Synthetases1. David W. Jiang,* Roxann Ingersoll,â Peter J. Myler,â¡ and Paul T. Englund* .... gift from John Donelson (University of Iowa), and the procyclic form.
Experimental Parasitology 96, 16–22 (2000) doi:10.1006/expr.2000.4547, available online at http://www.idealibrary.com on
Trypanosoma brucei: Four Tandemly Linked Genes for Fatty Acyl-CoA Synthetases1
David W. Jiang,* Roxann Ingersoll,† Peter J. Myler,‡ and Paul T. Englund* *Department of Biological Chemistry, †DNA Analysis Facility, Johns Hopkins Medical School, Baltimore, Maryland 21205, U.S.A.; and ‡Seattle Biomedical Research Institute, Seattle, Washington 98109, U.S.A.
Jiang, D. W., Ingersoll, R., Myler, P. J., and Englund, P. T. 2000. Trypanosoma brucei: Four tandemly linked fatty acyl-CoA synthetases. Experimental Parasitology 96, 16–22. We have cloned four acyl CoA synthetase (ACS) genes from Trypanosoma brucei strain 927. Each of these genes encodes a polypeptide about 78 kDa in size and all four contain the “ACS signature motif.” Sequence alignments indicate that these proteins are 46%–95% identical in amino acid sequence. Interestingly, three of them share almost identical C-termini (about 215 amino acid residues). Southern blots suggest that these genes are present in a single copy, and Northern blots reveal that all four are expressed in both bloodstream and procyclic trypanosomes. q 2000 Academic Press Index Descriptors and Abbreviations: Trypanosoma brucei; trypanosomatidae; glycosyl phosphatidylinositol (GPI); variant surface glycoprotein (VSG); acyl-CoA synthetase (ACS, EC 6.2.1.3); Trypanosoma brucei acyl CoA synthetase 1, 2, 3, and 4 (TbACS1, TbACS2, TbACS3, and TbACS4); expressed sequence tag (EST); polymerase chain reaction (PCR); Leishmania major acyl CoA synthetase (LCFACAS); base pairs (bp); open reading frame (ORF); sodium dodecyl sulfate (SDS).
unusual in that it contains two myristates, a 14-carbon saturated fatty acid (Ferguson et al. 1985). Although the biological significance of GPI myristoylation is not yet known, there is considerable knowledge about how this fatty acid is incorporated. Myristate is incorporated into the GPI precursor by fatty acid remodeling reactions, involving deacylation and reacylation, using myristoyl-CoA as the fatty acid donor (Masterson et al. 1990). The trypanosome needs massive amounts of myristate to anchor all of its VSG molecules. Since there are only relatively low concentrations of this fatty acid in either the mammalian bloodstream or the parasite cell itself (except for that already incorporated into VSG), the trypanosome has presumably evolved special mechanisms to ensure its supply of myristate. Therefore, the trypanosome’s metabolism of myristate is of considerable interest. A key enzyme in processing myristate for incorporation into GPIs is the ACS that makes the myristoyl-CoA substrate for GPI remodeling. The two-step reaction catalyzed by the ACS is Mg21
Fatty acid 1 ATP i Fatty acyl-AMP 1 PPi
INTRODUCTION
Fatty acyl-AMP 1 CoA i Fatty acyl-CoA 1 AMP. See Watkins (1997) for a review of fatty acyl-CoA synthetases. In other cells acyl-CoAs function in several pathways, including energy production, membrane biogenesis, and fat deposition. Because of their multiple functions most cell types have several different ACSs that presumably are involved in different metabolic pathways and have different
Trypanosoma brucei is the causative agent of African sleeping sickness. Its surface coat is composed of 107 identical molecules of a GPI-anchored VSG. This GPI anchor is 1
Nucleotide sequence data reported in this paper are available in GenBank under Accession No. AF208112.
16
0014-4894/00 $35.00 Copyright q 2000 by Academic Press All rights of reproduction in any form reserved.
