiment. Values with different letters on the tops of bars are significantly different (p b 0.05).

3.2. Salinity experiment

3.4. Autotomy experiment

Except at salinity of 5, molting success rates of all salinity treatments were very high (N 96.0%) and no significant difference was detected among them (p N 0.05). At salinity of 5, the crabs had a molting success rate of only 74.7 ± 2.3%, which is significantly lower than other treatments (p b 0.01) (Table 3). Interestingly, while low salinity of 5 reduced survival, it significantly enhanced the development of molt as the mean molting interval of C1 crabs was significantly shorter than other treatments (p b 0.05), In contrast, high salinity of 40 did not negatively influence molting success, but it significantly delayed its development resulting in a much longer molting interval compared to other treatments (p b 0.01) (Table 3). The result of real-time quantitative PCR showed that at 72 h, the expression of EcR transcript of C1 crabs exposed to the salinity of 5 increased sharply, exceeding the results of other salinity treatments. The result also showed that at 6 and 12 h, the expression of EcR transcripts of the crabs kept under salinity of 30 was significantly higher than other treatments (p b 0.05), and at 72 h, no significant difference was found between salinities of 30 and 5 treatments. On the other hand, the lowest expression level was detected at the highest salinity of 40 from 12 h onwards, which was significantly lower than all other treatments (p b 0.05) (Fig. 2).

Interestingly, induced autotomy did not lead to higher mortality compared to the control. Both autotomy treatment and the control had high molting success of 98.7 ± 2.3% and 97.3 ± 2.3%, respectively (Table 4), but autotomy significantly increased the molting interval of C2 crabs (6.2 ± 0.1 days) compared to the control (5.8 ± 0.1 days) (p b 0.05) (Table 4). Based on real-time quantitative PCR, at up to a period of 120 h, autotomy led to an initially repressed EcR mRNA level compared to the intact control; the difference at 6, 12, 24 and 96 h was significant (p b 0.05). From 120 h onwards, the EcR mRNA level of the autotomized crabs increased and at 134 h when the majority of crabs were at premolt stage, the EcR mRNA level increased sharply to a level that was significantly higher than that of the control (p b 0.01). Subsequently, after successful molting, the EcR mRNA level of newly molted C3 (140 h) of the autotomy group dropped abruptly and was no more significantly different from that of the control (Fig. 4).

3.3. Starvation experiment None of the crabs subjected to starvation developed to C2 stage and mass mortality occurred from day 11 onwards, while crabs in the control molted normally with an average molting interval of 4.8 ± 0.1 days. The expression of EcR gene of the crabs subjected to starvation was initially not significantly different from the control, however, with the progress of starvation, the EcR mRNA expression showed a gradually decreasing trend and from 48 h onwards, was significantly lower than that of the control (p b 0.01) (Fig. 3).

Table 3 Percentage molting success and molting interval of C1 crabs of S. paramamosain kept under different salinities. Values with different superscript letters within a same column are significantly different (p b 0.05). Salinity 5 10 20 30 40

Percentage molting success (%) a

74.7 ± 2.3 96.0 ± 0.0b 96.0 ± 4.0b 97.3 ± 2.3b 97.3 ± 2.3b

Molting interval (days) 4.7 ± 0.1a 5.0 ± 0.2b 5.2 ± 0.1b 5.2 ± 0.1b 6.0 ± 0.1c

4. Discussion As early juvenile crabs commonly experience regular molting and rapid development and growth, this study has focused on the effect of various factors on the molting process of early juveniles of S. paramamosain and the underlying mechanisms. Although past studies on the molting regulation of crustaceans have commonly measured the level of ecdysteroids in the hemolymph, the early juvenile crabs (the average carapace length and wet weight of C1 crabs were only 3.9 ± 0.1 mm and 0.0142 ± 0.0003 g respectively) collected in the present study were too small to obtain enough hemolymph for ecdysteroid measurement. Consequently, it was necessary to identify an alternative method to investigate molting regulation in early juvenile mud crabs. Recent studies showed that in the freshwater prawn, M. nipponense (Asazuma et al., 2007) and the kuruma shrimp, M. japonicas (Shen et al., 2013), the level of EcR mRNA was positively correlated with the levels of ecdysteroids. Owing to developments in molecular biology techniques, the expression of EcR gene can be detected relatively easily utilizing real-time quantitative PCR, thus providing a quick and feasible alternative way for the study of molting regulation in crustaceans (Shen et al., 2013). Temperature is an important factor impacting survival and development of brachyuran crabs. It was reported that the optimal temperature range for larval culture of S. paramamosain was 26–30 °C, and Zoea I larvae were unable to molt to Zoea II when culture temperature was lower than 15 °C or higher than 35 °C (Zeng and Li, 1992). In the present study, C1 crabs also failed to molt when maintained at 14 °C or 39 °C, while


