Functional characterization of the BvgAS two-component ... - CiteSeerX

Microbiology (2004), 150, 3715–3729

DOI 10.1099/mic.0.27432-0

Functional characterization of the BvgAS two-component system of Bordetella holmesii Gabriele Gerlach, Simone Janzen, Dagmar Beier and Roy Gross Theodor-Boveri-Institut fu¨r Biowissenschaften, Lehrstuhl fu¨r Mikrobiologie, Universita¨t Wu¨rzburg, Am Hubland, D-97074 Wu¨rzburg, Germany

Correspondence Roy Gross [email protected]

Received 24 June 2004 Revised 10 August 2004 Accepted 12 August 2004

The BvgAS two-component system is the master regulator of virulence gene expression in the mammalian pathogens Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. This paper reports the partial cloning and characterization of the bvgAS loci of the ‘new’ Bordetella species Bordetella holmesii, Bordetella trematum and Bordetella hinzii, which are increasingly recognized as opportunistic pathogens in humans. It is demonstrated that the cytoplasmic signalling domains of the BvgS histidine kinases of B. pertussis and B. holmesii are functionally interchangeable, while signal perception by the two sensor proteins seems to be different. Furthermore, it is shown that, despite the high similarity of the BvgA proteins of B. pertussis and B. holmesii, promoter recognition by the response regulator proteins differs substantially in these organisms.

INTRODUCTION The members of the genus Bordetella form a group of closely related organisms. With the exception of Bordetella petrii, which was recently isolated from river sediment (von Wintzingerode et al., 2001), Bordetella species so far have been found exclusively in close association with host organisms (Cotter & DiRita, 2000; Gerlach et al., 2001). The so-called ‘classical’ Bordetella species include Bordetella pertussis, Bordetella parapertussis, Bordetella bronchiseptica and Bordetella avium. The human pathogens B. pertussis and B. parapertussis are the causative agents of whooping cough and a milder pertussis-like disease, respectively. B. bronchiseptica causes respiratory infections in a wide range of warm-blooded animals and B. avium is the aetiological agent of bordetellosis, an upper respiratory tract disease of young poultry and other birds (Skeeles & Arp, 1988). The ‘classical’ Bordetella species are quite well characterized and, with the exception of B. avium, whose genome sequence is in the finishing phase, their genome sequences have already been published (Parkhill et al., 2003). Within the past few years, four new species have been added to the genus Bordetella. Bordetella holmesii can cause disease in man and has been isolated from blood cultures of patients with underlying disease and from patients with whooping cough-like symptoms (Weyant et al., 1995; Tang et al., 1998; Yih et al., 1999; Mazengia et al., 2000; Shepard et al., 2004). Abbreviations: Cya, adenylate cyclase toxin; FhaB, filamentous haemagglutinin; GFP, green fluorescent protein. The GenBank/EMBL/DDBJ accession numbers for the sequences reported in this paper are AJ748854, AJ748855 and AJ48856.

0002-7432 G 2004 SGM

Printed in Great Britain

Bordetella hinzii appears to be a commensal of birds, although it has been isolated occasionally also from the blood of immunocompromised patients (Cookson et al., 1994; Kattar et al., 2000). Bordetella trematum was isolated from patients suffering ear or wound infections, but was not found in the respiratory tract (Vandamme et al., 1996); at present its pathogenic potential is not known. Finally, B. petrii was the first member of the genus to be isolated from the environment (von Wintzingerode et al., 2001). Little is known about the biology and the pathogenic potential of these ‘new’ Bordetella species, although B. holmesii is increasingly recognized as being associated with human disease (Yih et al., 1999). During the course of the development of new vaccines against whooping cough, much has been learnt about the pathogenicity and the virulence-associated factors of B. pertussis, B. bronchiseptica and B. parapertussis. Interestingly, these three species share several virulence-relevant factors (Hewlett & Cowell, 1989; Weiss, 1992; Parton, 1999), including adhesion or colonization factors, such as the filamentous haemagglutinin, fimbriae of several serotypes and several autotransporter proteins. Moreover, these bacteria produce highly related toxic factors such as the tracheal cytotoxin, the dermonecrotic toxin and the adenylate cyclase toxin. Pertussis toxin is expressed exclusively by B. pertussis, although the ptx genes are also present in B. parapertussis and B. bronchiseptica (Gross & Rappuoli, 1988). It is well known that the three closely related Bordetella species B. pertussis, B. bronchiseptica and B. parapertussis, which are also referred to as members of the B. bronchiseptica cluster (Gerlach et al., 2001), coordinately regulate the expression of these virulence factors via a 3715

G. Gerlach and others

highly conserved two-component system encoded by the bvgAS locus (Weiss et al., 1983; Arico et al., 1989; Cotter & DiRita, 2000; Bock & Gross, 2001). BvgAS mediates the transition between the virulent and the avirulent phenotype by two phenomena called antigenic modulation and phase variation. Antigenic modulation describes a reversible on-and-off switch in the expression of pathogenicity factors in response to environmental signals, such as temperature, magnesium sulphate or nicotinic acid, and is caused by changes in the phosphorylation state of the BvgAS two-component system (Lacey, 1960; Uhl & Miller, 1996; Zu et al., 1996; Perraud et al., 1998). In contrast, phase variation, which occurs in vitro at a straindependent frequency of 1022–1026, is characterized by the irreversible loss of expression of the virulence-associated genes irrespective of the growth conditions (Leslie & Gardner, 1931; Peppler, 1982; Peppler & Schrumpf, 1984). It has been shown in a B. pertussis isolate that phase variation was due to a frameshift mutation in the bvgS gene (Stibitz et al., 1989), while in B. bronchiseptica, phase variation is frequently caused by small deletions within the bvgS gene (Monack et al., 1989). In contrast to the ‘classical’ species, virtually nothing is known about virulence-relevant features of the ‘new’ Bordetella species. Since the BvgAS system is the master regulator of virulence in the ‘classical’ species, we characterized the orthologous genes from the ‘new’ species in order to use the BvgAS system as a starting point for the identification of possible virulence factors in these species. In the present paper we describe the properties of the BvgAS systems of the new species, with the main emphasis on the human pathogen B. holmesii.

METHODS Bacterial strains and growth conditions. Bacterial strains used

in this study are listed in Table 1. B. holmesii strains were grown in brain heart infusion (BHI; Difco) or on Bordet–Gengou (BG) agar plates supplemented with 20 % horse blood (Bordet & Gengou, 1909). B. pertussis strains were grown in modified Stainer–Scholte medium (Stainer & Scholte, 1970; Aoyama et al., 1986) or on BG agar plates. When required, antibiotics were added to the following final concentrations: streptomycin, 100 mg ml21; kanamycin, 25 mg ml21; tetracycline, 12?5 mg ml21; ampicillin, 100 mg ml21; and chloramphenicol, 15 mg ml21. Bacterial conjugations were performed as described previously (Gross & Rappuoli, 1988), using Escherichia coli SM10 as the donor strain (Simon et al., 1983). Protein lysates were prepared from bacteria grown on BG agar plates for 72 h at 37 uC which were suspended in saline at a cell density of 2?46109 c.f.u. ml21. General techniques. DNA manipulation, cloning procedures and

SDS-PAGE were carried out according to standard procedures (Sambrook & Russell, 2000). PCR amplifications were performed with a model Progene thermocycler (Techne) by using Deep Vent DNA polymerase (New England Biolabs) or Taq polymerase (Qbiogene). All cloned PCR products were subjected to automated sequencing (Big Dye kit; Perkin-Elmer) to ensure proper amplification. Immunoblot analysis was performed using a semidry blotting procedure as described by Towbin et al. (1979). Membrane-immobilized 3716

filamentous haemagglutinin (FhaB) and green fluorescent protein (GFP) were detected using goat FhaB and rabbit GFP antiserum (Invitrogen), respectively. Characterization of the bvgAS loci of B. holmesii, B. trematum and B. hinzii. PCR reactions with degenerate oligonucleotide

primers were performed essentially as described by Morel-Deville et al. (1997) using chromosomal DNA of B. holmesii G7702, B. trematum and B. hinzii as templates. The degenerate primers were deduced from highly conserved regions of the receiver domain and from the output domain of BvgABP from B. pertussis. Plasmids and oligonucleotides used in this study are listed in Table 1 and Table 2, respectively. Primer pair deg1-forward/deg1-reverse was deduced from the sequence motifs IIDD and GAAGF, which correspond to amino acid residues 7–10 and 97–101, respectively, of the BvgABP receiver domain. Primer pair deg2-forward/deg2-reverse was deduced from the sequence motifs GAAGF and KL(N/G)(G/A), which correspond to amino acids 97–101 in the receiver domain and amino acids 190–193 in the output domain of BvgABP, respectively. Using primer pair deg1-forward/deg1-reverse, a fragment of the expected length (285 bp) could be amplified from chromosomal DNA of B. holmesii (BH) and B. hinzii (BHZ), while no PCR product was obtained using chromosomal DNA of B. trematum (BT) as template. Using primer pair deg2-forward/deg2-reverse, PCR fragments 54 bp shorter than the expected ones were amplified from genomic DNA of B. holmesii and B. trematum, while no product was obtained with chromosomal DNA of B. hinzii as template. The PCR products were cloned into pGEM-T vector DNA, giving rise to plasmids pGEM-T-deg1BH, pGEM-T-deg1BHZ, pGEM-T-deg2BH and pGEM-T-deg2BT, and sequenced. Sequence analysis demonstrated that the cloned DNA fragments were indeed derived from the bvgA orthologues of the ‘new’ Bordetella species. Interestingly, primer deg2reverse turned out to have annealed to a sequence motif within bvgABH and bvgABT, which is located further upstream than the motif from which the degenerate primer sequence was derived, therefore yielding PCR fragments of unexpected length. Partial genomic libraries of B. holmesii were screened using PCR fragment ‘deg1BH’ as probe. The DNA inserts of positive clones were subsequently sequenced to assemble the complete nucleotide sequence of bvgABH including its flanking DNA regions. The nucleotide sequences of ‘deg1BHZ’ and ‘deg2BT’ were extended by a combination of different techniques including inverse PCR, genome walking [using the Universal Genome Walker Kit (Clontech)] and the screening of partial genomic libraries of the respective organisms. Cloning of the bvgASBH locus of B. holmesii ATCC 51541 (bvgASBH ATCC 51541) and B. holmesii G7702 (bvgASBH G7702).