17
T. brucei ACS GENES
FIG. 1. Genomic organization of TbACS genes. The map represents 17,609 bp of sequenced T. brucei 927 genomic DNA. Open arrows indicate ACS genes, and ORF is an unidentified open reading frame. A box marked GT indicates the location of the 23 GT repeats. Regions 1 and 2 are repetitive sequences which are about 97% identical to each other. Short horizontal bars (labeled a–d) under the map are gene-specific oligonucleotide probes used for the Northern blots in Fig. 4. Long horizontal bars (labeled e–h) represent probes, constructed by PCR, used for the Southern blot in Fig. 3. B, BamHI; E, EcoRI; H, HindIII; S, ScaI. The figure is drawn to scale except for the box showing GT repeats and the oligonucleotide probes (a–d), which are each only about 30 nucleotides.
intracellular locations. To date, 5 ACS genes have been sequenced from human (Malhotra et al. 1999), 5 from rat (Oikawa et al. 1998), 4 from Saccharomyces cerevesiae (Johnson et al. 1994), 36 from Mycobacterium tuberculosis (Cole et al. 1998), and 1 from Escherichia coli (Black et al. 1992). Leishmania major parasite, related to the trypanosomes, has 6 candidate ACS genes that have been revealed by genome sequencing (5 are on chromosome 1 (Myler et al. 1999) and 1 is on chromosome 3 (unpublished results)). With a long-term goal of investigating their role in metabolism of myristate, we decided to investigate the ACS repertoire in T. brucei. We report the sequences of four tandemly linked ACS genes and demonstrate their expression in both bloodstream and procyclic trypanosomes.
W06539) was a gift from Phelix Majiwa (ILRI, Nairobi). Hybridization was detected by autoradiography. Sequencing and sequence analysis. All the subcloned recombinant fragments in pBluescript II (SK) vectors (Stratagene) were sequenced using an ABI PRISM 377 DNA sequencer (Perkin–Elmer) in the Johns Hopkins Synthesis and Sequencing Facility or the Johns Hopkins DNA Analysis Facility. Each sequence was confirmed on both strands and sequences at the junctions between subcloned fragments were confirmed by sequencing directly from the P1 DNA. P1 DNA was prepared using the Qiagen Plasmid Midi Kit protocol. The sequence of the 5D7 P1 clone was confirmed at the Seattle Biomedical Research Institute by random shotgun sequencing. (Myler et al. 1999). Sequence analysis was performed using Sequencher (Version 3.0, Gene Codes Corp.) and Lasergene (Version 3.0, DNASTAR, Inc.)
RESULTS
MATERIALS AND METHODS
Trypanosomes. The T. brucei strain 927 bloodstream form was a gift from John Donelson (University of Iowa), and the procyclic form was a gift from Elisabetta Ullu (Yale University). The procyclic forms were grown at 278C in SDM79 medium (containing 10% fetal bovine serum) (Brun and Schonenberger 1979) and harvested at 5 3 106 cells/ ml. Bloodstream forms were harvested from infected, lethally irradiated (1000 rad) male rats at a parasitemia of 5 3 108 cells/ml. The bloodstream trypanosomes were purified from host blood cells by DE52 chromatography (Lanham et al. 1970). Screening of genomic library. The bacteriophage P1 library of T. brucei 927 genomic fragments on a high-density filter (http://parsun1. path.cam.ac.uk/libs-2.htm) was provided by Sara Melville (Cambridge University). The library filter was hybridized at high stringency with a radiolabeled PstI-digested plasmid containing a T. brucei EST encoding a candidate ACS gene. The plasmid (EST T2367, Accession No.
Cloning the TbACS genes. Using a Leishmania ACS sequence to search for homologous sequences in the T. brucei EST database (http://www2.ebi.ac.uk/blast2/parasites.html), we found a candidate sequence (EST T2367) and constructed a probe to screen a P1 genomic DNA library. We identified three positive P1 clones: 5D7, 9H6, and 17D7. Multiple restriction digestions and limited sequencing suggested that these were overlapping clones. We focused further attention on the 5D7 clone, the smallest of the three, subjecting it to BamHI digestion and Southern hybridization analysis. The largest fragment (16 kb) was from the vector, and there were six smaller fragments derived from the ,34-kb insert. Three of the BamHI fragments (10, 8.2, and 1.8 kb) hybridized to the probe. We then digested the 10- and 8.2-kb fragments with HindIII and subcloned these digestion products as well as the 1.8-kb BamHI fragment into the pBluescript vector.
