FGF-Dependent Mechanosensory Organ Patterning in Zebrafish Alex Nechiporuk, et al. Science 320, 1774 (2008); DOI: 10.1126/science.1156547 The following resources related to this article are available online at www.sciencemag.org (this information is current as of June 27, 2008 ):
Supporting Online Material can be found at: http://www.sciencemag.org/cgi/content/full/320/5884/1774/DC1 This article cites 21 articles, 6 of which can be accessed for free: http://www.sciencemag.org/cgi/content/full/320/5884/1774#otherarticles This article appears in the following subject collections: Development http://www.sciencemag.org/cgi/collection/development Information about obtaining reprints of this article or about obtaining permission to reproduce this article in whole or in part can be found at: http://www.sciencemag.org/about/permissions.dtl
Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by the American Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. Copyright 2008 by the American Association for the Advancement of Science; all rights reserved. The title Science is a registered trademark of AAAS.
Downloaded from www.sciencemag.org on June 27, 2008
Updated information and services, including high-resolution figures, can be found in the online version of this article at: http://www.sciencemag.org/cgi/content/full/320/5884/1774
REPORTS outer (extra-embryonic) lineages (23). Rho GTPases are required for compaction (25), but how Rho activity is controlled has not been established.
10. 11. 12. 13. 14.
References and Notes 1. M. H. Johnson, J. M. McConnell, Semin. Cell Dev. Biol. 15, 583 (2004). 2. J. Nance, E. M. Munro, J. R. Priess, Development 130, 5339 (2003). 3. J.-Y. Lee, B. Goldstein, Development 130, 307 (2003). 4. B. Etemad-Moghadam, S. Guo, K. J. Kemphues, Cell 83, 743 (1995). 5. T. J. Hung, K. J. Kemphues, Development 126, 127 (1999). 6. J. Nance, J. R. Priess, Development 129, 387 (2002). 7. R. Totong, A. Achilleos, J. Nance, Development 134, 1259 (2007). 8. Materials and methods are available as supporting material on Science Online. 9. J. Y. Lee et al., Curr. Biol. 16, 1986 (2006).
15. 16. 17. 18. 19. 20. 21. 22. 23. 24.
S. Etienne-Manneville, A. Hall, Nature 420, 629 (2002). T. Dubois et al., Nat. Cell Biol. 7, 353 (2005). S. Sousa et al., Nat. Cell Biol. 7, 954 (2005). S. Kumari, S. Mayor, Nat. Cell Biol. 10, 30 (2008). K. J. Reese, M. A. Dunn, J. A. Waddle, G. Seydoux, Mol. Cell 6, 445 (2000). M. F. Maduro, M. D. Meneghini, B. Bowerman, G. Broitman-Maduro, J. H. Rothman, Mol. Cell 7, 475 (2001). W. Chen, J. Blanc, L. Lim, J. Biol. Chem. 269, 820 (1994). D. Aceto, M. Beers, K. J. Kemphues, Dev. Biol. 299, 386 (2006). M. Gotta, M. C. Abraham, J. Ahringer, Curr. Biol. 11, 482 (2001). A. J. Kay, C. P. Hunter, Curr. Biol. 11, 474 (2001). F. Motegi, A. Sugimoto, Nat. Cell Biol. 8, 978 (2006). S. Schonegg, A. A. Hyman, Development 133, 3507 (2006). N. Jenkins, J. R. Saam, S. E. Mango, Science 313, 1298 (2006). B. Plusa et al., J. Cell Sci. 118, 505 (2005). S. Vinot et al., Dev. Biol. 282, 307 (2005).
FGF-Dependent Mechanosensory Organ Patterning in Zebrafish Alex Nechiporuk*† and David W. Raible† During development, organ primordia reorganize to form repeated functional units. In zebrafish (Danio rerio), mechanosensory organs called neuromasts are deposited at regular intervals by the migrating posterior lateral line (pLL) primordium. The pLL primordium is organized into polarized rosettes representing proto-neuromasts, each with a central atoh1a-positive focus of mechanosensory precursors. We show that rosettes form cyclically from a progenitor pool at the leading zone of the primordium as neuromasts are deposited from the trailing region. fgf3/10 signals localized to the leading zone are required for rosette formation, atoh1a expression, and primordium migration. We propose that the fibroblast growth factor (FGF) source controls primordium organization, which, in turn, regulates the periodicity of neuromast deposition. This previously unrecognized mechanism may be applicable to understanding segmentation and morphogenesis in other organ systems. rimordia segmentation into reiterated structures occurs in the development of such diverse structures as photoreceptor ommatidia in the Drosophila compound eye and segregation of vertebrate paraxial mesoderm into somites. We describe the organization and regulation of segmentation in the zebrafish lateral line, where mechanosensory organs—called neuromasts—form in discrete clusters along the trunk. This pattern is produced by repeated segmentation of the pLL primordium, which migrates along the trunk, depositing 20 to 30 cells at regular (five-to-seven somite) intervals (1). Although the lateral line is an emerging system for the study of collective migration, mechanosensory hair cell development, and hair cell regeneration, the regulation of its initial development and cyclic segmentation is unknown. The migrating pLL primordium is organized into rosettes, each corresponding to a protoneuromast (1). Cells within each rosette have
P
distinct polarity, with apical ends centrally constricted and nuclei basally localized. We analyzed the relationships between rosette addition, pri-
*Present address: Oregon Health and Science University School of Medicine, Department of Cell and Developmental Biology, Portland, OR 97239, USA. †To whom correspondence should be addressed. E-mail:
[email protected] (A.N.);
[email protected] (D.W.R.)