15

Fig. 2. EcR mRNA transcripts of S. paramamosain newly molted C1 juveniles kept at different salinities. Expression of β-actin gene was used as control. The relative abundance of EcR transcripts was presented as mean ± S.E. (N = 3). The dotted line shows the relative EcR mRNA expression level of newly molted C1 juveniles at 0 h prior to the start of the experiment. Values with different letters on the tops of bars are significantly different (p b 0.05).

molting occurred normally between 20 °C and 32 °C, and within this temperature range the molting interval decreased with increasing temperature. Correspondingly, as temperature rose, the expression level of EcR gene was found to increase and reached a peak at 32 °C, appearing to promote molting in early juvenile crabs. Hwang et al. (2010) reported that in the intertidal copepod, Tigriopus japonicus, heat shock protein 70 (HSP70) family response elements were detected in the 5′-promoter region of EcR gene. Similarly, Lee et al. (2008) found that extreme temperature or salinity affected the expression of corticotropin-releasing hormone binding protein (CRH-BP) gene by a HSP70 response element in the promoter region. Furthermore, in adult S. paramamosain, the expression of HSP70 gene was elevated by thermal stress at 36 °C (Yang et al., 2013). Therefore, a possible explanation of higher expression level of EcR gene found in S. paramamosain C1 juveniles subjected to 32 °C might be that the enhanced expression of the HSP70 gene induced by high temperature stress possibly resulted in transactivation of the EcR via HSP70 response elements. Moreover, in the Pacific abalone Haliotis discus hannai, it was reported that the expression of HSP70 gene was the highest at 26 °C but decreased significantly at 30 °C, which was a physiological limit for the abalone species (Cheng et al., 2006). Similarly, in the present study, all C1 crabs kept at 39 °C died without molting and detected the lowest expression of EcR gene, indicating such an extreme temperature was beyond the tolerant limit of the C1 crabs of S. paramamosain. High percentages of molting success (N96%) were found in C1 crabs exposed to a broad range of salinity from 10 to 40, indicating S. paramamosain early juveniles are euryhaline. Ruscoe et al. (2004) reported a broad tolerance to salinity of the juveniles of S. serrata, another

mud crab species, and suggested that such a feature made the species an attractive candidate for aquaculture. Outside this salinity range, for example at salinity of 5 the molting success rate was significantly lower (74.7%); however, the C1 molting interval was the shortest. In contrast, the molting interval at a high salinity of 40 significantly exceeded the interval of other treatments with the corresponding lowest expression level of EcR gene. The results suggested that while high salinity did not significantly affect molting success, it prolonged the molting process. The broad tolerance range of salinity supported the previous study, in which S. paramamosain was found to be the predominant mud crab species in an estuarine habitat with marked seasonal variation in salinity (Le Vay et al., 2001). Osmotic stress has been reported to play an important role in the inducing HSP family in aquatic animals (Yokoyama et al., 2006). For example, the expression levels of the HSP70 and HSP90 gene in the abdominal muscle of the American lobster, Homarus americanus, reportedly increased significantly under hyper- and hypo-salinity stress (Spees et al., 2002). As molecular chaperones, members of the HSP family assist in the folding of proteins, but HSP90 is also involved in expression of steroid hormone receptors (Buchner, 1999). In the present study, a significantly higher expression of EcR gene was detected at 72 h for C1 crabs exposed to low salinity of 5. The result indicated that salinity of 5 might induce the expression of HSP gene that subsequently enhanced the EcR mRNA level (Hwang et al., 2010). Moreover, it is likely the high EcR mRNA level promoted molting which resulted in the significantly shorter molting interval at this salinity. The results of the starvation experiment showed that, although survival remained relatively high during the first 10 days of fasting,

Fig. 3. Comparison of changes in EcR mRNA transcripts of S. paramamosain newly molted C1 juveniles subjected to starvation and under normal feeding condition. Expression of β-actin gene was used as control. The relative abundance of EcR transcripts was presented as mean ± S.E. (N = 3). The dotted line shows the relative EcR mRNA expression level of newly molted C1 juveniles at 0 h prior to the start of the experiment. The Asterisks (“*”) on the tops of bars indicates significant difference (p b 0.05).

