Genomic organization, expression and evolution of

Original Article Cytogenet Genome Res 121:41–49 (2008) DOI: 10.1159/000124380

Genomic organization, expression and evolution of porcine CRSP1, 2, and 3 A.H. Rezaeian a–c T. Katafuchi d M. Yoshizawa b, c N. Hiraiwa e T. Saito a M. Nishibori f K. Hamano d N. Minamino d H. Yasue a a

National Institute of Agrobiological Sciences, Tsukuba, b United Graduate School of Agricultural Science, Tokyo University of Agriculture and Technology, Fuchu-shi, Tokyo c Faculty of Agriculture, Utsunomiya University, Utsunomiya d National Cardiovascular Center Research Institute, Suita, Osaka; e Bio-resource Center Riken, Tsukuba f Graduate School of Biosphere Science, Hiroshima University, Higashi-Hiroshima (Japan) Accepted in revised form for publication by J. Smith, 5 December 2007.

Abstract. Recently we identified and characterized porcine calcitonin receptor-stimulating peptide (CRSP) 1, CRSP2 and CRSP3 as members of the calcitonin/calcitonin gene-related peptide (CT/CGRP) family. In the present study, the genomic sequences and organization of CRSP1, 2, and 3 were determined, and the expression of the genes in the porcine brain was investigated using in situ hybridization. Analysis of 5ⴕ-upstream regions of the three CRSPs demonstrated that CRSP1 and CRSP2 have almost identical sequences (198% similarity) and high sequence similarities including functional transcription binding sites with the corresponding region of human CALCA (CT/␣CGRP), whereas CRSP3 retains less similarity with the above genes. RH mapping of CRSPs demonstrated that they resided in a region of swine chromosome 2 (SSC2). The arrangement of

the genes in the region was found to be conserved in corresponding human and mouse regions. In situ hybridization demonstrated sense transcripts of the three genes in cerebrum, hippocampus, hypothalamus, pons/midbrain, and thalamus of 3-month-old pigs, and CRSP2 sense transcripts additionally in tractus opticus. The sense transcripts of ␣CGRP and CALCB (␤CGRP) were detected in cerebrum, hippocampus, and pons/midbrain of newborn mice, and to a lesser extent in pons/midbrain of 8-week-old mice. These results taken together with the chromosomal conservation and phylogenetic clustering of CT/CGRP family indicate that CRSP1, 2, and 3 may be functionally different from ␣CGRP and ␤CGRP, though they are indicated to have a Copyright © 2008 S. Karger AG, Basel common progenitor gene.

We have recently described the identification, structures and biological properties of three porcine calcitonin receptor-stimulating peptides (CRSPs). CRSP1 was isolated from acid extracts of the porcine brain by monitoring the production of cAMP in LLC-PK1 cells (Katafuchi et al., 2003a). Al-

though CRSP1 shows a high structural similarity with calcitonin gene-related peptide (CGRP), it does not stimulate endogenous and recombinant CGRP or adrenomedullin (AM) receptor (Isumi et al., 1998; McLatchie et al., 1998). On the other hand, CRSP1 stimulates porcine calcitonin (CT) receptor (Lin et al., 1991) with a potency more than 100-fold than that of CT. By Northern blot analysis, CRSP1 mRNA is shown to be expressed mainly in the central nervous system and thyroid gland. Thus, CRSP1 is suggested to be an endogenous ligand for the central CT receptor. CRSP2 and CRSP3 were identified by screening a swine hypothalamus cDNA library using CRSP1 cDNA as a probe (Katafuchi et al., 2003b). Despite their high amino acid sequence similarity with CRSP1 and CGRP, CRSP2 and CRSP3 only faintly, if at all, stimulate recombinant CT, CGRP or AM receptor. RT-PCR analysis has revealed that mRNAs of

This work was supported in part by Research Grants from the Organization for Pharmaceutical Safety and Research (Medical Frontier Project), from the Ministry of Health, Labour and Welfare (Cardiovascular Diseases) of Japan, and from the Protein Research Foundation (Kaneko-Narita Research Grant). Request reprints from Hiroshi Yasue Animal Genome Research Unit National Institute of Agrobiological Sciences Tsukuba, Ibaraki, 305-0901 (Japan) telephone: +81 29 838 8664; fax: +81 29 838 8674 e-mail: [email protected]