In order to construct plasmids pSL-bvgASBH G7702 and pSL-bvgASBH ATCC 51541 the 4?7 kbp DNA region comprising the orfX-bvgABH intergenic region and the entire bvgASBH locus, from B. holmesii G7702 and ATCC 51541, respectively, was assembled by stepwise cloning from three individual PCR fragments (bvgASBHF1, bvgASBHF2 and bvgASBHF3) amplified from chromosomal DNA of the corresponding B. holmesii strain. The following steps were repeated for both B. holmesii strains. PCR fragment bvgASBHF1, which includes the orfX-bvgASBH intergenic region and extends to the SphI site of the bvgSBH gene, was synthesized using primer pair bvgASBHF1-SpeI/bvgASBHF1-SphI. PCR using primer pairs bvgASBHF2-SphI/bvgASBHF2-KpnI and bvgASBHF3-KpnI/ bvgASBHF3-EcoRI, respectively, yielded DNA fragment bvgASBHF2, containing the DNA segment located between the SphI and KpnI site of the bvgSBH gene, and PCR fragment bvgASBHF3, containing the sequence flanked by the KpnI site and the stop codon of the bvgSBH gene. Fragments bvgASBHF1 and bvgASBHF2 were first ligated into Microbiology 150

BvgAS two-component system of B. holmesii

Table 1. Bacterial strains and plasmids Bacterial strain or plasmid Strains B. holmesii ATCC 51541 No1 G8341 G7702 G7702/bvgABH : : kan B. pertussis Tohama I (TI) 347 359 B. hinzii ATCC 51783 B. trematum CCUG32381 E. coli DH5a M15 SM10 Plasmids pGEM-T pUC18 pRK415 pSL1180 pMMB208 pSS1129 pUC4K pKEN pLA57vir pProm67 pCYT-BvgABP pQE30 and pQE31 pQE-BvgSTRO pGEM-T-deg1BH pGEM-T-deg1BHZ pGEM-T-deg2BH pGEM-T-deg2BT pQE-BvgABH pGEM-T-FP pSL-bvgASBH

G7702

pSL-bvgASBH

ATCC 51541

pRK-bvgASBH

G7702

http://mic.sgmjournals.org

Relevant feature(s)

Reference or source

Clinical isolate Clinical isolate Clinical isolate Clinical isolate G7702 with a kanamycin-resistance cassette disrupting the bvgABH gene

Weyant et al. (1995) Njamkepo et al. (2000) Weyant et al. (1995) Weyant et al. (1995) This study

Wild-type, but rpsL Derivative of TI, bvgS : : Tn5 Derivative of TI, bvgA : : Tn5

Weiss & Falkow (1984) Weiss et al. (1983) Weiss & Falkow (1984)

Isolate from the trachea of a chicken

Vandamme et al. (1995)

Human isolate

Vandamme et al. (1996)

Strain used for high-efficiency transformation Strain used for overproducing His6-BvgABH and His6-BvgSBP Mobilizing strain

Gibco Qiagen Simon et al. (1983)

Vector for cloning of PCR products containing 39-T overhangs High-copy-number cloning vector Derivate of pRK404, broad-host-range cloning vector Cloning vector Broad-host-range expression vector Used for allelic exchange mutagenesis in Bordetella species Source of the kanamycin cassette Plasmid containing the promoterless gfp-mut2 gene Broad-host-range vector pLAFR2 carrying the entire bvgASBP locus of B. pertussis pGem3 carrying a 1250 bp PstI/PstI DNA fragment that includes both promoter regions for the bvg locus and for the fhaB gene of B. pertussis. pCYTEXP1 expressing the response regulator BvgABP of B. pertussis Expression vectors for N-terminal His-tag cloning pQE31 expressing the His6-tagged cytoplasmic domains of the histidine kinase BvgSBP of B. pertussis pGEM-T carrying a 285 bp PCR fragment of B. holmesii G7702 encoding amino acids 7–100 of BvgABH pGEM-T carrying a 285 bp PCR fragment of B. hinzii encoding amino acids 7–100 of BvgABHZ pGEM-T carrying a 237 bp PCR fragment of B. holmesii G7702 encoding amino acids 97–176 of BvgABH pGEM-T carrying a 237 bp PCR fragment of B. trematum encoding amino acids 97–176 of BvgABT pQE30 expressing the His6-tagged response regulator BvgABH of B. holmesii pGEM-T carrying a 253 bp DNA fragment derived from the upstream region of bvgASBH pSL1180 carrying the upstream region and the coding region of bvgASBH of B. holmesii G7702 pSL1180 carrying the upstream region and the coding region of bvgASBH of B. holmesii ATCC 51541 pRK415 carrying the upstream region and the coding region of bvgASBH of B. holmesii G7702

Promega Pharmacia Keen et al. (1988) Pharmacia Morales et al. (1991) Stibitz & Yang (1991) Pharmacia Cormack et al. (1996) Arico et al. (1989) Scarlato et al. (1990) Perraud et al. (1998) Qiagen Perraud et al. (1998) This study This study This study This study This study This study This study This study This study

3717

G. Gerlach and others

Table 1. cont. Bacterial strain or plasmid pRK-bvgASBH

ATCC 51541

pACYC184 pACYC-bvgABH-kanR

pSS1129-bvgABH-kanR

pUC-gfp pUC-bvgASBHup-gfp pMMB-bvgASBHup-gfp

Relevant feature(s)

Reference or source

pRK415 carrying the upstream region and the coding region of bvgASBH of B. holmesii ATCC 51541 Cloning vector pACYC184 containing a 649 bp DNA fragment comprising part of the upstream region of bvgABH and the sequence encoding amino acids 1–68 of BvgABH and an 897 bp DNA fragment comprising the sequence encoding amino acids 188–207 and 1–276 of bvgABH and bvgSBH, respectively, flanking a kanamycin resistance cassette pSORTP1 containing a 649 bp DNA fragment comprising part of the upstream region of bvgABH and the sequence encoding amino acids 1–68 of BvgABH and an 897 bp DNA fragment comprising the sequence encoding amino acids 188–207 and 1–276 of BvgABH and BvgSBH, respectively, flanking a kanamycin-resistance cassette pUC18 containing the promoterless gfp-mut2 gene pUC18 carrying a 1206 bp DNA fragment containing the upstream region of bvgASBH G7702 fused to the gfp-mut2 gene pMMB208 carrying a 1206 bp DNA fragment containing the upstream region of bvgASBH G7702 fused to the gfp-mut2 gene

This study Chang & Cohen (1978) This study

This study

This study This study This study

Table 2. Oligonucleotides Oligonucleotide deg1-forward deg1-reverse deg2-forward deg2-reverse bvgASBHF1-SpeI bvgASBHF1-SphI bvgASBHF2-SphI bvgASBHF2-KpnI bvgASBHF3-KpnI bvgASBHF3-EcoRI bvgABHFI-XbaI bvgABHFI-HindIII bvgABH-kanR5 bvgABH-kanR3 bvgASBHup-5 bvgASBHup-3 bvgABH-BamHI bvgABH-KpnI FP1-5 FP1-3 fhaBup5 fhaBup3 fhaB-PE bvgABH-PE gfp-PE

Sequence (5§–3§)*

Restriction recognition site

cgaagctttgathathgaygayca cttctagaaraanccngcngcncc cgaagctttgggngcngcnggnttygt cttctagaanrcnyynarytt cgcactagtgccaatacctgatcgtatgac acatgcatgcgggtagtgttgaatcaac acatgcatgcggagcttgtgccggccag cggggtaccggcgtgagctcgagtttg cggggtacctaccgatctgcgccgctt cgggaattcagtcgcgggcggccagcc acatctagagccaatacctgatcgtatgac gtaaaagcttctgcagcaggcgggtttt ggccggatccgatcttcccggacggggcgttgc ggccggatcccaagccccatcgatagatagcgtt ggcatcggatccccaatacctgatcgtatgacg ggcatctctagaagtagcttttgcatggccgtctg cgcggatcccaaaagctactaattatt aatggtaccgcataaacctcaccccag cgcggatccgcagatacttaaactagcctg aatggtaccaataattagtagcttttgcatggc cgcggatccgtttgactaagaaatttccta aatggtaccgcacttcgtcagtcagt gtgcaatgctcgctcacgggaaca ctttctccatcaagccctttacggc caagaattgggacaactccagtga

HindIII XbaI HindIII XbaI SpeI SphI SphI KpnI KpnI EcoRI XbaI HindIII BamHI BamHI BamHI XbaI BamHI KpnI BamHI KpnI

*Restriction recognition sequences which were introduced for cloning purposes are underlined. 3718