16


Table 4 Percentage molting success and molting interval of S. paramamosain newly molted C2 crabs subjected to autotomy and from the intact control. Values with different superscript letters within a same column are significantly different (p b 0.05). Treatment Control Autotomy

Percentage molting success (%) a

97.3 ± 2.3 98.7 ± 2.3 a

Molting interval (days) 5.8 ± 0.1a 6.2 ± 0.1b

none of the starved C1 crabs molted to C2 stage. Thus providing evidence that sufficient nutrition is necessary for the normal development of animals, especially for small poikilotherm (Wieser, 1991). It is well known that for early larvae of brachyurans, even a very short period of starvation can significantly delay larval development and potentially lead to higher mortality (Anger et al., 1981). In the adult fruit fly D. melanogaster, it was reported that in response to starvation, an excessively high concentration of ecdysteroids was detected, and the high level of ecdysteroids activated by starvation induced the apoptosis and restrained the ovarian development (Terashima and Bownes, 2004; Terashima et al., 2005). In the current study, the expression level of EcR gene remained low in starved S. paramamosain C1 crabs, which differed from what was reported for adult Drosophila. This difference might be explained by the use of early juveniles with immature ovaries; hence, when subjected to starvation, the expression of EcR gene was repressed as a strategy to prolong the molting cycle and thereby increased the chance to encounter foods. In crustaceans, the limb autotomy often occurs when their appendages are severely injured (Chung et al., 1998). The autotomized limbs can regenerate, which represents a remarkable adaptation of crustaceans to limb injury (Hopkins, 2001). In this study, the autotomized chelipeds were found to regenerate after C2 crabs molted to C3. Interestingly, autotomy did not appear to affect molting success of C2 crabs but significantly prolonged the molting cycle. Generally, limb autotomy increases the duration of the molting interval as more time is needed to accumulate nutritional reserves for the generation of the new limb bud (Quinitio and Estepa, 2011). The new limb bud is encased in a soft cuticular sac and grows slowly prior to molting. During molting, following the shedding of the old exoskeleton, the limb bud unfolds and expands to the size only slightly smaller than the normal limb (Quinitio and Estepa, 2011). The expression level of EcR gene in the autotomized S. paramamosain C2 crabs increased sharply and peaked at 134 h (or 5.6 days); this appeared to coincide with the premolt stage of the majority of the autotomized C2 crabs since their mean molting interval was 6.2 ± 0.1 days. The ecdysteroids in crustaceans appeared not only responsible for the control of limb regeneration, but also increased the muscle protein synthesis rate during limb bud growth (Hopkins,

1993). Therefore, the substantially higher EcR mRNA level detected at 134 h in the autotomized crabs is likely related to the growth of the new limb. Meanwhile, prior to 120 h, the EcR mRNA levels of the autotomized crabs were generally lower than that of intact crabs, perhaps representing a mechanism prolonging the molting interval and allowing the autotomized crabs sufficient time to accumulate nutrients for the regeneration of the limb. After successful molting, the expression level of EcR gene of newly molted C3 crabs of both autotomized and intact crabs was found to have dropped sharply to very low levels, further supporting the link between molting and the EcR mRNA level in crustaceans. In summary, the present study demonstrated that temperature, salinity, starvation and autotomy could all affect the molting of S. paramamosain early juveniles. When juvenile crabs were subjected to different conditions, the shorter molting intervals were generally associated with higher EcR mRNA levels detected in the crabs. Conversely, a low percentage molting success and/or prolonged molting interval resulting from crabs being subjected to extreme temperature, high salinity and prolonged starvation, generally coincided with a low expression level of the EcR gene. Thus changes of the EcR mRNA level in S. paramamosain early juveniles appeared to underlie the molting regulation process. Finally, our results further concluded that S. paramamosain early juveniles are able to tolerate a broad range of temperatures and salinity.

Acknowledgment The authors would like to thank Dr. Nicholas Romano (native English speaker) and Mr. Eilenberger for the careful editing of this manuscript. This study was supported by grants from the Key Projects in the Science and Technology of Fujian Province, China (No. 2008N0040), the Natural Science Foundation of Fujian Province, China (No. 2012J01147) and the Innovative Research Funds of Xiamen University (No. 201112G009). [SS].

References Anger, K., Dawirs, R.R., Anger, V., Costlow, J.D., 1981. Effects of early starvation periods on zoeal development of brachyuran crabs. Biol. Bull. 161, 199–212. Asazuma, H., Nagata, S., Kono, M., Nagasawa, H., 2007. Molecular cloning and expression analysis of ecdysone receptor and retinoid X receptor from the kuruma prawn, Marsupenaeus japonicas. Comp. Biochem. Physiol. B 148, 139–150. Bortolin, F., Piulachs, M.D., Congiu, L., Fusco, G., 2011. Cloning and expression pattern of the ecdysone receptor and retinoid X receptor from the centipede Lithobius peregrinus (Chilopoda, Lithobiomorpha). Gen. Comp. Endocrinol. 174, 60–69. Buchner, J., 1999. HSP90 & Co.—a holding for folding. Trends Biochem Science 24, 136–141.

