Genetic diversity in a reintroduced swift fox population | SpringerLink

Conserv Genet (2013) 14:93–102 DOI 10.1007/s10592-012-0429-8

RESEARCH ARTICLE

Genetic diversity in a reintroduced swift fox population Indrani Sasmal • Jonathan A. Jenks • Lisette P. Waits • Michael G. Gonda • Greg M. Schroeder • Shubham Datta

Received: 3 June 2012 / Accepted: 10 November 2012 / Published online: 27 November 2012 Ó Springer Science+Business Media Dordrecht 2012

Abstract Swift fox (Vulpes velox) were historically distributed in southwestern South Dakota including the region surrounding Badlands National Park (BNP). The species declined during the mid-1800s, largely due to habitat loss and poisoning targeted at wolves (Canis lupus) and coyotes (Canis latrans). Only a small population of swift foxes near Ardmore, which is located in Fall River County, South Dakota, persisted. In 2003, a reintroduction program was initiated at BNP with swift foxes translocated from Colorado and Wyoming. Foxes released in the years 2003, 2004 and 2005 were translocated from Colorado (BNP-Colorado) whereas in 2006, released foxes were translocated from Wyoming (BNP-Wyoming). Our objective was to evaluate genetic diversity and structure of the restored swift fox population in the area surrounding BNP compared to source fox populations in an area of Colorado and Wyoming, as well as the local swift fox population

I. Sasmal (&) J. A. Jenks S. Datta Department of Natural Resource Management, South Dakota State University, Box 2140B, NPB Room 138, Brookings, SD 57007, USA e-mail: [email protected]; [email protected] L. P. Waits Fish and Wildlife Sciences, University of Idaho, Moscow, ID 83844, USA M. G. Gonda Animal and Range Sciences Department, South Dakota State University, Brookings, SD 57006, USA G. M. Schroeder Wind Cave National Park, 26611 U.S. Highway 385, Hot Springs, SD 57747, USA

neighboring BNP near Ardmore in Fall River County, South Dakota. A total of 400 swift foxes (28 released in 2003, 28 released in 2004, 26 released in 2005, 26 released in 2006, 252 wild-born foxes, 40 individual foxes from the Ardmore area of South Dakota) was genotyped using twelve microsatellite loci. We report mean gene diversity values of 0.778 (SD = 0.156) for the BNP-Colorado population, 0.753 (SD = 0.165) for the BNP-Wyoming population, 0.751 (SD = 0.171) for the BNP population, and 0.730 (SD = 0.166) for the Fall River population. We also obtained Fst values ranging from 0.014 to 0.029 for pairwise comparisons of fox populations (BNP, Fall River, BNP-Wyoming, BNP-Colorado). We conclude that the reintroduced fox population around BNP has high genetic diversity comparable to its source populations in Colorado and Wyoming. Although genetic diversity indicates that the reintroduction was successful, additional time is necessary to fully evaluate long-term genetic maintenance and interconnectivity among these populations. Keywords Genetic diversity Connectivity Allelic richness Swift fox South Dakota Vulpes velox

Introduction Populations tend to lose genetic variability when an effectively small number of individuals are used as founders for reintroductions (Wright 1931; Nei 1975). Generally, the low genetic variability takes place due to the low number of rare alleles translocated to sites, which also are especially susceptible to elimination during bottlenecks (Allendorf and Luikart 2008) or when reestablishing populations. Reduction of genetic diversity also can occur due to genetic drift, which is independent of the number of

123

94

alleles present (Allendorf and Luikart 2008). Reduction in genetic variability may cause inbreeding depression and subsequent reduced fecundity, increased mortality, reduced adaptability, and physical abnormalities (Allendorf and Ryman 2002). Thus, it is important to ascertain genetic variability in newly established populations. Swift foxes (Vulpes velox) were once abundant throughout the Great Plains of North America (Egoscue 1979). The species declined dramatically by the late 1800s (Zumbaugh and Choate 1985) and much of this decline was attributed to conversion of native prairie to agriculture and associated decline in prey species, unregulated hunting and trapping, and predator control programs aimed at larger carnivores (Kilgore 1969; Egoscue 1979; Carbyn et al. 1994; Allardyce and Sovada 2003). The present distribution of swift foxes includes a fragmented population extending from southern Wyoming through eastern Colorado, western Kansas, eastern New Mexico, the Oklahoma panhandle, northern Texas, western South Dakota, Nebraska, Canada, and northern Montana (Carbyn 1998; Swift Fox Conservation Team Annual Report 2000; Zimmerman et al. 2003). The first successful reintroduction program for swift foxes was initiated in 1983. The Canadian Wildlife Service and cooperators began a swift fox reintroduction, focusing their efforts largely on private lands in Alberta and Saskatchewan, Canada (Carbyn et al. 1994). Following the first reintroduction program in Canada, several reintroductions had been initiated in an effort to restore swift fox populations to unoccupied, yet suitable, habitat within their historic range. These reintroductions include the Blackfeet Reservation in Montana from 1999–2002 (Ausband and Foresman 2007), Fort Peck Reservation in Montana, and four reintroductions in South Dakota: Bad River Ranches (Turner Endangered Species Fund), Lower Brule Sioux Tribal Land (Lower Brule Sioux Tribe Department of Wildlife, Fish and Recreation and the Maka Foundation), Badlands National Park (BNP, Schroeder 2007), and in 2009–2010 the Pine Ridge Indian Reservation (Oglala Sioux Parks Recreation Authority). Because microsatellites are hypervariable single locus genetic markers, they can be analyzed from miniscule tissue samples using polymerase chain reaction (PCR) (Forbes and Boyd 1996). Microsatellites are valuable for population genetic studies because numerous alleles are often segregating in a population at these loci (e.g., Schlotterer et al. 1991; Ellegren 1992; Bowcock et al. 1994; Taylor et al. 1994; Morin et al. 1994; Paetkau and Strobeck 1994; Paetkau et al. 1995; Forbes and Boyd 1996). Use of DNA microsatellite loci cloned from the dog genome and ¨ strused for closely related kit fox (Vulpes macrotis) (O ander et al. 1993; Fredholm and Wintero 1995; Francisco et al. 1996; Ralls et al. 2001), and primers developed for the swift fox genome by Cullingham et al. (2007) provided