Microbiology 150

BvgAS two-component system of B. holmesii SpeI-and KpnI-digested pSK-Bluescript DNA, yielding plasmid pSKbvgASBHF1/F2. Fragment bvgASBHF1/F2 was excised by SpeI and KpnI digestion of pSK-bvgASBHF1/F2 and ligated, together with fragment bvgASBHF3, into SpeI- and EcoRI-linearized plasmid pSL1180, generating pSL-bvgASBH. For the construction of plasmids pRK-bvgASBH G7702 and pRKbvgASBH ATCC 51541, fragment bvgABHFI, including the orfX-bvgASBH intergenic region and extending to the HindIII restriction site of the bvgABH gene, was PCR amplified using primer pair bvgABHFI-XbaI/ bvgASBHFI-HindIII and genomic DNA from the corresponding strain of B. holmesii. A DNA fragment, ranging from the HindIII site of the bvgABH gene to the bvgSBH stop codon, was excised by HindIII/EcoRI digestion from pSL-bvgASBH G7702 and pSL-bvgASBH ATCC 51541 and subsequently inserted, together with PCR fragment bvgABHFI, into XbaI- and EcoRI-digested pUC18 vector DNA. The resulting plasmids, pUC-bvgASBH G7702 and pUC-bvgASBH ATCC 51541, were digested with XbaI and EcoRI and the resulting 4?7 kbp DNA fragments were finally inserted into plasmid pRK415, giving rise to plasmids pRKbvgASBH G7702 and pRK-bvgASBH ATCC 51541, respectively. Construction of a bvgABH mutant of B. holmesii G7702. For

the construction of the suicide plasmid pSS1129-bvgABH-kanR, a 1?8 kbp DNA fragment comprising the bvgABH gene and part of its 59 and 39 flanking regions was PCR amplified from genomic DNA of B. holmesii G7702 using primer pair bvgABH-kanR5/bvgABHkanR3, which provided BamHI restriction sites at the 59 and 39 termini. This PCR fragment was cloned into pACYC184, and the resulting plasmid was digested with PstI, thereby deleting 354 bp from bvgABH because of the presence of three PstI restriction sites (at positions 206, 467 and 560 with respect to the bvgABH start codon) in the bvgABH gene. Subsequently, a kanamycin-resistance cassette, excised by PstI cleavage from pUC4K, was inserted into the PstI-digested plasmid pACYC-bvgABH, yielding plasmid pACYCbvgABH-kanR. The bvgABH-kanR fragment was excised with BamHI and ligated into the suicide vector pSS1129, giving rise to plasmid pSS1129-bvgABH-kanR, which was subsequently transformed into E. coli SM10. pSS1129-bvgABH-kanR was then conjugated into B. holmesii G7702 using E. coli SM10 as donor strain. Allelic exchange resulted in the B. holmesii strain G7702/bvgA : : kan. The correct insertion of the kanamycin-resistance cassette into the bvgABH gene of the kanamycin-resistant exconjugants was proven by PCR reactions with primers flanking the integration site and by Southern blot analysis. Construction of B. holmesii and B. pertussis strains containing a plasmid with a fusion of the upstream region of bvgABH to the gfp reporter gene. A DNA fragment containing

the promoterless gfp-mut2 gene (Cormack et al., 1996) was excised with XbaI and PstI from plasmid pKEN and ligated into plasmid pUC18, giving rise to plasmid pUC-gfp. A 455 bp DNA fragment containing the upstream region of the bvgASBH locus was PCR amplified from genomic DNA of B. holmesii G7702 using primer pair bvgASBHup-5/bvgASBHup-3, thereby introducing BamHI and XbaI restriction sites at the 59 and 39 termini, respectively, and the fragment was cloned into pUC-gfp, resulting in plasmid pUCbvgASBHup-gfp. The bvgASBHup-gfp fragment was then excised by BamHI- and PstI-digestion and was subsequently ligated into plasmid pMMB208. In the resulting plasmid pMMB-bvgASBHup-gfp, the bvgASBHup-gfp promoter fusion is located in the opposite orientation to the plasmid-borne tac promoter. pMMB-bvgASBHup-gfp was subsequently transformed into E. coli SM10 and transferred by conjugation into various B. holmesii and B. pertussis strains. Construction of plasmids expressing recombinant BvgABP, BvgSBP and BvgABH proteins, and protein purification. The

construction of pQE-BvgSTRO and pCYT-BvgABP has been described by Perraud et al. (1998). For the generation of plasmid http://mic.sgmjournals.org

pQE-BvgABH, a DNA fragment including the complete bvgABH gene (621 bp) was amplified from genomic DNA of B. holmesii G7702 using primer pair bvgABH-BamHI/bvgABH-KpnI, thus introducing BamHI and KpnI sites at its 59 and 39 ends respectively. This PCR fragment was ligated into BamHI/KpnI-digested pQE30 vector DNA, creating an N-terminal His6-tag. Recombinant His6-BvgABH and His6BvgSBP, encoded on plasmids pQE-BvgABH and pQE-BvgSTRO, respectively, were expressed in E. coli M15 cells and the proteins were purified by affinity chromatography on Ni2+-nitrilotriacetic acid agarose (Qiagen) essentially as described by Perraud et al. (1998). Native BvgABP encoded on plasmid pCYT-BvgABP was overexpressed in E. coli DH5a cells and the protein was purified by affinity chromatography on heparin-Sepharose CL-6B (Pharmacia) as described by Perraud et al. (1998). In vitro-phosphorylation assays with the recombinant proteins were performed as described by Bock & Gross (2002). Primer extension experiments. Total RNA was prepared from bacteria grown in liquid culture as described previously (Gross & Rappuoli, 1989). Primer extension experiments were carried out essentially as described by Scarlato et al. (1991) with primer oligonucleotides fhaB-PE, bvgABH-PE and gfp-PE (Table 2). Sequencing reaction mixtures, with plasmids pSL-bvgASBH G7702 and pUCbvgASBHup-gfp as template DNA and the appropriate oligonucleotide primer, were analysed on 6 % urea-polyacrylamide gels and used as standards for determination of the transcription initiation sites. Gel retardation experiments. A 77 bp DNA fragment encompass-

ing the BvgABP-P binding site of the fhaB promoter was amplified by PCR using primer pair fhaBup5/fhaBup3 and plasmid pProm67 as template. The PCR fragment was 59-end labelled with [c-32P]ATP using T4 polynucleotide kinase (MBI) and purified using the QIAquick Nucleotide Removal Kit (Qiagen). The recombinant BvgA proteins were diluted in 16 dilution buffer (2 mM MgCl2, 50 mM KCl, 0?1 % Igepal CA 630, 10 mM DTT) and were phosphorylated by incubation with 50 mM acetyl phosphate (Sigma) for 20 min at room temperature. Increasing amounts of the proteins were added to approximately 15 000 c.p.m. of the labelled DNA probe in 20 ml of 16 binding buffer (10 mM Tris/HCl, pH 8, 10 mM KCl, 5 mM EDTA, 1 mM DTT, 10 % glycerol, v/v). The samples were incubated for 20 min at room temperature and were then loaded onto a nondenaturing 4 % polyacrylamide gel (Sambrook & Russell, 2000). Gels were run for 2?5 h at 150 V and subsequently the dried gels were autoradiographed. DNase I footprinting. DNase I footprint experiments were per-

formed essentially as described by Dickneite et al. (1998). A 253 bp DNA fragment containing part of the upstream region of the bvgASBH locus was PCR amplified from chromosomal DNA of B. holmesii G7702 using primer pair FP1-3/FP1-5. The purified promoter fragment was cloned into plasmid pGEM-T. The resulting plasmid pGEM-T-FP was digested with BamHI and 59-end labelled with [c-32P]ATP using T4 polynucleotide kinase. The labelled promoter fragment was excised from the plasmid by KpnI digestion, purified by gel electrophoresis and eluted in 3 ml elution buffer (10 mM Tris/HCl, pH 8?0, 1 mM EDTA, 300 mM sodium acetate, 0?2 % SDS). The eluted probe was then extracted with phenol/ chloroform (1 : 1, v/v) and ethanol precipitated. Binding reaction mixtures contained various concentrations of protein and approximately 100 000 c.p.m. of labelled DNA probe in 50 ml of 16 binding buffer (10 mM Tris/HCl, pH 8, 2 mM MgCl2, 0?1 mM CaCl2, 1 mM DTT, 10 % glycerol, v/v). The samples were incubated for 20 min at room temperature and then the nucleolytic reactions were initiated by the addition of 1 U DNase I in 16 binding buffer. After 1 min, digestions were terminated by the addition of 140 ml stop buffer (192 mM sodium acetate, 0?14 % SDS, 62 mg ml21 yeast tRNA). The samples were extracted with phenol/chloroform 3719

G. Gerlach and others (1 : 1, v/v), ethanol precipitated and run on a 6 % polyacrylamideurea sequencing gel. A G+C sequence reaction was also conducted in parallel with the labelled DNA probe (Maxam & Gilbert, 1977) and electrophoresed on the same gel.

RESULTS

within the analysed region downstream of bvgAS in B. holmesii. The lack of a bvgR orthologue in the downstream region has already been described for B. avium (Spears et al., 2003), therefore suggesting that the genome organization of the bvgAS locus is conserved in B. avium and the ‘new’ Bordetella species (Fig. 1).

To clone the bvgA genes of B. holmesii (BH), B. hinzii (BHZ) and B. trematum (BT), a PCR approach, with degenerate primers deduced from highly conserved regions of the receiver domain and from the output domain of BvgA from B. pertussis (BP), was used. The obtained DNA fragments of 285 or 237 bp were used as probes to screen partial genomic libraries of the respective organisms or were extended by genome walking. Assembly of the resulting DNA sequences yielded the entire bvgAS locus, and 873 bp and 1373 bp from its upstream and downstream regions in the case of B. holmesii. In the case of B. trematum, 1068 bp from the upstream region of the bvgAS locus, and 3142 bp encoding BvgA and the N-terminal 839 amino acids of BvgS were obtained. From the B. hinzii bvgAS locus, a partial sequence, comprising a fragment encoding the N-terminal 166 amino acids of BvgA and 660 bp from the upstream region, was determined.