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

© 2008 S. Karger AG, Basel 1424–8581/08/1211–0041$24.50/0

Accessible online at: www.karger.com/cgr

CRSP2 and CRSP3 are expressed mainly in the central nervous system and thyroid, and that the expression profiles are principally similar to those of porcine CRSP1 and CGRP (Katafuchi et al., 2003b). The CRSPs have been shown to exist in pigs, horses, cows and dogs but we failed to identify their counterparts in humans and rodents by cross-hybridization or database search (Katafuchi et al., 2004). On the other hand, only one CGRP (␣CGRP) has so far been identified in the former animals, while two CGRPs (␣CGRP and ␤CGRP), that are produced from distinct genes, have been identified in the latter animals. Although cDNA and amino acid sequences of the three CRSP precursors are shown to have high similarity with those of CGRPs, the evolutionary relationship between CRSPs and CGRPs as well as physiological functions of CRSPs remain obscure. Determination of genomic localizations and organizations of CRSPs in swine and searching for their counterpart genes in the corresponding human and mouse genomic regions are expected to provide clues to solve these problems. In addition to the fact that CRSPs were first identified and well characterized in the pig, this animal has these days been frequently used as a model for human disease and is also considered to be a source animal for xenotransplantation to humans due to its anatomical and physiological similarities (Tumbelson and Schook, 1996). For greater understanding of pigs in comparison with mice and humans and to answer the above-mentioned questions, in the present study, we investigated the genomic organization of porcine CRSPs, their localization in the genome, and their expression profiles in brain tissue. Materials and methods Genomic sequencing of swine CRSPs A porcine genomic library (EMBL 3 containing Sau3A partially digested) purchased from Clonetech (Japan) was screened to obtain clones indicated to contain sequences of CRSPs using cDNAs of CRSPs as probes. Then, DNAs of the clones were subjected to sequence analysis using an ABI 310 DNA sequencer (Applied Biosystems, USA). Potential transcription factor binding sites were identified by analysis with the ‘MatInspector’ program using the ‘Transfac’ database (Quandt et al., 1995). Determination of 5ⴕ-transcription initiation site by 5ⴕ-rapid amplification of cDNA ends (5ⴕ-RACE) The first strand for 5ⴕ-RACE cDNA was synthesized from 0.5 ␮g of porcine hypothalamus poly-A+ RNA using a SMART RACE cDNA amplification kit (Clontech). The universal primer mix for 5ⴕ-RACE was used with the following gene-specific antisense primers: 5ⴕ-GGACCAGGATGCTGAGAACCAGGAA-3ⴕ for CRSP-1; 5ⴕ-TTCCTCCTCTGTGAGAGTGGCAGAA-3ⴕ for CRSP-2; and 5ⴕ-GGATGCAGGAACCAGGTAGCTTGGA-3ⴕ for CRSP-3. For each PCR reaction, we used 1/50 of the cDNA reaction mixture, 0.2 mM of each dNTP, 50 units/ml of Advantage 2 DNA polymerase (Clontech), 1! concentration of the corresponding reaction buffer provided with the enzyme, and a pair of the above-described primers. The amplification was performed for 40 cycles (each cycle consisted of 15 s at 94 ° C, 15 s at 65 ° C, and 1 min at 72 ° C). Following the amplification, the nucleotide sequences of the PCR products were determined as described above using the respective gene-specific antisense primer.

42

Cytogenet Genome Res 121:41–49 (2008)