123

Conserv Genet (2013) 14:93–102

insights into swift fox population genetics (Kitchen et al. 2005). Microsatellite loci have been used previously by Kitchen et al. (2006) for understanding multiple breeding strategies in the swift fox, as well as for assessing the genetic and spatial structure within a swift fox population (Kitchen et al. 2005). Also Cullingham et al. (2010) used microsatellite loci for swift fox fecal DNA profiling, and Harrison et al. (2002) used microsatellite loci for a swift fox population survey in New Mexico. However, no study has been conducted to measure the genetic diversity and connectedness between swift fox populations after a reintroduction. Our objective was to measure the genetic diversity and connectedness of the reintroduced population of swift foxes at BNP and its surrounding area and thereby provide a contribution to an assessment of the long-term viability of the species.

Study site Badlands National Park (BNP) is located in southwestern South Dakota (Fig. 1). The 1,846-km2 study area included the north unit of BNP and surrounding area (Schroeder 2007). Twenty-three percent of the area was managed by the National Park Service, 34 % by United States Forest Service, and 43 % was privately owned;\1 % of the study area was used for row-crop agriculture (Schroeder 2007). The major industry in the region was cattle production; thus, the majority of the study area outside of BNP was grazed (Schroeder 2007). Within BNP, moderate- to lowintensity grazing by bison (Bison bison) occurred in 52 % of the north unit of the Park (Schroeder 2007). Soils of the Badlands National Park region were composed of midway clay loam and were relatively infertile with low water holding capacity (Whisenant and Uresk 1989). Mean annual temperature and precipitation in this region of South Dakota was 10.1 °C and 40 cm, respectively (Fahnestock and Detling 2002) with dramatic seasonal variation, which is typical of the continental climate. Minimum and maximum temperature varied between -40 and 47 °C. Topography of the region was diverse and elevation ranged from 691 to 989 m above mean sea level (Russell 2006; Schroeder 2007). The area within BNP was typified by highly eroded cliffs and spires over 100 m in height. Outside BNP, the terrain was less rugged and typified by rolling, relatively flat prairie (e.g., Conata Basin: Russell 2006; Schroeder 2007). Vegetation in the region was dominated by mixed-grass prairie species including buffalograss (Buchloe dactyloides), western wheatgrass (Pascopyrum smithii), and prickly-pear cactus (Opuntia polyacantha); the region was mostly void of tree and brush species (Russell 2006; Schroeder 2007). The Cheyenne and


95

Fig. 1 Location of swift foxes that were captured from Colorado (medium gray, BNP-COL), Wyoming (medium gray, BNP-WY), Fall River Area (light gray, FR), and Badlands National Park (black, BNP), USA, for genetic diversity analysis. Fall River Area (N = 40); BNP (N = 252); WY (N = 26); COL (N = 82). The inset map shows

the four states of the continental USA (South Dakota, Wyoming, Colorado, and Nebraska), the major rivers flowing through those states, the continental divide through Wyoming and Colorado and Badlands National Park, South Dakota

White rivers formed the western and southern boundaries of the study area, respectively. The approximate distances between the BNP-Colorado and BNP-Wyoming fox

populations was 136 km, that between BNP-Colorado and Fall River was 319 km, and distance between BNP-Wyoming and Fall River fox populations was 216 km (Fig. 1).