As was reported for B. avium (Spears et al., 2003), the nucleotide sequences of the bvgAS genes of the ‘new’ Bordetella species exhibit only a low degree of similarity with the orthologous genes of the members of the B. bronchiseptica cluster, with the pairwise identity between the bvgA and bvgS sequences of B. holmesii and the orthologous genes from B. pertussis being 72?7 % and 59?9 %, respectively. However, the amino acid sequences of the BvgA proteins of B. holmesii or B. trematum and BvgA from B. pertussis are highly similar in the receiver and output domains (74?8 and 86?1 % mean pairwise identity, respectively), while the linker region connecting the two functional domains is less conserved (34?5 % pairwise identity). Similarly, the alignment of the BvgS orthologues of B. holmesii and B. pertussis showed a high similarity in the cytoplasmic transmitter, receiver and HPt domains (52?9 % identity), but much less sequence conservation in the periplasmic domain, which is believed to be involved in signal perception (39?5 % identity).

The genome organization of the bvgAS loci of the ‘new’ Bordetella species differs from that of the members of the B. bronchiseptica cluster. In B. holmesii, B. hinzii and B. trematum, a gene (orfX) encoding a putative response regulator was detected at a distance of about 400 bp upstream from bvgA in the same transcriptional direction, while in the members of the B. bronchiseptica cluster the fhaB gene encoding filamentous haemagglutinin (FhaB) is located upstream of bvgA (Parkhill et al., 2003). Also, in B. avium, an ORF encoding a homologous response regulator was found upstream of bvgA; this ORF was annotated by Spears et al. (2003) as an orthologue of the vieA gene of V. cholerae. Furthermore, no orthologue of the bvgR gene, which is located downstream of bvgAS in the genomes of the members of the B. bronchiseptica cluster is present

Interestingly, DNA sequence analysis of the bvgA gene of the B. holmesii type strain ATCC 51541 (bvgABH ATCC 51541) revealed the insertion of an adenosine residue at nucleotide position 212 which leads to a frameshift mutation that causes the premature termination of the encoded protein. Therefore, we sequenced the bvgABH gene of three additional B. holmesii strains which were isolated independently from each other in different geographical regions and at different times. In one of these strains, B. holmesii No1, we found the identical mutation to that seen in the type strain, while the bvgABH genes of the other two isolates, B. holmesii G7702 and G8341, are intact. This observation is reminiscent of the phenomenon of phase variation in B. pertussis and B. bronchiseptica and, therefore subsequently in this paper B. holmesii isolates with an intact bvgABH

Characterization of the bvgAS loci of the ‘new’ Bordetella species

B. pertussis B. avium B. holmesii B. trematum B. hinzii

3720

Fig. 1. Schematic representation of the genomic organization of the bvgAS loci of B. pertussis, B. avium, B. holmesii, B. trematum and B. hinzii. Arrows represent coding sequences; non-coding DNA is indicated as thin lines. Rectangles indicate incomplete sequencing of the bvgS and bvgA genes of B. trematum and B. hinzii, respectively. The sequence of orfX was not determined completely. The complete genome sequence of B. pertussis and B. avium was determined by the Sanger Centre (Parkhill et al., 2003; http://www. sanger.ac.uk/Projects/B_avium). The figure is not drawn to scale. Microbiology 150

BvgAS two-component system of B. holmesii

gene are considered as wild-type strains, while strains carrying the frameshift mutation are classified as phase variants. However, after the insertion of a kanamycinresistance cassette into the bvgABH gene of the B. holmesii wild-type strain G7702, the resulting bvgABH mutant strain B. holmesii G7702/bvgABH : : kan displayed growth behaviour and colony morphology indistinguishable from its parent strain and from the other B. holmesii strains mentioned above. The cytoplasmic signalling domains of BvgSBH and BvgSBP are functionally interchangeable It has been shown already that the bvgAS loci of B. pertussis and B. bronchiseptica can replace each other in vivo (Monack et al., 1989; Martinez de Tejada et al., 1996). To investigate whether the bvgASBH genes of B. holmesii are able to functionally complement B. pertussis bvgAS mutants, we introduced plasmid pRK-bvgASBH G7702, containing the orfX-bvgAS intergenic region and the entire bvgAS locus of B. holmesii G7702 (bvgASBH G7702) into the B. pertussis strains 359 and 347 by conjugation. BP 359 contains a polar Tn5 insertion in the bvgABP gene and is therefore unable to express both the BvgABP and the BvgSBP proteins. In BP 347, the bvgSBP gene is disrupted, resulting in the low-level expression of BvgABP due to the presence of a weak constitutive promoter upstream of bvgASBP (Scarlato et al., 1991); however, BvgABP is present in its non-phosphorylated and therefore inactive state (Fig. 2a). Expression of the B. holmesii bvgASBH locus in BP 359(pRKbvgASBH G7702) was proven by RT-PCR experiments and Western blotting with a BvgABH-specific polyclonal antibody which also recognizes BvgABP (data not shown). BP 359(pRK-bvgASBH G7702) and BP 347(pRK-bvgASBH G7702) were compared with the positive control strains BP 347(pLA57vir) and BP 359(pLA57vir), which are complemented with the wild-type bvgASBP locus for the ability to express the virulence determinants FhaB and Cya (adenylate cyclase toxin). Strain BP 347(pRK-bvgASBH G7702) but not BP 359(pRK-bvgASBH G7702) formed small haemolytic colonies on BG-blood agar plates and produced FhaB, as determined by immunoblot analysis (Fig. 2b). The failure of strain BP 359(pRK-bvgASBH G7702) to activate fhaB transcription was also confirmed by primer extension experiments with an fhaB-specific oligonucleotide primer and RNA prepared from BP 359(pRK-bvgASBH G7702) (data not shown). These data suggest that, despite the high degree of sequence similarity, BvgABH can not functionally substitute for BvgABP in B. pertussis in vivo, while BvgSBH can replace BvgSBP in the phosphorylation of BvgABP. To confirm that the successful complementation in BP 347(pRK-bvgASBH G7702) was due to cross-phosphorylation between BvgSBH and BvgABP, plasmid pRK-bvgASBH ATCC 51541, carrying the bvgASBH locus of the bvgA phase variant B. holmesii ATCC 51541, was introduced into BP 347 by conjugation. As expected, the resulting strain BP 347(pRKbvgASBH ATCC 51541) was haemolytic on BG blood agar plates http://mic.sgmjournals.org

and expressed FhaB (data not shown). In keeping with these results, efficient cross-phosphorylation between the purified BvgSBP and BvgABH proteins was also observed in vitro (data not shown). Since it is well known that high concentrations of MgSO4 inhibit the histidine kinase activity of BvgSBP (Melton & Weiss, 1989), strain BP 347(pRK-bvgASBH ATCC 51541) was analysed for the activity of histidine kinase BvgSBH in the presence of MgSO4. The effect of MgSO4 on the phosphorylation status of BvgSBH ATCC 51541, and consequently on the expression of the virulence genes, was investigated by primer extension experiments using the fhaB-specific primer and RNA extracted from BP 347(pRK-bvgASBH ATCC 51541) cells cultured in the presence or absence of 50 mM MgSO4. As shown in Fig. 2(c), addition of MgSO4 to the culture medium completely repressed fhaB transcription in the positive control strain BP 347(pLA57vir), while transcription of fhaB was only slightly reduced under these growth conditions in BP 347(pRK-bvgASBH ATCC 51541). Taken together these data demonstrate that the cytoplasmic signalling domains of BvgSBP and BvgSBH are functionally interchangeable, while differences exist regarding the function of their N-terminal signal-perception domains. BvgABH binds in vitro to the orfX-bvgASBH intergenic region but not to the BvgABP binding site of the fhaB promoter of B. pertussis The results of the complementation experiments suggest that the failure of plasmid pRK415-bvgASBH G7702 to restore virulence gene expression in the B. pertussis mutant BP 359 is due to the inability of BvgABH to bind to the fhaB and cya promoters. Therefore, we investigated, by gel retardation experiments, the in vitro binding of BvgABH to a 77 bp DNA fragment containing the well-characterized BvgABP binding site of the promoter region of the B. pertussis fhaB gene. A clear band shift of the fhaB probe was observed with the purified BvgA of B. pertussis, irrespective of whether the protein was in vitro phosphorylated with acetyl phosphate prior to the binding assay, as has been described by Zu et al. (1996) (Fig. 3b). In contrast, no binding to the fhaB promoter fragment could be detected with either the unphosphorylated or the phosphorylated BvgABH protein (Fig. 3a), suggesting that BvgA of B. holmesii is unable to recognize canonical BvgABP-dependent promoters. In keeping with this hypothesis, we could not detect binding of BvgABH to the bvgABP promoter region in gel retardation experiments (data not shown). As transcription of the bvgAS locus is autoregulated in the members of the B. bronchiseptica cluster (Scarlato et al., 1990; Karimova & Ullmann, 1997), we analysed whether BvgABH is able to bind the intergenic region between orfX and bvgASBH in B. holmesii. DNase I footprint experiments, with increasing amounts of BvgABH, were performed on a cloned 253 bp DNA segment spanning from nucleotide position +20 to 2232 with respect to the translational start site of bvgABH. Addition of 180 ng in vitro-phosphorylated 3721