18
JIANG ET AL.
FIG. 2. (a) Alignment of TbACS protein sequences. Darkened areas denote identical amino acids. The underlined sequence denotes the ACS signature motif. Alignments were constructed using MegAlign software (DNASTAR, Inc.). (b) Alignment of trypanosome ACS signature motifs for TbACS1–4. Asterisks indicate positions of the eight conserved amino acids in the ACS signature motif (Black et al. 1997). Identical residues are indicated by black boxes.
19
T. brucei ACS GENES
FIG. 2.—Continued
Genomic organization of the TbACS genes. Using these clones we sequenced 17,609 bp which contained four open reading frames in the same direction with sequences related to ACSs (see map in Fig. 1 and aligned ACS protein sequences in Fig. 2). Downstream of the ACS genes is an unidentified ORF encoding a 371-residue polypeptide that has no significant homology to any known protein (Fig. 1). We have no evidence that it is a functional gene. As shown in Fig. 1, the four ACS genes reside in a region of 12.6 kb. Each gene is about 2.1 kb and the intergenic regions are all about 1.4 kb. An interesting feature of this region is the presence of 2 overlapping 4.1-kb repeats, designated on Fig. 1 as regions 1 and 2, which are 97% identical to each other. These repeats span all or part of the genes for TbACS2, 3, and 4. Region 1 ends 9 bp downstream of TbACS3, and Region 2 ends 9 bp downstream of TbACS4. As a result of these repeats, 643 bp at the 38 ends of TbACS2, 3, and 4 are nearly identical to each other. Furthermore, immediately downstream of region 2 is a sequence of 23 GT repeats (Fig. 1). Four encoded TbACS proteins. All four trypanosome ACS proteins are about 78 kDa. Predicted pI values range between 6.3 and 7.1. Sequence alignments indicate that these proteins are homologous (Fig. 2a), with 46–95% identity in amino acid sequence. The genes have 53–96% identity in nucleotide sequence. Because of the Region 1 and 2 repeats (Fig. 1), TbACS3 and 4 are highly homologous, and the C-terminal regions of TbACS2, 3, and 4 are also highly homologous (Fig. 2a). TbACS1 and 4 are the least similar. Are there other TbACS genes? As one approach to this question we compared Southern blots of digests of genomic DNA with those of the 5D7 P1 clone using a mixture of the four full-length ACS genes as probes (the locations of probes e, f, g, and h are indicated in Fig. 1). Using hybridization and wash conditions of slightly less than maximum stringency, we detected the same hybridizing pattern in both digests (Fig. 3), and all of the hybridizing bands are predicted from the map in Fig. 1. Therefore, these data give no indication of additional ACS genes elsewhere in the genome, although they do provide evidence that each of the four genes is present in a single copy. However, when we searched for
ACS-related sequences in the database of random genomic sequences from T. brucei 927 (http://www.tigr.org/tdb/mdb/ tbdb/index.html), we found ACS-like sequences in addition to those derived from TbACS1–4. Therefore, the T. brucei genome may contain one or more additional ACS genes. Expression pattern of TbACS genes. To evaluate the expression of each ACS gene in bloodstream and procyclic
FIG. 3. Southern analysis of T. brucei procyclic genomic DNA (6 mg, prepared by the Qiagen DNA Midiprep protocol) and 5D7 P1 clone (25 ng, extracted using the Qiagen Plasmid Midi Kit). Double digests with BamHI (B), HindIII (H), or EcoRI (E) were resolved on a 0.6% agarose gel, transferred to a Hybond N nylon membrane (Amersham Pharmacia Biotech), and probed with a mixture of 32Plabeled random primed probes corresponding to approximately fulllength sequences of the four TbACS genes (see map in Fig. 1 for location of probes). The DNA probes were made by PCR. Final wash conditions for the filter were 0.13 SSC containing 0.1% SDS at 608C. G, genomic DNA; P1, 5D7 P1 DNA.