123

96

Methods Sample collection and DNA isolation DNA samples from 433 individual foxes comprising both released and wild born foxes at BNP as well as foxes originating from the Fall River County area were collected. Swift foxes were captured with modified wire box traps (Model 108SS; Tomahawk Live Trap Co., Tomahawk, WI, USA) of dimensions 81.3 cm 9 25.4 cm 9 30.5 cm (Sovada et al. 1998), which were set in the evening and checked the following morning. Foxes were manually restrained to determine sex, and to record general body condition. Blood samples were collected from foxes caught in box traps and stored using FTA classic cards (Whatman Inc., NJ, USA). Captured swift foxes were weighed with a spring scale (model 80210; PesolaÒ Macro-Line Spring scale, Rebmattli 19, CH-6340 Baar, Switzerland, EU), and ages of captured foxes were determined using tooth wear. Captured foxes were fitted with Very High Frequency (VHF) radiocollars (model M1830, \40 g; Advanced Telemetry Systems, Isanti, MN, USA) and injected with transponders (AVID ID Systems, Norco, California, USA) between their shoulder blades. Each individual fox was identified with the help of transponders; transponders had unique ID numbers that could be determined using an electronic reader. Fox capture, identification, and sample collection methods were similar for both released and wildborn swift foxes at BNP as well as those associated with the Fall River County area swift fox population. Released foxes were translocated from Colorado in the years 2003, 2004, and 2005 where fox density was about 0.22 foxes/ km2 (Finley et al. 2005), whereas foxes released in the year 2006 were translocated from Wyoming. Although density of swift fox at the Wyoming capture site was unknown, the annual survival rate of adult swift foxes in southeastern Wyoming ranged from 40 to 69 % and about 79 % of the pairs were observed with young (Olson and Lindzey 2002). DNA was extracted from blood samples obtained from captured foxes using a blood Qiagen protocol (Qiagen Inc. Valencia, CA, USA). Three FTA punches of 3 mm diameter were used to extract DNA from FTA cards. Genotypes of 252 wild born foxes, 108 released foxes in BNP, and 40 individual foxes from the neighboring Fall River County area of South Dakota were obtained to assess genetic diversity among swift fox populations. Twentyeight swift foxes released in 2003, 28 foxes released in 2004, 26 foxes released in 2005, and 26 foxes released in 2006 were genotyped. Genotypes of 41 male swift foxes and 41 female foxes translocated from Colorado were obtained whereas genotypes of 11 male and 15 female swift foxes translocated from Wyoming were obtained. We obtained genotypes of wild born foxes from 2004 to 2009

123


as follows: 14 in 2004, 24 in 2005, 41 in 2006, 77 in 2007, 56 in 2008, and 40 in 2009. Animal handling methods followed guidelines approved by the American Society of Mammalogists (Sikes and Gannon 2011) and were approved by the Institutional Animal Care and Use Committee at South Dakota State University (Approval number: 08-A039). Microsatellite analysis We amplified 14 microsatellite loci for swift fox (Saiki et al. 1985; Kitchen et al. 2005) using multiplex polymerase chain reaction (PCR). Among these microsatellites, nine primer pairs that successfully amplified microsatellites ¨ strander et al. 1993; Fredholm and in the dog and kit fox (O Wintero 1995; Francisco et al. 1996; Ralls et al. 2001) were optimized by the Waits Laboratory in Moscow, Idaho, USA for swift fox samples. Another five microsatellite primer pairs developed for the swift fox genome by Cullingham et al. (2007) were redesigned (Table 1) by the Waits Laboratory in Moscow, Idaho, USA for multiplex PCR. The following microsatellites were genotyped for this study: CXX20, CXX173, CXX109, CXX263, CXX403, CXX2062, CXX377, FH2054, CPH3, VVE2-111, VVE533, VVE2-110, VVE-M19, and VVE3-131. DNA was amplified in 3 multiplex reactions: (1) CPH3/CXX173/ CXX20/CXX377/CXX403/FH2054, (2) CXX109/CXX2062/ CXX263/VVE2-111/VVE5-33, and (3) VVE2-110/VVE-M19/ VVE3-131. Forward primers were flourescently labeled with 6-FAM, VIC, NED, or PET (Applied Biosystems, Carlsbad, CA, USA), while reverse primers were unlabelled (Integrated DNA Technology, Coralville, IA, USA). Microsatellite loci were selected for a particular multiplex reaction based upon amplicon size and flourescent label (Table 2). A Qiagen Multiplex Kit (Qiagen Inc. Valencia, CA, USA) was used to amplify microsatellites (Table 2). Touchdown PCR was performed for each multiplex reaction and slightly different touchdown protocols were used for the three different multiplex reactions (Table 3). Two of the primer pairs (CXX173 and CXX109) did not consistently amplify and thus, we eliminated them from our analyses. Flourescently labeled PCR products were mixed with an internal size standard (GeneScanTM 600 LIZÒ, Applied Biosystem) and Hi-DiTM Formamide (Applied Biosystems), and loaded onto an ABI PRISMÒ 3130 genetic analyzer for fragment analysis. Genotyper software (Applied Biosystems, Carlsbad, CA, USA) was used for genotyping microsatellites. The PCR product for multiplex 1 was diluted in a 1:5 ratio, i.e., 2 ll of product with 8 ll of sterilized water, and for multiplex 3 the PCR product was diluted in a 1:10 ratio, i.e., 2 ll of product with 18 ll of water. The PCR product for multiplex 2 amplicons was not diluted. Diluted PCR products were then combined with


97

Table 1 Primer sequences used for genetic analysis of swift fox (Vulpes velox) populations Primers