27 JUNE 2008
Supporting Online Material www.sciencemag.org/cgi/content/full/320/5884/1771/DC1 Materials and Methods Figs. S1 to S8 Tables S1 and S2 Movies S1 and S2 References 4 February 2008; accepted 29 May 2008 10.1126/science.1156063
mordium migration, and neuromast deposition by time-lapse imaging. The pLL primordium is first recognized as a group of cells caudal to the otic vesicle with a single anteriorly positioned rosette (Fig. 1A). Over the next few hours, additional rosettes are sequentially added to the posterior, toward the future primordium leading edge (Fig. 1, A to D, and movie S1). Migration begins once two to three rosettes have formed, and the onset of neuromast deposition correlates with formation of the fourth rosette in the leading zone. During deposition, the trailing protoneuromast gradually slows down before coming to a complete stop (movie S2). Over the course of migration, the primordium exhibits a cyclical behavior with a new rosette generated near the leading (posterior) zone soon after a proto-neuromast separates from the trailing (anterior) edge, alternating from three to four proto-neuromast rosettes (Fig. 1, E and F, and movie S2). This cyclical behavior produces five to six primary neuromasts
Fig. 1. Rosettes are renewed from the leading-edge progenitor zone. (A to F) Lateral views of the pLL primordium in a single confocal plane in Tg(Bactin:HRAS-EGFP) fish (20) (right) and corresponding schematic representation (left). One rostral rosette [arrowhead, (A)] is formed at 19 hpf, and three more rosettes [arrowheads, (B) to (D)] are sequentially added between 19 and 25 hpf (see movie S1). Neuromast deposition begins once the primordium is organized into four rosettes [(D) and (E)]; a new rosette is then organized from the leading end (F). (G) Single confocal plane of the primordium leading zone at 24 hpf immediately after photoconversion of green Kaede protein to red (arrow). (H and I) Single confocal planes of the L5 neuromast (H) and terminal cluster (I) from the embryo shown in (G) at 54 hpf. Differential labeling possibly reflects different proliferation rates and/or differential origin. s, somite; L1 to L5, trunk neuromasts. Scale bar in (A), 50 mm.
University of Washington, School of Medicine, Department of Biological Structure, Seattle, WA 98195–7420, USA.
1774
25. L. Clayton, A. Hall, M. H. Johnson, Dev. Biol. 205, 322 (1999). 26. We thank A. Hyman, K. Kemphues, and G. Seydoux for reagents. Some antibodies and strains were obtained from the Developmental Studies Hybridoma Bank and the Caenorhabditis Genetics Center. We thank G. Fishell, M. Rosenberg, and Nance laboratory members for comments. Funding was provided by NIH [T32HD07520 (D.C.A.) and R01GM078341 (J.N.)] and the Edward Mallinckrodt, Jr. Foundation (J.N.). pac-1 GenBank accession: EU752496.