20 trypanosomes, we performed a Northern blot on total RNA from both parasite forms. Because of the high homology of the four gene sequences, we had to use short 32P end-labeled synthetic oligonucleotides as gene-specific probes (a–d in Fig. 1). We confirmed the gene specificity using a Southern blot of P1 5D7 DNA digested with HindIII and ScaI, in which each oligoprobe hybridized to a different fragment, as predicted by the map in Fig. 1 (data not shown). As shown in Fig. 4, we found that all four genes are constitutively expressed in both life cycle stages, producing transcripts of about 3.1 or 3.6 kb. In three cases (TbACS1, 2, and 4), expression is higher in procyclic forms.
JIANG ET AL.
DISCUSSION
We have cloned four ACS genes in T. brucei 927 that are designated TbACS1–4.2 All four of these genes are expressed in both bloodstream and procyclic parasites, although in some cases at different levels (Fig. 4). All four genes encode 2
After this work was completed we learned that the same sequence had been determined independently by TIGR as part of the T. brucei genome project. We thank Najib El-Sayed for sharing this information with us.
FIG. 4. Northern blots on total RNA (4 mg) from bloodstream and procyclic trypanosomes using gene-specific oligonucleotides as probes (see map in Fig. 1 for location of probes a–d). Total RNA from trypanosome bloodstream (b.s.) or procyclic (p.) strain 927 were made using the Qiagen RNeasy Midi Kit. RNA was run on a 1.5% formaldehyde agarose gel and transferred to a Hybond N nylon membrane. Hybridization was carried out using Quikhyb (Stratagene) and final wash conditions for the filter were 0.13 SSC and 0.1% SDS at 638C. The 58 32P-labeled probes were TbACS1, 58-ACAGTTTTCGCCCTCCGCTGGTCCACAAA; TbACS2, 58-CATATTCTCCGTTTCTGTCTGTGGAATCGC; TbACS3, 58CGCAGTATGTTTCCCCTTTAACATGGCAA; TbACS4, 58-ACAGGTAAGTTTCTCCATCCCGCAACGGT. The bottom panels are loading controls, showing rRNA species in the same gel stained with ethidium bromide.
21
T. brucei ACS GENES
active enzymes when expressed as recombinant proteins in E. coli (preliminary studies, not shown). It is not surprising that all four proteins contain an ACS signature motif (part of the active site that controls fatty acid binding specificity) (Fig. 2b) (Black et al. 1997). The TbACS2 and 4 motifs are identical. It is interesting that all four T. brucei ACSs match seven of eight conserved amino acids, and all have a Gly substitution for Asp in the consensus signature motif (position 22 in the sequences shown in Fig. 2b). Previous mutagenesis studies show that conversion of that Asp residue to Ala does not inactivate the enzyme but instead alters the specificity for fatty acid chain length (Black et al. 1997). Multiple sequence alignments reveal that all four TbACS gene products share significant homology (43 to 53% identity) with the products of five of the six L. major ACS sequences. The sixth L. major gene product, of gene LCFACAS5, is an unconventional protein that is about twice the molecular weight of other ACS proteins (Myler et al. 1999); it has only about a 32–35% identity with the products of the other ACS genes in either L. major or T. brucei. Identities among the products of the five conventional L. major ACS genes ranged from 48 to 67%. It is interesting that although T. brucei and L. major have very similar genomic organization, with multiple genes linked in tandem, the two most similar genes in T. brucei have 96% identity, whereas the two most similar from L. major have only 68%. The high homology within T. brucei suggests a gene duplication that must have occurred after Trypanosoma diverged from Leishmania. The position of the sequence duplication in the T. brucei sequence (regions 1 and 2, Fig. 1) suggests that the T. brucei genome initially contained only TbACS1, 2, and 4, with the 38 ends of TbACS2 and 4 being homologous. Recombination within these 38 ends could have given rise to the current configuration of four TbACS genes. The availability of the four TbACS gene sequences opens the possibility for studying the function of these genes in T. brucei fatty acid metabolism. Our laboratory’s interest focuses specifically on the metabolism of myristate. Our plans are to study the fatty acid specificity of each of the four recombinant proteins, to localize the gene products within the cell, and to study the function of each gene using genetic techniques.
for their help, and Jodie Franklin and Jennifer Meyers for sequencing the subcloned fragments. This study was supported by NIH Grant AI21334.