PCR

Primer sequences

Literature cited

CPH3 F

1

CAGGTTCAAATGATGTTTTCA (original)

Fredholm and Wintero 1995

CPH3 R

1

TTGACTGAAGGAGATGTGGTAA (original)

CXX403 F

1

TCCTTGTCAGGATTTTGATTCC (original)

Fredholm and Wintero 1995 ¨ strander et al. 1993 O

CXX403 R

1

AGGAAGGAATATTGACACTTGG (original)

¨ strander et al. 1993 O

FH2054 F

1

GCCTTATTCATTGCAGTTAGGG (original)

FH2054 R

1

ATGCTGAGTTTTGAACTTTCCC (original)

CXX20 F

1

AGCAACCCCTCCCATTTACT (original)

¨ strander et al. 1993 Francisco et al. 1996; O ¨ strander et al. 1993 Francisco et al. 1996; O ¨ strander et al. 1993 O

CXX20 R

1

TTGATCTGAATAGTCCTCTGCG (original)

CXX377 F

1

ACGTGTTGATGTACATTCCTG (original)

CXX377 R

1

CCACCCAGTCACACAATCAG (original)

¨ strander et al. 1993 O ¨ strander et al. 1993 O ¨ strander et al. 1993 O

VVE2-111 F VVE2-111R

2 2

TGATCCCTTGATCTCATGTT (redesigned) CTTGTTGAAGGGATGAATGA (redesigned)

Cullingham et al. 2007 Cullingham et al. 2007

VVE5-33 F

2

TTCTCTTTCTTAAGGGTGGA (redesigned)

Cullingham et al. 2007

VVE5-33 R

2

ATATCCCTGAGTCCATTCTG (redesigned)

Cullingham et al. 2007 ¨ strander et al. 1993 O

CXX2062 F

2

GGCTCCTCCAGACAGGCAT (original)

CXX2062 R

2

CAGAACGCTGTCTAGCCCTT (original)

CXX263 F

2

TCAATCATAGGTCGATTGTTGC (original)

CXX263 R

2

AGTCACCCTCCAAGATGTGG (original)

¨ strander et al. 1993 O ¨ Ostrander et al. 1993 ¨ strander et al. 1993 O

VVE3-131 F

3

GAGTTTATAGCCAGGAGCAA (redesigned)


VVE3-131 R

3

TCGAACTCCGATAAGAAAGA (redesigned)


VVE-M19 F

3

AAAACAACAAACCCCTCAAT (redesigned)


VVE-M19 R

3

GAAAGATGGCTCCGATACTTG (original)


VVE2-110 F

3

TGGTTACCTTCTATTTTGGAA (redesigned)


VVE2-110 R

3

TCGATTCCCACATCGGGC (original)


Table 2 The PCR concentration of each primer along with its size range and fluorescent label Primers

PCR concentration (lM)

Multiplex

Dye lable

Size range

Qiagen mastermix (29)

Q-solution (59)

DNA (lL)

3.5

0.7

2

3.5

0.7

2

3.5

0.7

2

CPH3 F & R (10 lM)

0.15

1

6FAM

150–160

CXX403 F & R (10 lM)

0.30

1

VIC

263–281

FH2054 F & R (10 lM) CXX20 F & R (10 lM)

0.15 0.23

1 1

NED VIC

167–191 114–144

CXX377 F & R (10 lM)

0.11

1

VIC

165–193

VVE2-111 F & R (20 lM)

0.23

2

NED

107–142

VVE5-33 F & R (20 lM)

0.71

2

NED

188–250

CXX2062 F & R (10 lM)

0.36

2

6FAM

135–160

CXX263 F & R (10 lM)

0.07

2

6FAM

94–142

VVE3-131 F & R (10 lM)

0.10

3

PET

153–185

VVE-M19 F & R (10 lM)

0.07

3

VIC

227–356

VVE2-110 F & R (10 lM)

0.29

3

6FAM

231–346

Amount of Qiagen mastermix, Q-solution, and DNA for each multiplex reaction was constant but the amount of water differed depending upon the primer volume to make a total reaction volume of 8 lL. Twelve primers were used to obtain the genotype of captured swift fox individuals (2003–2009) for determining the genetic diversity of swift fox at Badlands National Park, South Dakota, USA

123

98


Table 3 Protocol used for running different multiplex PCRs in thermocycler to amplify swift fox DNA Multiplex 1 Initial denaturation

95 °C

15 min

Touchdown Number of cycles: 20 (weak samplesa) 14 (strong samplesb) Denaturation

94 °C

30 s

Annealing

55–0.3 °C

90 s

Elongation

72 °C

1 min

Denaturation

94 °C

30 s

Annealing Elongation

51 °C 72 °C

90 s 1 min

60 °C

30 min

95 °C

15 min

Denaturation

94 °C

30 s

Annealing

53–0.5 °C

90 s

Elongation

72 °C

1 min

Cycling Number of cycles: 20

Final elongation Multiplex 2 and 3 Initial denaturation Touchdown Number of cycles: 12