Fig. 4. Comparison of changes in EcR mRNA transcripts of S. paramamosain newly molted C2 juveniles subjected to autotomy and from the intact control. Note: The data of 140 h came from newly molted stage 3 crabs (C3). Expression of β-actin gene was used as control. The relative abundance of EcR transcripts was shown as mean ± S.E. (N = 3). The dotted line shows the relative EcR mRNA expression level of newly molted C2 juveniles at 0 h prior to the start of the experiment. The asterisks (“*”) on the tops of bars indicate significant difference (p b 0.05).

J. Gong et al. / Journal of Experimental Marine Biology and Ecology 464 (2015) 11–17 Buckmann, D., 1989. The significance of ecdysone in comparative physiology. In: Koolman, J. (Ed.), Ecdysone from Chemistry to Mode of Action. Thieme, Stuttgart, pp. 20–26. Cheng, P.Z., Li, X., Zhang, G.F., Deng, Y.E., 2006. Heat-shock protein70 gene expression in four hatchery Pacific abalone Haliotis discus hannai Ino populations using for marker-assisted selection. Aquac. Res. 37, 1290–1296. Chung, A.C.K., Durica, D.S., Hopkins, P.M., 1998. Tissue-specific patterns and steady-state concentrations of ecdysteroid receptor and retinoid-X-receptor mRNA during the molt cycle of the fiddler crab, Uca pugilator. Gen. Comp. Endocrinol. 109, 375–389. Das, S., Durica, D.S., 2013. Ecdysteroid receptor signaling disruption obstructs blastemal cell proliferation during limb regeneration in the fiddler crab, Uca pugilator. Mol. Cell. Endocrinol. 365, 249–259. Gaertner, K., Chandler, G.T., Quattro, J., Ferguson, P.L., Sabo-Attwood, T., 2012. Identification and expression of the ecdysone receptor in the harpacticoid copepod, Amphiascus tenuiremis, in response to fipronil. Ecotoxicol. Environ. Saf. 76, 39–45. Hopkins, P.M., 1993. Regeneration of walking legs in the fiddler crab, Uca pugilator. Am. Zool. 32, 450–458. Hopkins, P.M., 2001. Limb regeneration in the fiddler crab, Uca pugilator: hormonal and growth factor control. Am. Zool. 41, 389–398. Hwang, D.S., Lee, J.S., Lee, K.W., Rhee, J.S., Han, J., Lee, J., Park, G.S., Lee, Y.M., Lee, J.S., 2010. Cloning and expression of ecdysone receptor (EcR) from the intertidal copepod, Tigriopus japonicus. Comp. Biochem. Physiol. A 151, 303–312. Ishimoto, H., Kitamoto, T., 2010. The steroid molting hormone ecdysone regulates sleep in adult Drosophila melanogaster. Genetics 185, 269–281. Ishimoto, H., Sakai, T., Kitamoto, T., 2009. Ecdysone signaling regulates the formation of long-term courtship memory in adult Drosophila melanogaster. Proc. Natl. Acad. Sci. U. S. A. 106, 6381–6386. Jantrarotai, P., Taweechuer, K., Pripanapong, S., 2002. Salinity levels on survival rate and development of mud crab (Scylla olivacea) from zoea to megalopa and from megalopa to crab stage. Kasetsart J. 36, 278–284. Le Vay, L., Ngoc Ut, V., Jones, D.A., 2001. Seasonal abundance and recruitment in an estuarine population of mud crabs, Scylla paramamosain, in the Mekong Delta, Vietnam. Hydrobiologia 449, 231–240. LeBlanc, G., 2007. Crustacean endocrine toxicology: a review. Ecotoxicology 16, 61–81. Lee, K.W., Rhee, J.S., Raisuddin, S., Park, H.G., Lee, J.S., 2008. A corticotrophin releasing hormone binding protein (CRH-BP) gene from the intertidal copepod, Tigriopus japonicus. Gen. Comp. Endocrinol. 158, 54–60. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(− Delta Delta C (T)) method. Methods 25, 402–408. Ma, H.Y., Ma, C.Y., Ma, L.B., Xu, Z., Feng, N.N., Qiao, Z.G., 2013. Correlation of growthrelated traits and their effects on body weight of the mud crab (Scylla paramamosain). Genet. Mol. Res. 12 (4), 4127–4136. McGaw, I.J., Whiteley, N.M., 2012. Effects of acclimation and acute temperature change on specific dynamic action and gastric processing in the green shore crab, Carcinus maenas. J. Therm. Biol. 37, 570–578. Nakagawa, Y., Henrich, V., 2009. Arthropods nuclear receptors and their role in molting. FEBS J. 276, 6128–6157. Pequeux, A., 1995. Osmotic regulation in crustaceans. J. Crustac. Biol. 15, 1–60.