ACKNOWLEDGMENTS
Myler, P. J., Audleman, L., deVos, T., Hixson, G., Kiser, P., Lemley, C., Magness, C., Rickel, E., Sisk, E., Sunkin, S., Swartzell, S., Westlake, T., Bastien, P., Fu, G., Ivens, A., and Stuart, K. 1999. Leishmania major Friedlin chromosome 1 has an unusual distribution of protein-coding genes. Proceedings of the National Academy of Sciences USA 96, 2902–2906.
We thank Drs. Paul Watkins, Theresa Shapiro, Kim Paul, and Yasu Morita for critically reviewing the paper, Mark Drew and Viiu Klein
REFERENCES
Black, P. N., DiRusso, C. C., Metzger, A. K., and Heimert, T. L. 1992. Cloning, sequencing, and expression of the fadD gene of Escherichia coli encoding acyl coenzyme A synthetase. Journal of Biological Chemistry 267, 25513–25520. Black, P. N., Zhang, Q., Weimar, J. D., and DiRusso, C. C. 1997. Mutational analysis of a fatty acyl-coenzyme A synthetase signature motif identifies seven amino acid residues that modulate fatty acid substrate specificity. Journal of Biological Chemistry 272, 4896– 4903. Brun, R., and Schonenberger, M. 1979. Cultivation and in vitro cloning of procyclic culture forms of Trypanosoma brucei in a semi-defined medium. Acta Tropica 36, 289–292. Cole, S. T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., Gordon, S. V., Eiglmeier, K., Gas, S., Barry, C. E., 3rd, Tekaia, F., Badcock, K., Basham, D., Brown, D., Chillingworth, T., Connor, R., Davies, R., Devlin, K., Feltwell, T., Gentles, S., Hamlin, N., Holroyd, S., Hornsby, T., Jagels, K., Barrell, B. G., et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393, 537–544. Ferguson, M. A. J., Low, M. G., and Cross, G. A. M. 1985. Glycosylsn-1,2-dimyristylphosphatidylinositol is covalently linked to Trypanosoma brucei variant surface glycoprotein. Journal of Biological Chemistry 260, 14547–14555. Johnson, D. R., Knoll, L. J., Levin, D. E., and Gordon, J. I. 1994. Saccharomyces cerevisiae contains four fatty acid activation (FAA) genes: An assessment of their role in regulating protein N-myristoylation and cellular lipid metabolism. Journal of Cell Biology 127, 751–762. Lanham, S. M., and Godfrey, D. G. 1970. Isolation of salivarian trypanosomes from man and other mammals using DEAE–cellulose. Experimental Parasitology 28, 521–534. Malhotra, K. T., Malhotra, K., Lubin, B. H., and Kuypers, F. A. 1999. Identification and molecular characterization of acyl-CoA synthetase in human erythrocytes and erythroid precursors. Biochemical Journal 344, 135–143. Masterson, W. J., Raper, J., Doering, T. L., Hart, G. W., and Englund, P. T. 1990. Fatty acid remodeling: A novel reaction sequence in the biosynthesis of trypanosome glycosyl phosphatidylinositol membrane anchors. Cell 62, 73–80.
22 Oikawa, E., Iijima, H., Suzuki, T., Sasano, H., Sato, H., Kamataki, A., Nagura, H., Kang, M. J., Fujino, T., Suzuki, H., and Yamamoto, T. T. 1998. A novel acyl-CoA synthetase, ACS5, expressed in intestinal epithelial cells and proliferating preadipocytes. Journal of Biochemistry 124, 679–685.
JIANG ET AL.
Watkins, P. A. 1997. Fatty acid activation. Progress in Lipid Research 36, 55–83. Received 28 March 2000; accepted with revision 13 July 2000