Cycling Number of cycles: 20 (strong samplesa) 25/30 (weak samplesb) Denaturation

94 °C

30 s

Annealing

47 °C

90 s

Elongation

72 °C

1 min

60 °C

30 min

Final elongation a

samples that contain more DNA

b

samples that contain less DNA

10 ll of Hi-Di/LIZ mixture and solutions were denatured at 94 °C for 5 min and then maintained at 4 °C until used in the analyzer. For each sample, 0.55 ll of LIZ was mixed with 10 ll of Hi-Di to prepare the LIZ/Hi-Di mixture. Reamplification of each locus from 80 individual samples was carried out to obtain the error rate per single locus genotype for the 400 samples. Each locus was reamplified from 80 random samples twice to estimate error rate. Accuracy of genotypes assigned in Genotyper was manually confirmed by repeating PCR for those samples that failed to amplify. Error rate was estimated by calculating the number of errors divided by the number of amplifications. Genotypes were replicated until a confidence level for obtaining a correct multilocus genotype of 99 % was obtained. Samples were removed from analysis if they were not assessed at all 12 loci used for the analyses. Statistical methods Program FSTAT version 2.9.3 (Goudet 2001) was used to evaluate Hardy–Weinberg (HW) equilibrium, linkage

123

disequilibrium, genetic diversity (Nei’s heterozygosity), number of alleles per locus, allelic richness, and genetic differentiation among populations for the 12 loci used in analyses. Bonferroni corrected nominal level (5 %) p values of Fis reported in FSTAT tests (Goudet 2001) were used to measure departure from HW equilibrium. Fis (Wright 1931) measures the departure from HW proportions within local subpopulations. Bonferroni corrected nominal level (5 %) p values also were used to estimate linkage disequilibrium among all pairs of loci. Nei’s heterozygosity (Nei 1973) was estimated to measure the allelic diversity/gene diversity of the reintroduced population as well as the source populations of swift foxes. Genetic differentiation between pairs of populations was measured with pairwise Fst tests using the program FSTAT (Goudet 2001), which calculates the mutilocus Weir and Cockerham (1984) estimator of Fst (theta) between all pairs of samples. We grouped released individuals into two subpopulations for data analysis: the BNP-Colorado and the BNPWyoming subpopulations. Program SYSTAT 10 (Wilkinson 1990) was used to perform paired t tests to compare the genetic diversities of populations and also to compute the means and standard deviations of the genetic diversity parameters for populations. We considered four populations of foxes depending on their place of origin for data analysis: the BNP-Colorado population, the BNP-Wyoming population, the BNP population, and the Fall River population (Fig. 1).

Results We isolated DNA from 433 individual foxes comprising both released and wild-born foxes at BNP as well as foxes originating from the Fall River County area. We removed 33 samples from our analysis due to unsuccessful amplification at all 12 loci used for analysis despite repeated attempts. Thus, 7.6 % of our samples were omitted from the analysis. We obtained an average error rate of 0.017 for all 12 loci with minimum and maximum errors of 0 and 0.02, respectively. We found that all 12 loci used for data analyses were in HW equilibrium after Bonferroni corrections (p [ 0.05). We did not find any linkage disequilibrium between any pair of loci (p [ 0.001) in any of the populations under study. We obtained mean gene diversity values of 0.778 (SD = 0.156) for the BNP-Colorado population, 0.753 (SD = 0.165) for the BNP-Wyoming population, 0.751 (SD = 0.171) for the BNP population, and 0.730 (SD = 0.166) for the Fall River County population (Table 4). We obtained a maximum number of alleles (31) at locus VVE-M19 for the BNP population (Table 4). We also calculated the highest mean allelic richness of 11.15 (SD = 7.97) for the BNP population (Table 4).


99

We did not document differences (p [ 0.05) in genetic diversity among any of the populations. However, we documented significant (p \ 0.05) differences in allelic richness between the BNP-Wyoming and the BNP population (Table 5). We obtained an Fst value of 0.029 for the BNP and Fall River swift fox populations and an Fst value of 0.014 for the BNP-Colorado and BNP-Wyoming fox populations. We also obtained an Fst value ranging from 0.020 to 0.029 between the Fall River population and the BNP-Colorado and BNP-Wyoming populations (Table 6).

Discussion Relative to the restoration effort for swift foxes at BNP, no reduction of heterozygosity (HE) or allelic richness (AR) was evident in the newly established BNP fox population (HE = 0.751; AR = 11.154) when compared to the BNPColorado (HE = 0.778; AR = 8.551) or BNP-Wyoming (HE = 0.753; AR = 7.455) founder populations. It can be inferred from the genetic data that the reintroduction of foxes at BNP has, to date, been successful, although future viability analysis is required to confirm this result. A periodic monitoring of genetic variability of the BNP reintroduced population is necessary to evaluate the longterm viability of the population. Also, connectivity maintenance with other neighboring fox populations for gene