17

Quinitio, E.T., Estepa, F.D.P., 2011. Survival and growth of mud crab, Scylla serrata, juveniles subjected to removing or trimming of chelipeds. Aquaculture 318, 229–234. Romano, N., Zeng, C., 2006. The effects of salinity on the survival, growth and haemolymph osmolality of early juvenile blue swimmer crabs, Portunus pelagicus. Aquaculture 260, 151–162. Ruscoe, I.M., Shelley, C.C., Williams, G.R., 2004. The combined effects of temperature and salinity on growth and survival of juvenile mud crabs (Scylla serrata Forskal). Aquaculture 238, 239–247. Schubiger, M., Wade, A.A., Carney, G.E., Truman, J.W., Bender, M., 1998. Drosophila EcR-B ecdysone receptor isoforms are required for larval molting and for neuron remodeling during metamorphosis. Development 125, 2053–2062. Schwedes, C.C., Carney, G.E., 2012. Ecdysone signaling in adult Drosophila melanogaster. J. Insect Physiol. 58, 293–302. Shen, H.S., Zhou, X., Bai, A.X., Ren, X.F., Zhang, Y.P., 2013. Ecdysone receptor gene from the freshwater prawn Macrobrachium nipponense: identification of different splice variants and sexually dimorphic expression, fluctuation of expression in the molt cycle and effect of eyestalk ablation. Gen. Comp. Endocrinol. 193, 86–94. Spees, J.L., Chang, S.A., Snyder, M.J., Chang, E.S., 2002. Osmotic induction of stressresponsive gene expression in the lobster Homarus americanus. Biol. Bull. 203, 331–337. Subramoniam, T., 2000. Crustacean ecdysteroids in reproduction and embryogenesis. Comp. Biochem. Physiol. C 125, 135–156. Tarrant, A.M., Behrendt, L., Stegeman, J.J., Verslycke, T., 2011. Ecdysteroid receptor from the American lobster Homarus americanus: EcR/RXR isoform cloning and ligandbinding properties. Gen. Comp. Endocrinol. 173, 346–355. Terashima, J., Bownes, M., 2004. Translating available food into the number of eggs laid by Drosophila melanogaster. Genetics 167, 1711–1719. Terashima, J., Takaki1, K., Sakurai1, S., Bownes, M., 2005. Nutritional status affects 20-hydroxyecdysone concentration and progression of oogenesis in Drosophila melanogaster. J. Endocrinol. 187, 69–79. Wang, G.Z., Lin, S.J., Lin, Q.W., Li, S.J., Zeng, C.S., 1998. Effects of salinity on survival and development of the mud crab, Scylla Paramamosain. J. Fish. China 22, 89–92. Wieser, W., 1991. Limitations of energy acquisition and energy use in small poikilotherms: evolutionary implications. Funct. Ecol. 5, 234–240. Yang, Y.N., Ye, H.H., Huang, H.Y., Li, S.J., Liu, X.L., Zeng, X.L., Gong, J., 2013. Expression of Hsp70 in the mud crab, Scylla paramamosain in response to bacterial, osmotic, and thermal stress. Cell Stress Chaperones 18, 475–482. Ye, H.H., Tao, Y., Wang, G.Z., Lin, Q.W., Chen, X.L., Li, S.J., 2011. Experimental nursery culture of the mud crab Scylla paramamosain (Estampador) in China. Aquac. Int. 19, 313–321. Yokoyama, S., Koshio, S., Takakura, N., Oshida, K., Ishikawa, M., Gallardo-Cigarro, F., 2006. Effect of dietary bovine lactoferrin on growth response, tolerance to air exposure and low salinity stress conditions in orange spotted grouper Epinephelus coioides. Aquaculture 255, 507–513. Zeng, C.S., Li, S.J., 1992. Effects of temperature on survival and development of the larvae of Scylla Paramamosain. J. Fish. China 16, 213–221. Zeng, C.S., Li, S.J., Zeng, H., 2004. Occurrence of additional Zoea-VI larvae in the mud crab, Scylla paramamosain (Estampador), reared in the laboratory. Hydrobiologia 529, 49–58.