G. Gerlach and others

Fig. 2. Complementation of B. pertussis bvgAS mutants with the B. holmesii bvgASBH locus in trans. (a) Schematic representation of the bvgAS loci in the complemented B. pertussis strains. The bvgAS genes of B. pertussis and B. holmesii are indicated by filled and open bars, respectively. The sites of the Tn5 transposon insertions in the bvgASBP genes are indicated by arrows; crosses indicate inactivation of the bvgASBP genes due to the transposon insertion itself, a polar effect on the downstream gene or the frameshift mutation in bvgABH ATCC 51541. The phenotypes of the complemented B. pertussis strains are shown on the right. Haemolysis was determined on BG agar plates supplemented with 20 % horse blood. FhaB expression was determined by immunoblot analysis. (b) Immunoblot analysis of protein lysates of B. pertussis TI (lane 1), BP 347 (lane 2), BP 347(pLA57vir) (lane 3), BP 347(pRK-bvgASBH G7702) (lane 4), BP 359 (lane 5), BP 359(pLA57vir) (lane 6) and BP 359(pRK-bvgASBH G7702) (lane 7). Hybridization was done with a polyclonal antiserum directed against the filamentous haemagglutinin (FhaB). The arrow indicates the FhaB protein. (c) Analysis of fhaB transcription in BP 347(pLA57vir) and BP 347(pRK-bvgASBH ATCC 51541) grown under modulating conditions. Primer extension experiments, with the fhaB-specific oligonucleotide fhaB-PE, were performed on equal amounts of RNA extracted from BP 347 (lane 1) and BP 347(pLA57vir) (lanes 2 and 3) and BP 347(pRK-bvgASBH ATCC 51541) (lanes 4 and 5) which had, for lanes 3 and 5, been grown in the presence of 50 mM MgSO4. The arrow indicates the fhaB-specific cDNA.

BvgABH (BvgABH-P) resulted in a region of DNase I protection ranging from position 270 to 2195 with respect to the start codon of bvgABH, with the appearance of a regular pattern of hypersensitive sites every 10 to 11 nucleotides (Fig. 4). No further extension of the protected region was observed upon the addition of higher amounts of BvgABH-P. This was tested by using additional overlapping DNA probes covering an entire region ranging from position +81 to 2313 with respect to the bvgABH start codon (data not shown). Binding of unphosphorylated BvgABH to the bvgASBH promoter probe could not be detected (Fig. 4). Interestingly, a virtually identical binding pattern was observed when in vitro-phosphorylated BvgA 3722

from B. pertussis was added to the bvgASBH promoter probe (data not shown). As in the case of BvgABH, unphosphorylated BvgABP was unable to bind to the bvgASBH promoter region (data not shown). Careful in silico analysis of the 125 bp region which is protected from DNase I digestion in the orfX-bvgASBH intergenic region revealed the presence of four 14 bp sequence motifs (IR1–IR4) which are arranged at a regular spacing of 20–21 bp from each other. These sequence motifs bear a certain resemblance to the consensus heptanucleotide inverted-repeat sequence which constitutes the primary binding site for BvgABP in BvgABP-dependent B. Microbiology 150

BvgAS two-component system of B. holmesii

Fig. 3. Binding of BvgABH and BvgABP to the BvgABP binding site of the B. pertussis fhaB promoter. (a) A radiolabelled 77 bp PCR fragment containing the BvgABP binding site of the fhaB promoter of B. pertussis was incubated with 80, 160, 240, 360 and 600 ng of purified BvgABH which was phosphorylated in vitro (lanes 2–6) and with unphosphorylated BvgABH (lanes 7–11), respectively. (b) The same radiolabelled fhaB promoter fragment was incubated with 80, 160, 240, 360 and 600 ng of in vitro phosphorylated (lanes 2–6) and unphosphorylated (lanes 7–11) BvgABP, respectively. Lane 1 on both panels contains the radiolabelled DNA probe. The reaction mixtures were run on a non-denaturing 4 % polyacrylamide gel. F, free DNA; C, DNA–protein complex.

pertussis promoters, as one half site of each sequence motif matches the BvgABP consensus half site motif in six (IR1, IR2), or four (IR3, IR4) out of seven positions (Fig. 5). The second half site, however, does not show significant similarity to the BvgABP consensus binding site. Therefore, the 14 bp sequence motifs, which all exhibit similar binding affinities for BvgABH at least under the conditions of in vitro DNA binding, might represent the primary binding sites of BvgABH in the orfX-bvgASBH intergenic region.

Taken together, the results on the binding of BvgABH to the orfX-bvgASBH intergenic region suggest an autoregulatory role for BvgABH in the expression of the BvgAS twocomponent system of B. holmesii. BvgABH activates transcription of the bvgASBH locus in B. holmesii To analyse whether the bvgAS locus of B. holmesii is autoregulated, primer extension experiments were performed with RNA extracted from B. holmesii strain G7702 and the isogenic bvgA knockout mutant G7702/bvgABH : : kan, using a bvgABH-specific oligonucleotide. As shown in Fig. 6(a), two transcriptional start sites could be identified at positions 220 (S1) and 234 (S2) with respect to the translational start codon of bvgABH. Upstream of both start sites, putative 210 regions are present which exhibit one (P2: CATAAT) and two (P1: TAAAAC) mismatches compared to the 210 consensus promoter element of E. coli. These putative 210 elements are located at a distance of 27 and 42 bp, respectively, from the IR1 sequence motif, within the region which is protected from DNase I digestion Fig. 4. Binding of BvgABH to the intergenic region between orfX and bvgASBH. DNase I footprint experiments were performed on a 253 bp BamHI–KpnI DNA fragment from plasmid pGEM-T-FP labelled at its BamHI site. The 59-labelled probe was incubated with 180, 360 and 600 ng in vitrophosphorylated BvgABH (BvgABH-P; lanes 3–5, respectively) or the same amounts of unphosphorylated BvgABH (lanes 6–8, respectively). No protein was added to the reaction mixture loaded in lane 2. Lane 1 is a G+A sequencing reaction on the DNA probe used as a size marker (Maxam & Gilbert, 1977). Numbers on the left indicate the distance from the translational start codon of bvgABH. The vertical bar on the right indicates the area of DNase I protection.

http://mic.sgmjournals.org

3723

G. Gerlach and others

Fig. 5. Representation of the intergenic region between orfX and the bvgAS locus of B. holmesii. Partial amino acid sequences of OrfX and BvgABH are given below the coding DNA sequences. The ATG start codon is shown in bold letters. Transcriptional start sites of the BvgABH-dependent promoters P1 (S1) and P2 (S2) of bvgABH are marked by arrows. Putative ”10 promoter elements are boxed. The region protected from DNase I digestion in footprint experiments with BvgABH-P is highlighted by grey shading. The 14 bp sequence motifs showing similarity to the inverted-repeat sequence representing the consensus BvgABP binding site (IR1–IR4) are indicated by horizontal arrows within the double-stranded DNA sequence, and the high-scoring half-site of each sequence motif is highlighted by bold letters in the nucleotide sequence. The distances between the IR1-IR4 motifs are indicated above the sequence. The broken arrow marked SP indicates the transcriptional start site of gfp transcribed from the bvgASBHup-gfp promoter fusion in BP 359(pMMB-bvgASBHup-gfp). The ”10 element of the corresponding putative promoter is also boxed.

in the footprint experiments performed with BvgABH (Fig. 5). The amount of bvgABH-specific transcript was clearly reduced in G7702/bvgABH : : kan, suggesting a positive autoregulatory effect of BvgABH on the transcription of bvgASBH in B. holmesii. To confirm these results, a DNA fragment comprising 455 bp of the 59 region of bvgASBH was fused to a promoterless gfp gene in the broad-hostrange vector pMMB208 and the resulting plasmid pMMBbvgASBHup-gfp was conjugated into B. holmesii G7702 and G7702/bvgABH : : kan. Expression of the reporter gene was investigated by immunoblot analysis using a polyclonal antibody directed against GFP. Consistent with the results of the primer extension experiments, expression of the gfp reporter gene was clearly reduced in the bvgA mutant G7702/bvgABH : : kan as compared to the wild-type strain G7702 (Fig. 6b), corroborating positive autoregulation by BvgABH. The pMMB-bvgASBHup-gfp reporter plasmid was also introduced into the B. pertussis strains Tohama I (TI), BP 347 and BP 359. Expression of GFP was hardly detectable by immunoblot analysis in the wild-type strain TI(pMMBbvgASBHup-gfp), while strong expression of the reporter gene was observed in the bvgAS mutant BP 359(pMMBbvgASBHup-gfp). Mutant BP 347(pMMB-bvgASBHup-gfp), harbouring a Tn5 insertion in the bvgSBP gene and therefore expressing unphosphorylated BvgABP, produced a significantly lower amount of GFP than BP 359(pMMBbvgASBHup-gfp) (Fig. 7a). In contrast to the positive 3724

autoregulation exerted by BvgABH in B. holmesii, these data suggest that binding of BvgABP to the bvgASBH promoter region represses the transcription of the gfp reporter gene in B. pertussis. Primer extension analysis performed with RNA extracted from BP 359(pMMBbvgASBHup-gfp) using a gfp-specific oligonucleotide demonstrated that transcription of gfp starts at position 2139 with respect to the translational start codon of bvgABH (Fig. 7b). This transcriptional start site corresponds to a promoter which is different from the promoters directing transcription of bvgASBH in B. holmesii and which is located within the region protected in DNase I footprint experiments by the BvgABP protein on the bvgASBH promoter probe. The putative 210 (TATGCT) and 235 (TATTCA) boxes of this promoter differ in two and three positions, respectively, from the E. coli 210 and 235 consensus promoter elements. Therefore, it seems likely that binding of BvgABP to the bvgASBH promoter region in B. pertussis interferes with the binding of the RNA polymerase to this B. pertussisspecific promoter located in the bvgASBH upstream region. Interestingly, a transcriptional start site differing only slightly (position 2130) from the one used in B. pertussis is observed when transcription of the bvgASBH-gfp promoter fusion is analysed in E. coli (data not shown).