Table 4 The minimum, maximum, mean, and standard deviation values of heterozygosity, number of alleles, and allelic richness of fox populations studied at Colorado, Wyoming, BNP, and Fall River area

flow among subpopulations would be required to ensure the future viability of the reintroduced fox population at BNP. Exchange of genetic material through immigration and emigration of foxes between the BNP-Colorado and BNPWyoming populations was evident from the low Fst value (0.014). The low Fst value for the Fall River and BNPColorado fox populations (Fst = 0.020) and Fall River and BNP-Wyoming (Fst = 0.025) fox populations indicated gene flow was occurring through migration/dispersal of individual foxes among these populations. In addition, the Fst value for the Fall River and BNP fox populations also was low (0.029), which indicated connectedness. Considering that 6 years (2003 to 2009) might not provide a temporal window large enough for dispersal and reproduction to occur, the low Fst value between Fall River and BNP fox populations was more likely due to the relatively short distance between the two areas, which indicates that genetic exchange has been occurring between these populations. In fact, a swift fox radio-collared and released within the BNP area was observed in the area of Fall River County where swift foxes occurred. The Fall River population has been considered a remnant population, which was believed to be on the edge of extinction with only about 60 individuals (Uresk et al. 2003). The reason behind maintenance of the Fall River County population may be due to the connectedness and therefore, gene flow between this population and the neighboring population in

BNP-Colorado

BNP-Wyoming

BNP

Fall River

0.322

0.347

0.303

0.335

(CXX403)

(CXX403)

(CXX403)

(CXX403)

0.906

0.907

0.922

0.898

(VVE5-33)

(VVE-M19)

(VVE2-110)

(CXX20)

Mean

0.778

0.753

0.751

0.73

SD

0.156

0.165

0.171

0.166

5

4

5

5

(CXX263 & VVE3-131)

(VVE3-131)

(CXX263)

(CXX263)

23

15

31

12 (CXX20)

Heterozygosity (HE) Minimum (locus) Maximum (locus)

Number of alleles Minimum (locus) Maximum (locus)

(VVE2-110)

(VVE-M19)

(VVE-M19)

Mean

10.083

7.5

11.167

7.917

SD

6.007

3.398

7.998

2.353

Allelic richness (AR) Minimum 4.892

4

5

5

(VVE3-131)

(VVE3-131)

(CXX263)

(CXX263)

16.858

14.805

30.88

12

(VVE2-110)

(VVE-M19)

(VVE-M19)

(CXX20)

Mean

8.551

7.455

11.154

7.917

SD

4.193

3.345

7.97

2.353

(locus) Maximum (locus)

123

100 Table 5 Comparison of heterozygosity and allelic richness between different populations


BNP-Colorado

BNP-Wyoming

Fall River

BNP

–

0.267 (p value);

0.141 (p value);

0.134 (p value);

1.168 (t test)

1.587 (t test)

1.617 (t test)

–

0.554 (p value);

0.898 (p value);

0.61 (t test)

0.131 (t test)

–

0.0555 (p value);

Heterozygosity (HE) BNP-Colorado BNP-Wyoming

0.267 (p value); 1.168 (t test)

Fall River

0.141 (p value);

0.554(p value);

1.587 (t test)

0.61 (t test)

–

0.063 (p value);

0.492 (p value);

0.068 (p value);

2.069 (t test)

0.711 (t test)

2.021 (t test)

0.608 (t test)

Allelic richness (AR) BNP-Colorado BNP-Wyoming Paired t tests were used for the comparison at 95 % level of significance

0.063 (p value);

Fall River

* Significantly different

Table 6 The pairwise Fst values between different swift fox populations

0.492 (p value);

0.496 (p value);

0.711 (t test)

0.705 (t test)

Fall river

Colorado

Colorado Wyoming

0.02 0.025

– 0.014

BNP

0.029

–

Wyoming (Fig. 1). Connectedness between multiple populations is important to rescue rare populations from becoming extinct as well as for the persistent viability of the overall population (Fahrig and Merriam 1985; Noss 1987; Segelbacher et al. 2003; Koons 2010). The Fall River County population as such should be protected to provide connectedness between multiple subpopulation and in turn long-term viability of the restored swift fox population occupying BNP and the surrounding area. Swift fox populations in Colorado, Wyoming, and Fall River County, South Dakota could be considered stable populations as these populations have been extant from the prehistoric time period despite declining and disappearing swift fox populations from other historic sites inhabited by the species. Heterozygosity level of the stable populations of Wyoming (0.753), Colorado (0.778) and the Fall River County area (0.73) was similar to the heterozygosity level of the BNP reintroduced fox population (0.751). Also Garner et al. (2005) reported an average heterozygosity level of 0.69 across mammal species as an indicator of genetic health. Thus, it could be inferred that the BNP reintroduced fox population has been exhibiting a high genetic diversity compared to its healthy source populations of Colorado and Wyoming. Heterozygosity observed by Harrison et al. (2002) in the extant swift fox population of New Mexico was nearly 0.7, and heterozygosity in the

123

–

2.069 (t test)

0.496 (p value);

0.028* (p value);

0.705 (t test)

2.528 (t test)