VOL 320
SCIENCE
www.sciencemag.org
REPORTS [named L1 to L6, following the convention in (2)] deposited along the trunk and a terminal cluster of two to three neuromasts at the end of the tail. We reasoned that if leading-edge cells act as a progenitor zone, then they should contribute to new neuromasts once already-formed proto-neuromasts are deposited. Following cell fates by photoconversion of Kaede protein (3, 4) confirmed this hypothesis (Fig. 1G). In a majority of embryos (77%, n = 17), the labeling of leading cells, after two to three rosettes had formed, resulted in labeled cells only in L3 to L6 neuromasts and the terminal cluster (Fig. 1, H and I, and table S1). In every case, almost all cells within neuromasts were labeled (Fig. 1H), indicating that a small number of cells act as a progenitor zone. FGFs regulate cellular morphogenesis in many systems (5, 6). Using the FGF receptor (Fgfr) inhibitor SU5402 (7) or an inducible dominantnegative Fgfr1 transgenic strain hsp70:dn-fgfr1 (8), we found that FGF signaling is necessary for rosette formation, neuromast deposition, and proper primordium migration (fig. S1, A to H). Application of increasing concentrations of SU5402 caused corresponding reductions in neuromast numbers, confirming specificity of the druginduced phenotype (fig. S1, I and J). Application of SU5402 beginning at 13 hours postfertilization (hpf), before lateral line placodes were induced (9), did not affect formation of the first, most rostral rosette but blocked formation of more caudal rosettes (fig. S2, A and B, and movie S3). This defect in rosette formation did not alter initial migration onset. These results suggest that FGF signals are not needed for initial primordium formation or polarization, a process whose regulation remains unknown. Later FGF inhibition during primordium migration altered its organization and movement (fig. S1, D to G, and movie S4). Migration was not affected immediately after inhibitor application, and a single neuromast was deposited. However, subsequent rosette renewal was blocked, and after migrating a distance of 8 to 10 somites, the primordium became disorganized and stopped moving. Alterations in migration were probably caused by changes in expression of the chemokine receptors cxcr4b and cxcr7b (fig. S3), which are required for proper migration (10–12). FGFinhibitor effects were reversible; after inhibitor removal, the primordium reorganized into three to four rosettes and then resumed migration (movie S5). Expression of FGF signaling components is consistent with a role in primordium organization. fgfr1 was strongly expressed in the primordium trailing region, with lower expression in the leading zone (Fig. 2A). pea3, a downstream target of FGF signaling (13, 14), was expressed in the trailing zone (Fig. 2B). Of 22 FGF ligands screened, only fgf3 (15) and fgf10 (16) were expressed in the pLL primordium, broadly in the leading zone and restricted to a focus of one to two cells in trailing rosettes (Fig. 2, C and E). As the primordium organizes into rosettes, both fgf3
Fig. 2. Dynamic expression of FGF signaling components in the migrating pLL primordium. (A) Fluorescent in situ hybridization of fgfr1 (red) and deltaA (green) transcripts at 31 hpf. Nuclei were labeled with 4´,6´-diamidino-2phenylindole (DAPI) (blue). Cell shapes were revealed with antibody against pan-Cadherin (magenta). Arrows indicate rosette centers. fgfr1 expression is strong in the trailing part of the primordium and weaker in the leading zone (brackets). (B) At 31 hpf, pea3 (red) is expressed in trailing rosettes [revealed by basally displaced nuclei (arrows)]. (C and E) fgf3 and fgf10 are expressed in the leading zone and in distinct foci in the trailing zone. fgf3 is expressed at relatively low levels as compared with fgf10. (D and F) Expanded fgf3 and fgf10 expression after treatment with SU5402 between 27 to 31 hpf. Primordia are outlined by dotted lines. Scale bars in (A) to (C), 50 mm.
Fig. 3. Fgf3 and Fgf10 are necessary for primordium organization and neuromast deposition. (A and B) Zygotes derived from fgf3+/− parents were injected with fgf10-MO, collected at 48 hpf, analyzed for eya1 expression, and genotyped. (A) In wild-type ( fgf3+/+ or fgf3+/−) embryos, the pLL primordium migrated through the trunk and deposited five to six neuromasts. (B) fgf3−/− embryos injected with fgf10-MO displayed only one or no neuromasts and showed complete disorganization of the primordium. (C and D) Neuromast (NM) numbers decrease and neuromast positions shifted caudally, as FGF signaling is reduced. Data are shown as means ± SD. (*P < 0.05; **P wt transplants (Fig. S6), we employed Fisher’s Exact Test (http://www.matforsk.no/ola/fisher.htm). Kaede photoconversion Zygotes were injected with 100 pg of Kaede mRNA at the one-cell stage (8, 9). The Kaede fluorophore was converted from green to red between 22 and 24 hpf in a small number of cells in the leading zone of the pLL primordium using the 405 nm laser on a FLUOVIEW1000 (Olympus) confocal system. The distribution of red fluorescent cells was assessed at 54 hpf Morpholino injections Fgf3 (5’-CATTGTGGCATGGAGGGATGTCGGC) (10) and Fgf10 (5’GCTTTACTCACTGTACGGATCGTCC) antisense morpholino oligonucleotides (MO) were obtained from GeneTools (Corvalis, OR), diluted to a working concentration of 1 ng/nl and 7.5 ng/nl, respectively, in Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, and 5 mM HEPES, pH 7.6), and 2-3 nl were pressure-injected into one- or two-cell stage zygotes. atoh1a MO (11), a gift from Bruce Riley, was injected at 1.25 ng/nl. In situ hybridization and immunolabeling In situ hybridization, fluorescent in situ hybridization (FISH) and immunolabeling experiments were performed according to the published protocols (12, 13). To find Fgfs expressed in the pLL primordium, we screened a panel of 12 Fgfs, fgf3, fgf4, fgf7, fgf8, fgf10, fgf10b, fgf17a, fgf17b, fgf18, fgf20a, fgf20b, and fgf24, by in situ hybridization. Expression of additional 10 Fgfs (fgf1, fgf2, fgf6, fgf8b, fgf13, fgf13L, fgf16, fgf18l, fgf19, fgf21) was assessed from ZFIN database (http://zfin.org/). Eleven other Fgf ligands that can be identified from the Sanger sequencing project (http://www.sanger.ac.uk/Projects/D_rerio/mapping.shtml) or the literature (14-17) have not been screened for pLL primordium expression (fgf1b, fgf4b, fgf5, fgf9, fgf11, fgf12a, fgf12b,
fgf14, fgf15, fgf22, fgf25). Only two fgf ligands, fgf3 and fgf10, were found to be expressed in pLL primordium during neuromast deposition. We used the following riboprobes and antibodies: atoh1a (18), deltaA (18), notch3 (18), fgf3 (19), fgf10 (20), fgfr1 (21), pea3 (22, 23), antiacetylated Tubulin (1:1000, Sigma), anti-pan-Cadherin (1:500, Sigma), anti-β-catenin (1:100, BD Biosciences), anti-BrdU (1:100, BD Biosciences), anti-phosphohistone H3 (1:200; Upstate Biotechnolgy) and anti-GFP (1:1000, Invitrogen). Immunolabeling and BrdU detection were performed according to the published protocols (24). In some cases, nuclei were counterstained using DAPI or TO-PRO-3 (Invitrogen) according to the manufacturer’s protocol. For brightfield photography, embryos were de-yolked when appropriate, flat mounted in 50% glycerol/50% PBS and photographed on a Nikon SMZ 1500 stereoscope or Zeiss Axioplan microscope using a Spot CCD camera (Diagnostic Instruments). Fluorescent images were obtained using an LSM-5 Pascal (Zeiss) or FLUOVIEW 1000 confocal systems (Olympus). Brightness and contrast of whole images were adjusted using Adobe Photoshop. Transplantation experiments For transplants, embryos were raised in filtered EM supplemented with penicillin (5000 U/l)/streptomycin (100 mg/l; Sigma). Donor embryos were injected at the one-cell stage with 2% lysine-fixable fluorescein or tetramethylrhodamine dextran (10,000 Mr; Invitrogen Molecular Probes) in 0.2 M KCl. Dechorionated donor and host embryos were mounted in 3.2% methylcellulose in EM on a glass depression slide. 25-30 donor cells were inserted into the presumptive placodal domain of a shield-staged host embryo, about 40° from the margin and 110° from the shield (25). Donor-derived fluorescein-labeled cells were detected essentially as described (26) or using tyramide amplification (13).
Supplementary Figure 1. Fgf signaling is required for zebrafish neuromast deposition in a dosedependent manner. Embryos were treated for the period indicated with DMSO (A and D) or SU5402 (B and E). hsp70:dn-fgfr1 embryos (C and F) were heat-shocked at times indicated. Following treatment, embryos were fixed at 48 hpf and the primordium and neuromast positions were assessed by eya1 expression. eya1 is expressed in all placode-derived structures, including the lateral line (27). Arrowheads indicate the position of the pLL primordium at the beginning of treatment. (G) Average axial neuromast position±s.d., indicated by somite number, following inhibition of Fgf signaling. Arrowheads indicate the position of the primordium at the beginning of treatments in E and F. (H) Neuromast numbers±s.d., excluding terminal cluster. (I and J) dose response curve and neuromast numbers were obtained for embryos exposed to increasing concentrations of SU5402 (n=16 for all treatments). The inhibitor was applied between 22 and 48 hpf. At 22 hpf, at least one, most rostral, proto-neuromast had already formed (Fig. 1), thus positions of the L1 at 48 hpf is not expected to change significantly in SU5402-treated embryos. Note that application of SU5402 at 10 μM causes a caudal shift of L2-L4 as well as premature termination of primordium migration (44% of all cases). Data are shown as mean±s.d. **p