DISCUSSION The regulatory BvgAS two-component system is the master regulator of virulence gene expression in the members of Microbiology 150

BvgAS two-component system of B. holmesii

Fig. 6. Characterization of the bvgAS promoter of B. holmesii. (a) Determination of the transcriptional start site of bvgASBH by primer extension analysis. Equal amounts of total RNA extracted from B. holmesii G7702 (lane 1) and B. holmesii G7702/ bvgABH : : kan (lane 2) were hybridized with radiolabelled oligonucleotide bvgABH-PE. Transcriptional start points are indicated by arrows. A part of the promoter sequence is shown on the left. The corresponding putative ”10 promoter elements are boxed. The sequencing reaction (lanes A, C, G and T) was performed by using oligonucleotide bvgABH-PE and plasmid pSL-bvgASBH G7702 as template. (b) Immunoblot analysis of equal amounts of proteins prepared from E. coli(pUCbvgASBHup-gfp) (lane1), B. holmesii G7702 (lane 2), B. holmesii G7702(pMMB-bvgASBHup-gfp) (lane 3) and B. holmesii G7702/bvgABH : : kan(pMMB-bvgASBHup-gfp) (lane 4). The membrane was probed with a polyclonal antiserum directed against GFP. The arrow indicates the positions of the GFPspecific band.

the B. bronchiseptica cluster which cause respiratory tract infections in man and other mammals, and has been demonstrated to play a critical role in the establishment and maintenance of disease (Cotter & DiRita, 2000; Bock et al., 2001). Since the ‘new’ members of the genus Bordetella, in particular B. holmesii, are increasingly recognized to be associated with human diseases, we set out to clone putative orthologues of the bvgAS genes of these bacteria as a first approach to characterize their pathogenic potential. By PCR with degenerate oligonucleotide primers derived from the BvgA sequence of B. pertussis, we obtained bvgAspecific DNA fragments from the three organisms; these fragments were used as probes for the cloning of the complete bvgAS locus from B. holmesii and of partial sequences of bvgAS from B. trematum and B. hinzii. At the DNA level, the bvgAS genes of the three ‘new’ Bordetella species show only limited sequence similarity with their orthologues from the members of the B. bronchiseptica cluster, explaining our previous failure to prove their presence by DNA hybridization experiments with B. pertussis-specific DNAprobes (Gerlach et al., 2001). However, as far as they were http://mic.sgmjournals.org

Fig. 7. Expression of the gfp reporter gene fused to the bvgASBH promoter in B. pertussis. (a) Immunoblot analysis of GFP expression in E. coli(pUC-bvgASBHup-gfp) (lane 1), BP TI (lane 2), BP TI(pMMB-bvgASBHup-gfp) (lane 3), BP 347 (lane 4), BP 347(pMMB-bvgASBHup-gfp) (lane 5), BP 359 (lane 6), BP 359(pMMB-bvgASBHup-gfp) (lane 7). Equal amounts of protein were blotted and were probed with a polyclonal antiserum directed against GFP. The arrow indicates the positions of the GFP-specific band. (b) Determination of the transcriptional start site of the gfp reporter gene fused to the upstream region of bvgASBH of B. holmesii by primer extension analysis. Equal amounts of total RNA extracted from B. pertussis 347(pMMB-bvgASBHup-gfp) (lane 1) and B. pertussis 359(pMMB-bvgASBHup-gfp) (lane 2) were hybridized with radiolabelled oligonucleotide gfp-PE. The transcriptional start point is indicated by an arrow. A part of the bvgASBH promoter sequence is shown on the left. The corresponding putative ”10 promoter element is boxed. The sequencing reaction (lanes A, C, G and T) was performed using oligonucleotide gfp-PE and plasmid pUC-bvgASBHup-gfp as template.

determined, the deduced amino acid sequences of BvgAS were found to be conserved between all species including the bird pathogen B. avium whose bvgAS genes have recently been cloned (Spears et al., 2003). As expected, sequence similarity is highest in the two-component signalling modules but is less pronounced in the recently characterized linker region of BvgA (Bock et al., 2001) and the sensory domain of BvgS. Clearly the BvgAS proteins of the ‘new’ Bordetella species and of B. avium are more closely related to each other than to the orthologous proteins of the members of the B. bronchiseptica cluster (Table 3). Similarly, the genomic organization of the bvgAS loci of the ‘new’ Bordetella species and of B. avium seems to be identical, but differs from the members of the B. bronchiseptica cluster. In the ‘new’ Bordetella species and in B. avium, a gene (orfX) encoding a putative response regulator protein was observed upstream of bvgAS, and downstream no orthologue of the gene encoding the BvgR protein, which is involved in regulating the virulence repressed genes (vrg) in the members of the B. bronchiseptica cluster, is present in B. holmesii and B. avium (Fig. 1). The upstream regulator is also present in B. bronchiseptica and B. parapertussis, although at a different location on the chromosome, while it is missing in B. pertussis. 3725

G. Gerlach and others

Table 3. Similarity between the BvgA and BvgS proteins from different Bordetella species Pairwise identity and similarity (in parentheses) between the two-component proteins from the respective Bordetella species are given as percentages. In the case of BvgS, pairwise identity and similarity between the cytoplasmic signalling domains of the respective sensor proteins is also shown. Similarity in BvgA

B. B. B. B.

pertussis avium holmesii trematum

B. pertussis

B. avium

B. holmesii

B. trematum

– – – –

75?5 (82?8) – – –

76?0 (84?8) 93?2 (94?2) – –

75?0 (83?2) 91?8 (94?2) 92?3 (95?7) –

Similarity in BvgS/BvgScyt

B. pertussis B. avium B. holmesii

B. pertussis

B. avium

B. holmesii

– – –

45?0 (54?0)/51?7 (61?0) – –

46?8 (54?9)/52?9 (61?3) 63?0 (70?2)/66?4 (73?1) –

Unexpectedly, 16S rDNA sequence analysis had suggested that the closest phylogenetic relationship was between B. pertussis and B. holmesii (Weyant et al., 1995; Gerlach et al., 2001); however, in agreement with comparisons of the amino acid sequences of conserved proteins (von Wintzingerode et al., 2002), our characterization of the bvgAS loci clearly classifies B. holmesii as proximate to the species B. avium, B. hinzii and B. trematum. Interestingly, the bvgA sequences of two out of four independent clinical isolates of B. holmesii contained an identical point mutation causing a frameshift that results in the premature termination of the encoded protein. This is reminiscent of phase variation in B. pertussis and B. bronchiseptica leading to the loss of virulence properties upon in vitro passaging of the respective strains due to mutations in the bvgS genes (Monack et al., 1989; Stibitz et al., 1989). However, phase variants of these organisms have apparently never been isolated from infected hosts. Since inactivation of the bvgA gene in B. holmesii G7702 had no obvious effect on growth and colony morphology of the mutant, the possibility that frameshift mutations in strains ATCC 51541 and No1 occurred after their isolation from the infected patients can not be ruled out. But, since the site of the mutation is not associated with a homo- or dinucleotide tract which could cause slipped-strand mispairing, it seems rather unlikely that the identical insertion mutation should have occurred in both strains as a consequence of in vitro culture. The apparent isolation of bvgA mutants from infected individuals would clearly argue against a role of the BvgASBH two-component system in the regulation of important virulence traits in B. holmesii, while inactivation of bvgASBA caused a clear attenuation of the virulence of B. avium in turkey poults (Spears et al., 2003). Interestingly, Njamkepo et al. (2000) reported differences in the protein hybridization patterns of different B. holmesii isolates, including the type strain, ATCC 51541, 3726

and G7702, when the bacterial lysates were probed with sera from infected individuals, and therefore they suggested that the phenomenon of phase variation might exist in B. holmesii. However, the observed differences in the protein patterns do not correlate with the presence or absence of a functional BvgABH protein as predicted by our sequence analysis of the same strains. The observation that the bvgASBH locus is able to restore virulence gene expression in the B. pertussis bvgS mutant BP 347 but not in the bvgAS mutant BP 359 suggested crossphosphorylation between the BvgSBH histidine kinase and BvgABP (Fig. 2). Similarly, cross-phosphorylation was also demonstrated to occur between BvgSBP and BvgABH in vitro (data not shown). Therefore, the cytoplasmic signalling domains of BvgSBH and BvgSBP, showing 52?9 % identity, are functionally interchangeable in the recognition of the orthologous BvgA response regulator proteins, whose receiver domains are 76?2 % identical. In the genetic background of BP 347, BvgSBH is only slightly responsive to the presence of 50 mM MgSO4, which causes phenotypic modulation in the wild-type B. pertussis strain TI. Therefore, in accordance with the observation that the periplasmic input domains of BvgSBH and BvgSBP show a far lower degree of similarity (39?5 % identity) than the cytoplasmic domains, signal perception of the BvgS proteins from B. holmesii and B. pertussis seems to be different. Similarly, in the genetic background of B. bronchiseptica, the function of the BvgSBP protein was indistinguishable from BvgSBB when the expression of virulence factors, under either standard in vitro culture conditions or in vivo growth in an animal model, was investigated, but the sensitivity to modulating agents in vitro was different between BvgSBB and BvgSBP (Martinez de Tejada et al., 1996). BvgSBB and BvgSBP are highly similar (87 % overall identity), but, as seen with BvgSBH and BvgSBP, most of the non-conservative amino Microbiology 150