–

0.131 (p value); 1.631 (t test)

reintroduced swift fox population of Saskatchewan and Alberta, Canada also was approximately 0.7 (Cullingham et al. 2010). Our study populations also had a high genetic diversity in comparision to other canid species such as wolves (Canis lupus, 0.605; Forbes and Boyd 1996), and coyotes (Canis latrans, 0.75; Williams et al. 2003), and its close relative the kit fox (Vulpes macrotis mutica, 0.4; Schwartz et al. 2005). Monitoring of swift fox populations in BNP and the neighboring Fall River County area was necessary to estimate the connectedness between these two populations because little time had elapsed for genetic drift to affect the genetic diversity of the restored population. Continuous maintenance of high genetic diversity similar to source populations as well as connectedness with the neighboring Fall River County population might indicate avoidance of inbreeding, which would minimize the potential for inbreeding depression and decreased fitness and improve the potential for evolutionary adaptation (Ouborg 2009). Acknowledgments Our study was funded by the National Park Service. We appreciate the support provided by the Department of Natural Resource Management (formerly the Department of Wildlife and Fisheries Sciences) at South Dakota State University and the South Dakota Department of Game, Fish and Parks for providing administrative support for the project. Any use of trade, product, or firm names is for descriptive purposes only and does not imply endorsement by the U.S. Government. Special thanks to T. W. Grovenburg for assistance with figure creation. Also thanks to D. Schwalm for her help with PCR and K. Gedye for her help with the sequencer.

References Allardyce D, Sovada MA (2003) Review of the ecology, distribution, and status of swift foxes in the United States. In: Sovada MA, Carbyn L (eds) The swift fox: ecology and conservation of swift

Conserv Genet (2013) 14:93–102 foxes in a changing world. Canadian Plains Research Center, Regina, pp 3–18 Allendorf FW, Luikart G (2008) Conservation and the genetics of populations. Blackwell, Malden Allendorf FW, Ryman N (2002) The role of genetics in population viability analysis. In: Beissinger SR, McCullough DR (eds) population viability analysis. University of Chicago Press, Chicago, pp 50–85 Ausband DE, Foresman KR (2007) Dispersal, survival, and reproduction of wild-born, yearling swift foxes in a reintroduced population. Can J Zool 85:185–189 Bowcock AM, Ruizlinares A, Tomfohrde J, Minch E, Kidd JR, Cavalli-Sforza LL (1994) High resolution of human evolutionary trees with polymorphic microsatellites. Nature 368:455–457 Carbyn L (1998) COSEWIC status report on the swift fox. Committee on the status of endangered wildlife in Canada. Canadian Wildlife Service, Ottawa Carbyn LN, Armbruster H, Mamo C (1994) The swift fox reintroduction program in Canada from 1983–1992. In: Bowels M, Whelan CJ (eds) Symposium proceedings on restoration of endangered plants and animals, University of Cambridge Press, Cambridge Cullingham CI, Smeeton C, White BN (2007) Isolation and characterization of swift fox tetranucleotide microsatellite loci. Mol Ecol 7(1):160–162 Cullingham CI, Curteanu M, Ball MC, Manseau M (2010) Feasability and recommendations for swift fox fecal DNA profiling. J Wildl Manag 74(4):849–859 Egoscue HJ (1979) Vulpes velox. Mamm species 122:1–5 Ellegren H (1992) Polymerase-chain-reaction (PCR) analysis of microsatellites-a new approach to studies of genetic relationships in birds. Auk 109:886–895 Fahnestock JT, Detling JK (2002) Bison-prairie dog-plant interactions in North American mixed-grass prairie. Oecologia 132:86–95 Fahrig L, Merriam G (1985) Habitat patch connectivity and population survival. Ecology 66:1762–1768 Finley DJ, White GC, Fitzgerald JP (2005) Estimation of swift fox population size and occupancy rates in Eastern Colorado. J Wildl Manag 69(3):861–873 Forbes SH, Boyd DK (1996) Genetic variation of naturally colonizing wolves in the Central Rocky Mountains. Conserv Biol 10(4): 1028–1090 ¨ strander EA Francisco LV, Langston AA, Mellersh CS, Neal CL, O (1996) A class of highly polymorphic tetranucleotide repeats for canine genetic mapping. Mamm Genome 7:359–362 Fredholm M, Wintero AK (1995) Variation of short tandem repeats within and between species belonging to the Canidae family. Mamm Genome 6:11–18 Garner A, Rachlow JL, Hicks JF (2005) Patterns of genetic diversity and its loss in mammalian population. Conserv Biol 19: 1215–1221 Goudet J (2001) FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). http://www.unil. ch/izea/softwares/fstat.html. Updated from Goudet (1995) FSTAT (vers. 1.2): a computer program to calculate F statistics, J Hered 86: 485–486 Harrison RL, Barr DJ, Dragoo JW (2002) A comparison of population survey techniques for swift foxes (Vulpes velox) in New Mexico. Am Midl Nat 148:320–337 Kalvels J (1982) Soil survey of Fall River County, South Dakota. Soil Conservation Service and Forest Service in cooperation with the South Dakota Agricultural Experimental Station Kilgore DL (1969) An ecological study of the swift fox (Vulpes velox) in the Oklahoma panhandle. Am Midl Nat 81:512–534 Kitchen AM, Gese EM, Waits LP, Karki SJ, Schauster ER (2005) Genetic and spatial structure within a swift fox population. J Anim Ecol 74:1173–1181