BvgAS two-component system of B. holmesii

acid substitutions occur in the periplasmic domain which has been shown to be solely responsible for the observed differences in the sensitivity to modulating signals (Martinez de Tejada et al., 1996). In contrast to the cytoplasmic signalling domains of BvgSBP and BvgSBH, the BvgA response regulators are not functionally interchangeable between B. pertussis and B. holmesii. The observations that the B. pertussis bvgAS mutant BP 359 could not be complemented to virulence gene expression by the presence of the bvgAS locus of B. holmesii in trans (Fig. 2) and that BvgABH did not bind to the BvgABP binding sites of the B. pertussis fhaB (Fig. 3) and bvgA (data not shown) promoters in vitro, indicate that BvgABH is unable to productively interact with BvgA-dependent promoters of B. pertussis which are characterized by the presence of multiple BvgABP binding sites. The fhaB promoter contains an imperfect heptanucleotide inverted-repeat sequence with abutting half-sites centred at position 288?5 relative to the transcriptional start site, which is the high-affinity binding site of a BvgABP-P dimer, as well as two additional low-affinity binding sites centred at position 267?5 and directly adjacent to the 235 region (Boucher et al., 2001, 2003). These secondary binding sites show a very limited degree of similarity to the high-affinity heptanucleotide inverted-repeat motif, but binding of BvgABP-P to the low-affinity binding sites is required for full transcriptional activation of the fhaB promoter (Boucher et al., 1997, 2001). Similarly, the ptx promoter harbours two inverted heptad repeats in the region ranging from position 2167 to 2123 relative to the transcriptional start site. These repeats match the fhaB high-affinity binding motif in five of seven positions, and cooperative binding of multiple BvgABP-P dimers to the DNA downstream of these primary binding sites is necessary for the activation of ptx transcription (Boucher & Stibitz, 1995; Marques & Carbonetti, 1997). Differences in the affinity of the BvgABP binding sites in the fhaB and ptx promoters, resulting in the requirement of higher concentrations of BvgABP-P for transcriptional activation of ptx, account for the different temporal pattern of expression of these virulence genes (Scarlato & Rappuoli, 1991). Here we demonstrate that in B. holmesii transcription of bvgASBH is under control of two overlapping promoters which are positively regulated by BvgABH, since transcription of bvgASBH and expression of a gfp reporter gene which was fused to the bvgASBH promoter region were reduced in the bvgABH mutant G7702/bvgABH : : kan (Fig. 6). However, basal BvgABH-independent transcription from these promoters was also detected in G7702/ bvgABH : : kan, and this might be responsible for low-level expression of BvgASBH under conditions in which the BvgSBH histidine kinase is inactive. The moderate difference in the amount of bvgASBH transcript in strains G7702 and G7702/bvgABH : : kan might indicate that, in contrast to BvgSBP, BvgSBH is not fully activated under the standard in vitro culture conditions tested so far. Interestingly, the region upstream of the regulated bvgASBH http://mic.sgmjournals.org

promoters, which is protected in DNase I footprint experiments with in vitro-phosphorylated BvgABH, contains four 14 bp sequence motifs (IR1–IR4) in a regular spacing of 20–21 bp, which show similarity to the heptanucleotide inverted-repeat sequence that has been deduced as consensus motif for the primary binding site for BvgABP in BvgABP-dependent B. pertussis promoters (Fig. 5). This arrangement of binding sites might suggest end-to-end binding of BvgABH dimers to the same face of the DNA helix. The sequence motifs IR1 and IR2, showing the highest degree of similarity to the BvgABP consensus half-site motif T/A-T-T-C-C/T-T-A, are located proximal to the transcriptional start site of bvgASBH, while IR3 and IR4, which match the sequence of the consensus binding site in four of seven positions, are located further upstream. This architecture of putative high- and low-affinity BvgABH binding sites differs from the fhaB and ptx promoters, but resembles the B. pertussis core bvgR promoter, which, for activity, requires binding of BvgABP-P to a secondary binding site located at a distance of 22 bp upstream from the primary binding site, which is centred at position 253?5 proximal to the transcriptional start site. Interestingly, the BvgABP binding motifs in the bvgR promoter also consist of one half-site with high-scoring similarity to the BvgABP consensus binding motif in combination with a low-scoring half-site (Merkel et al., 2003). However, DNase I footprint experiments did not provide indications for differences in the binding affinities of sequence motifs IR1–IR4 in the bvgASBH promoter since a sharp onset of protection, spanning the complete region from position 270 to 2195 relative to the bvgABH start codon, was observed upon addition of low amounts of BvgABH. Considering the striking similarity of the bvgASBH promoter region to BvgA-dependent promoters of B. pertussis and the fact that in vitro binding of BvgABP-P to this promoter is virtually indistinguishable from BvgABH-P, the inability of BvgABH to interact with B. pertussis promoters remains unexplained. In the B. pertussis bvgAS mutant BP 359 containing the bvgASBHup-gfp promoter fusion, transcription of the gfp reporter gene is directed from a promoter different to the overlapping P1 and P2 promoters in B. holmesii. Transcription from this promoter starts within the region of BvgABH- and BvgABP-binding, unless the detected transcript is the defined processing product of a longer mRNA transcribed from a cryptic promoter located further upstream or in the plasmid backbone (Fig. 5, Fig. 7). In the B. pertussis wild-type strain TI, BvgABP-P does not stimulate transcription from the overlapping BvgABH-dependent P1 and P2 promoters, but instead binding of BvgABP-P to the upstream region of bvgASBH seems to interfere with transcription from the alternative promoter since no expression of the gfp reporter gene could be detected in TI(pMMB-bvgASBHup-gfp). Although in vitro binding of unphosphorylated BvgABP to the bvgASBH promoter region was not observed, expression of gfp was also strongly reduced in the bvgS mutant BP 347(pMMB-bvgASBHup-gfp) as compared to BP 359(pMMB-bvgASBHup-gfp) (Fig. 7). It 3727

G. Gerlach and others

should be noted that despite the inhibitory effect of BvgABP on transcription from the bvgASBH upstream region in B. pertussis, low-level expression of BvgSBH was sufficient to restore virulence gene expression in BP 347(pRK-bvgASBH G7702). We are currently trying to identify the members of the BvgA regulon of B. holmesii. The characterization of additional BvgABH-dependent promoters will help to unravel the molecular basis of the striking differences in promoter recognition observed with the highly homologous BvgA proteins of B. holmesii and B. pertussis.

ACKNOWLEDGEMENTS We would like to thank N. Guiso and E. Njamkepo for sending us B. holmesii strains. This work was supported by the Deutsche Forschungsgemeinschaft (SFB479-A2).

caused by a novel Bordetella species, ‘B. hinzii’. J Clin Microbiol 32, 2569–2571. Cormack, B. P., Valdivia, R. H. & Falkow, S. (1996). FACS-optimized

mutants of the green fluorescent protein (GFP). Gene 173, 33–38. Cotter, P. A. & DiRita, V. J. (2000). Bacterial virulence gene regula-

tion: an evolutionary perspective. Annu Rev Microbiol 54, 519–565. Dickneite, C., Bockmann, R., Spory, A., Goebel, W. & Sokolovic, Z. (1998). Differential interaction of the transcription factor PrfA and

the PrfA-activating factor (Paf) of Listeria monocytogenes with target sequences. Mol Microbiol 27, 915–928. Gerlach, G., von Wintzingerode, F., Middendorf, B. & Gross, R. (2001). Evolutionary trends in the genus Bordetella. Microbes Infect 3,

61–72. Gross, R. & Rappuoli, R. (1988). Positive regulation of pertussis

toxin expression. Proc Natl Acad Sci U S A 85, 3913–3917. Gross, R. & Rappuoli, R. (1989). Pertussis toxin promoter sequences

involved in modulation. J Bacteriol 171, 4026–4030. Hewlett, E. L. & Cowell, J. L. (1989). Evaluation of the mouse model

REFERENCES

for study of encephalopathy in pertussis vaccine recipients. Infect Immun 57, 661–663.

Aoyama, T., Murase, Y., Iwata, T., Imaizumi, A., Suzuki, Y. & Sato, Y. (1986). Comparison of blood-free medium (cyclodextrin solid

Karimova, G. & Ullmann, A. (1997). Characterization of DNA binding sites for the BvgA protein of Bordetella pertussis. J Bacteriol 179, 3790–3792.

medium) with Bordet-Gengou medium for clinical isolation of Bordetella pertussis. J Clin Microbiol 23, 1046–1048. Arico, B., Miller, J. F., Roy, C., Stibitz, S., Monack, D., Falkow, S., Gross, R. & Rappuoli, R. (1989). Sequences required for expression

of Bordetella pertussis virulence factors share homology with prokaryotic signal transduction proteins. Proc Natl Acad Sci U S A 86, 6671–6675. Bock, A. & Gross, R. (2001). The BvgAS two-component system of

Kattar, M. M., Chavez, J. F., Limaye, A. P. & 7 other authors (2000).

Application of 16S rRNA gene sequencing to identify Bordetella hinzii as the causative agent of fatal septicemia. J Clin Microbiol 38, 789–794. Keen, N. T., Tamaki, S., Kobayashi, D. & Trollinger, D. (1988).

Improved broad-host-range plasmids for DNA cloning in gramnegative bacteria. Gene 70, 191–197.

Bordetella spp.: a versatile modulator of virulence gene expression. Int J Med Microbiol 291, 119–130.

Lacey, B. W. (1960). Antigenic modulation of Bordetella pertussis.

Bock, A. & Gross, R. (2002). The unorthodox histidine kinases BvgS

Leslie, P. H. & Gardner, A. D. (1931). The phases of Haemophilus

and EvgS are responsive to the oxidation status of a quinone electron carrier. Eur J Biochem 269, 3479–3484.

Marques, R. R. & Carbonetti, N. H. (1997). Genetic analysis of

Bock, A., Bantscheff, M., Perraud, A. L., Rippe, K., Weiss, V., Glocker, M. O. & Gross, R. (2001). Rational design and molecular

pertussis toxin promoter activation in Bordetella pertussis. Mol Microbiol 24, 1215–1224.

characterization of a chimaeric response regulator protein. J Mol Biol 310, 283–290.

Martinez de Tejada, G., Miller, J. F. & Cotter, P. A. (1996).

J Hyg 58, 57–93. pertussis. J Hyg 31, 423–434.

Bordet, J. & Gengou, O. (1909). Le microbe de la coqueluche. Ann

Comparative analysis of the virulence control systems of Bordetella pertussis and Bordetella bronchiseptica. Mol Microbiol 22, 895–908.

Inst Pasteur 20, 731–741.

Maxam, A. M. & Gilbert, W. (1977). A new method for sequencing

Boucher, P. E. & Stibitz, S. (1995). Synergistic binding of RNA

DNA. Proc Natl Acad Sci U S A 74, 560–564.

polymerase and BvgA phosphate to the pertussis toxin promoter of Bordetella pertussis. J Bacteriol 177, 6486–6491.

Mazengia, E., Silva, E. A., Peppe, J. A., Timperi, R. & George, H. (2000). Recovery of Bordetella holmesii from patients with pertussis-

Boucher, P. E., Murakami, K., Ishihama, A. & Stibitz, S. (1997).

like symptoms: use of pulsed-field gel electrophoresis to characterize circulating strains. J Clin Microbiol 38, 2330–2333.

Nature of DNA binding and RNA polymerase interaction of the Bordetella pertussis BvgA transcriptional activator at the fha promoter. J Bacteriol 179, 1755–1763. Boucher, P. E., Yang, M. S., Schmidt, D. M. & Stibitz, S. (2001).

Melton, A. R. & Weiss, A. A. (1989). Environmental regulation of

expression of virulence determinants in Bordetella pertussis. J Bacteriol 171, 6206–6212.

Genetic and biochemical analyses of BvgA interaction with the secondary binding region of the fha promoter of Bordetella pertussis. J Bacteriol 183, 536–544.

Analysis of bvgR expression in Bordetella pertussis. J Bacteriol 185, 6902–6912.

Boucher, P. E., Maris, A. E., Yang, M. S. & Stibitz, S. (2003). The

Monack, D. M., Arico, B., Rappuoli, R. & Falkow, S. (1989). Phase

response regulator BvgA and RNA polymerase alpha subunit Cterminal domain bind simultaneously to different faces of the same segment of promoter DNA. Mol Cell 11, 163–173.

variants of Bordetella bronchiseptica arise by spontaneous deletions in the vir locus. Mol Microbiol 3, 1719–1728.

Chang, A. C. & Cohen, S. N. (1978). Construction and characteriza-

Merkel, T. J., Boucher, P. E., Stibitz, S. & Grippe, V. K. (2003).

Morales, V. M., Backman, A. & Bagdasarian, M. (1991). A series of

wide-host-range low-copy-number vectors that allow direct screening for recombinants. Gene 97, 39–47.

tion of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol 134, 1141–1156.

Morel-Deville, F., Ehrlich, S. D. & Morel, P. (1997). Identification by

Cookson, B. T., Vandamme, P., Carlson, L. C., Larson, A. M., Sheffield, J. V., Kersters, K. & Spach, D. H. (1994). Bacteremia

PCR of genes encoding multiple response regulators. Microbiology 143, 1513–1520.

3728

Microbiology 150

BvgAS two-component system of B. holmesii

Njamkepo, E., Delisle, F., Hagege, I., Gerbaud, G. & Guiso, N. (2000). Bordetella holmesii isolated from a patient with sickle cell

anemia: analysis and comparison with other Bordetella holmesii isolates. Clin Microbiol Infect 6, 131–136. Parkhill, J., Sebaihia, M., Preston, A. & 50 other authors (2003).

Stibitz, S. & Yang, M. S. (1991). Subcellular localization and

immunological detection of proteins encoded by the vir locus of Bordetella pertussis. J Bacteriol 173, 4288–4296. Stibitz, S., Aaronson, W., Monack, D. & Falkow, S. (1989). Phase

variation in Bordetella pertussis by frameshift mutation in a gene for a novel two-component system. Nature 338, 266–269.

Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet 35, 32–40.

Tang, Y. W., Hopkins, M. K., Kolbert, C. P., Hartley, P. A., Severance, P. J. & Persing, D. H. (1998). Bordetella holmesii-like organisms

Parton, R. (1999). Review of the biology of Bordetella pertussis. Biologicals 27, 71–76.

associated with septicemia, endocarditis, and respiratory failure. Clin Infect Dis 26, 389–392.

Peppler, M. S. (1982). Isolation and characterization of isogenic pairs of domed hemolytic and flat nonhemolytic colony types of Bordetella pertussis. Infect Immun 35, 840–851.

Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic

Peppler, M. S. & Schrumpf, M. E. (1984). Isolation and characterization of Bordetella pertussis phenotype variants capable of growing on nutrient agar: comparison with phases III and IV. Infect Immun 43, 217–223. Perraud, A. L., Kimmel, B., Weiss, V. & Gross, R. (1998). Specifi-

city of the BvgAS and EvgAS phosphorelay is mediated by the C-terminal HPt domains of the sensor proteins. Mol Microbiol 27, 875–887. Sambrook, J. & Russell, D. (2000). Molecular Cloning: a Laboratory

Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Scarlato, V. & Rappuoli, R. (1991). Differential response of the bvg

virulence regulon of Bordetella pertussis to MgSO4 modulation. J Bacteriol 173, 7401–7404. Scarlato, V., Prugnola, A., Arico, B. & Rappuoli, R. (1990). Positive

transcriptional feedback at the bvg locus controls expression of virulence factors in Bordetella pertussis. Proc Natl Acad Sci U S A 87, 6753–6757. Scarlato, V., Prugnola, A., Arico, B. & Rappuoli, R. (1991). The

bvg-dependent promoters show similar behaviour in different Bordetella species and share sequence homologies. Mol Microbiol 5, 2493–2498.

transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76, 4350–4354. Uhl, M. A. & Miller, J. F. (1996). Integration of multiple domains

in a two-component sensor protein: the Bordetella pertussis BvgAS phosphorelay. EMBO J 15, 1028–1036. Vandamme, P., Heyndrickx, M., Vancanneyt, M., Hoste, B., De Vos, P., Falsen, E., Kersters, K. & Hinz, K. H. (1996).

Bordetella trematum sp. nov., isolated from wounds and ear infections in humans, and reassessment of Alcaligenes denitrificans Ru¨ger and Tan 1983. Int J Syst Bacteriol 46, 849–858. Vandamme, P., Hommez, J., Vancanneyt, M., Monsieurs, M., Hoste, B., Cookson, B., Wirsing von Konig, C. H., Kersters, K. & Blackall, P. J. (1995). Bordetella hinzii sp. nov., isolated from poultry

and humans. Int J Syst Bacteriol 45, 37–45. von Wintzingerode, F., Schattke, A., Siddiqui, R. A., Ro¨sick, U., Go¨bel, U. B. & Gross, R. (2001). Bordetella petrii sp. nov., isolated

from an anaerobic bioreactor, and emended description of the genus Bordetella. Int J Syst Evol Microbiol 51, 1257–1265. von Wintzingerode, F., Gerlach, G., Schneider, B. & Gross, R. (2002). Phylogenetic relationships and virulence evolution in the

genus Bordetella. Curr Top Microbiol Immunol 264, 177–199. Weiss, A. A. (1992). In The Prokaryotes, pp. 2530–2543. Edited by

A. Balows, H. G. Tru¨per, M. Dworkin, W. Harder & K.-H. Schleifer. New York: Springer.

Shepard, C. W., Daneshvar, M. I., Kaiser, R. M. & 7 other authors (2004). Bordetella holmesii bacteremia: a newly recog-

Weiss, A. A. & Falkow, S. (1984). Genetic analysis of phase change

nized clinical entity among asplenic patients. Clin Infect Dis 38, 799–804.

Weiss, A. A., Hewlett, E. L., Myers, G. A. & Falkow, S. (1983).

Simon, R., Priefer, U. & Pu¨hler, A. (1983). A broad host range

mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Biotechnology. 1, 784–791. Skeeles, J. K. & Arp, L. H. (1988). In Diseases of Poultry, pp. 275–288.

Edited by B. W. Calnck and others. Ames, IA: University of Iowa Press. Spears, P. A., Temple, L. M., Miyamoto, D. M., Maskell, D. J. & Orndorff, P. E. (2003). Unexpected similarities between Borde-

tella avium and other pathogenic Bordetellae. Infect Immun 71, 2591–2597. Stainer, D. W. & Scholte, M. J. (1970). A simple chemically defined

medium for the production of phase I Bordetella pertussis. J Gen Microbiol 63, 211–220.

http://mic.sgmjournals.org

in Bordetella pertussis. Infect Immun 43, 263–269. Tn5-induced mutations affecting virulence factors of Bordetella pertussis. Infect Immun 42, 33–41. Weyant, R. S., Hollis, D. G., Weaver, R. E. & 7 other authors (1995).

Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. J Clin Microbiol 33, 1–7. Yih, W. K., Silva, E. A., Ida, J., Harrington, N., Lett, S. M. & George, H. (1999). Bordetella holmesii-like organisms isolated from

Massachusetts patients with pertussis-like symptoms. Emerg Infect Dis 5, 441–443. Zu, T., Manetti, R., Rappuoli, R. & Scarlato, V. (1996). Differential

binding of BvgA to two classes of virulence genes of Bordetella pertussis directs promoter selectivity by RNA polymerase. Mol Microbiol 21, 557–565.

3729