101 Kitchen AM, Gese EM, Waits LP, Karki SM, Schauster ER (2006) Multiple breeding strategies in the swift fox, Vulpes velox. Anim Behav 71:1029–1038 Koons DN (2010) Genetic estimation of dispersal in metapopulation viability analysis. Anim Conserv 13:127–128 Morin PA, Moore JJ, Chakraborty R, Jin L, Goodall J, Woodruff DS (1994) Kin selection, social structure, gene flow, and the evolution of chimpanzees. Science 265:1193–1201 Nei M (1973) Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci USA 70:3321–3323 Nei M (1975) Molecular population genetics and evolution. North Holland, Amsterdam Noss RF (1987) Corridors in real landscape: a reply to Simberloff and Cox. Conserv Biol 1:159–164 Olson TL, Lindzey FG (2002) Swif fox survival and production in southeastern Wyoming. J Mammal 83(1):199–206 ¨ strander EA, Sprague GF, Rine J (1993) Identification and O characterization of dinucleotide repeat (CA)n markers for genetic mapping in dog. Genomics 19:207–213 Ouborg NJ, Angeloni F, Vergeer P (2009) An essay on the necessity and feasibility of conservation genomics. Conserv Genet 11: 643–653 Paetkau D, Strobeck C (1994) Microsatellite analysis of genetic variation in black bear populations. Mol Ecol 3:489–495 Paetkau D, Calvert W, Stirling I, Strobeck C (1995) Microsatellite analysis of population structure in Canadian polar bears. Mol Ecol 4:347–354 Ralls K, Pilgrim KL, White PJ, Paxinos EE, Schwartz MK, Fleischer RC (2001) Kinship, social relationships, and den sharing in kit foxes. J Mammal 82:858–866 Russell TA (2006) Habitat selection by swift fox in Badlands National Park and surrounding area in South Dakota. Thesis, South Dakota State University, Brookings Saiki RK, Scharf S, Faloona F (1985) Enzymatic amplification of bglobin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350–1354 Schlotterer C, Amos B, Tautz D (1991) Conservation of polymorphic simple sequence loci in cetacean species. Nature 354:63–65 Schroeder GM (2007) Effects of coyotes and release site selection on survival and movement of Translocated swift foxes in the Badlands ecosystem of South Dakota. Thesis, South Dakota State University, Brookings Schwartz MK, Ralls K, Williams DF, Cypher BL, Pilgrim KL, Fleischer RC (2005) Gene flow among San Joaquin kit fox populations in a severely changed ecosystem. Conserv Genet 6:25–37 Segelbacher G, Hoglund J, Storch I (2003) From connectivity to isolation: genetic consequences to population fragmentation in capercaillie across Europe. Mol Ecol 12:1773–1780 Sikes RS, Gannon WL (2011) Guidelines of the American Society of Mammalogists for the use of wild mammals in research. J Mammal 92:235–253 Sovada MA, Roy CC, Bright JB, Gillis JR (1998) Causes and rates of mortality of swift foxes in western Kansas. J Wildl Manag 62: 1300–1306 Swift Fox Conservation Team Annual Report (2000) In: Schmitt GC (ed) New Mexico Department of Game and Fish, Albuquerque, New Mexico Taylor AC, Sherwin WB, Wayne RK (1994) Genetic variation of microsatellite loci in a bottlenecked species: the northern hairynosed wombat Lasiorbinus krefftii. Mol Ecol 3:277–290 Uresk DW, Severson KE, Javersak J (2003) Detecting swift fox: smoked-plate scent stations vs spotlighting. United States Department of Agriculture, Forest Service, Rocky Mountain Research Station, Research paper RMRS-RP-39 Weir BS, Cockerham CC (1984) Estimating F-statistics for the analysis of population structure. Evolution 38:1358–1370

123

102 Whisenant SG, Uresk DW (1989) Burning upland, mixed prairie in Badlands National Park. Prairie Nat 21:221–227 Wilkinson L (1990) SYSTAT: the system for statistics. SYSTAT Inc, Evanston Williams CL, Blejwas K, Johnston JJ, Jaeger MM (2003) Temporal genetic variation in a coyote (Canis latrans) population experiencing high turnover. J Mammal 84:177–184 Wright S (1931) Evolution in Mendelian populations. Genetics 16: 97–159

123

Conserv Genet (2013) 14:93–102 Zimmerman AL, Irby L, Giddings B (2003) The status and ecology of swift foxes in north central Montana. In: Sovada MA, Carbyn L (eds) The swift fox: ecology and conservation of swift foxes in a changing world. Canadian Plains Research Center, Regina, pp 49–59 Zumbaugh DM, Choate JR (1985) Historical biogeography of foxes in Kansas. Trans Kans Acad Sci 88:1–13