RT-PCR analysis Complementary DNA was synthesized from total RNA (4 ␮g) isolated from swine tissues, including cerebral cortex, cerebellum, midbrain, thalamus, hypothalamus, pons/medulla oblongata, spinal cord, pituitary gland, lung, adrenal gland, kidney, spleen, liver, small intestine, ovary, cardiac atrium, cardiac ventricle, aorta and testis, using Revertra Ace reverse transcriptase with oligo dT12–18 primers. The PCR reaction and following agarose gel electrophoresis were performed as described previously (Katafuchi et al., 2003b). The following PCR-specific primers were used: 5ⴕ-AGCAGCTTTGATTCTGCCAC-3ⴕ (sense), 5ⴕ-CTTCTTAAGCACCTTAGGGT-3ⴕ (antisense 1) and 5ⴕ-ACCTCCTCTCTGATATTCCA-3ⴕ (antisense 2) for CT-2; 5ⴕ-TCACTGCCACCCAGAAGACT-3ⴕ and 5ⴕ-AGTGGTCGTTGAGGGCAATG-3ⴕ for glyceraldehyde-3-phosphate dehydrogenase. RH mapping PCR primers were designed to amplify sequences specific for respective CRSPs and CT/CGRP from swine genomic DNA (Table 1). The sequences amplified from the genomic DNA were determined to confirm the identity of the amplified sequences with the respective CRSP genomic sequences determined in this study and CT/CGRP (Accession Nos. AB331639 and AB331640, and our unpublished data). Then, the IMpRH7000rad panel DNAs (Yerle et al., 1998) and the IMNpRH12000rad (Yerle et al., 2002) panel DNAs were typed by PCR using the respective primer pairs to assign CRSPs and CT/CGRP to the RH maps as described previously (Shimogiri et al., 2006). To assign genes to the IMpRH map, the typed data were first submitted to the IMpRH server (http://imprh.toulouse.inra.fr/) (Milan et al., 2000). The most likely order of genes together with markers and ESTs/genes publicly available on the IMpRH server was then determined by maximum likelihood estimation in CarthaGene software (Schiex et al., 2001). To determine the order of genes on the IMNpRH map, the typed data of IMNpRH panel DNAs were directly analyzed by the CarthaGene software. The RH maps were constructed following the procedure described by Shimogiri et al. (2006). Preparation of tissues samples for in situ hybridization Three-month-old male pigs of Landrace or Landrace/Duroc/Largewhite composite were used to obtain tissues for in situ gene expression analyses. The animals used in the present study received humane care as described in the Guidelines for the Care and Use of Experimental Animals (National Institute of Agrobiological Sciences Care Committee, Japan). The process for the preparation of tissue samples followed the guidelines of animal ethics at the National Institute of Agrobiological Sciences. The pigs were euthanized by an intravenous injection of 10 ml of sodium pentobarbital. Immediately after respiration and heartbeat stopped, tissue samples were excised from brain to fix tissues in 4% paraformaldehyde in phosphate-buffered saline. Brain samples of 8-week-old and newborn C57BL/6J mice, which were kept in Riken under the ‘Guidelines for the Care and Use of Experimental Animals’, were first fixed in situ by perfusion of 4% ice-cold paraformaldehyde solution (w/v in phosphate-buffered saline), and then the resulting brains were excised to be further fixed overnight in the paraformaldehyde solution. The organs/tissues thus fixed were embedded in paraffin and then sectioned 4 ␮m thick. Sections were collected on glass-slides and subjected to in situ hybridization. cRNA probes for in situ hybridization For probes, 120 nucleotides (nt) were chosen from cDNA sequences of porcine CRSPs, CGRP, and CT, and mouse ␣CGRP (a splice variant of CALCA) and ␤CGRP (CALCB) transcripts using G-probe software (Genetyx Co., Japan): The probe sequences are shown in Table 2. The highest similarity of probe sequences to the respective gene transcripts (other than for self gene transcript) was shown to be 85% between the CRSP1 probe and the CGRP gene transcript. It is possible that such high similarity may induce cross-hybridization between CRSP1 probe and CGRP transcript in in situ hybridization. Therefore, control in situ hybridizations were performed on swine testis samples using cRNA probes, with similarities designed to be 100, 95, 90, 85 and 80% of swine

Table 1. Primers for RH mapping are 20 nucleotides in size.

Primers

Sequence (5ⴕ–3ⴕ)

PCR product

Annealing temperature (° C)

CRSP1-forward CRSP1-reverse CRSP2-forward CRSP2-reverse CRSP3-forward CRSP3-reverse CT-forward CT-reverse

TGAGATGCAGAAGCAGAGGG TGAGTGCAGGTGCTGTACGA TGTACCACATCAGGAACTCC TAGAGTTCAGTTCCTTGGTG CGTACAATGTCACGTACACC TGCAGTGAAAGCAACTTGAG ATAGATTCTCTGGCATGGGC CCCCAGCATTCTCTGTCATA

285 bp

59

388 bp

59

282 bp

59

238 bp

57

Table 2. cRNA probe sequences are 120 nucleotides in size.

Gene

Nucleotide sequence (5ⴕ–3ⴕ)

Swine CRSP1

GAGATGCAGAAGCAGAGGGCACAGGGCTCCGGCATCAGTGTCCAGAAGAGATCCTGCAACACTGCCACCTGCATGACCCATCGGCTGGTGGGCTTGCTCAGCAGATCTGGGAGCATGGTG TGTGGACTCCAAAATCTTGGGCTGACGCCGCAGAGAGCCTCAGGCCTGAGCTGTGAAATGACTCCACAAAGAAGGTCACCAAGGAACTGAACTCTATTTCTTTTAATCTGCAATGAAAGC CATGGGCTCCAAAGTCTTGGGCCGGCGCCGCAGACAGCCTCAGGCCTGAGCTGTGAAATGACTCTAAAAAGAAGTTGAACTCAAGTTGCTTTCACTGCAAAGTTGCTTTCCCTGCAAATT TGATCATGGCAGCTCTGCCAAATTTTAACATTAAATCACTGCCTCTGTGGCCTCTGGGGACACATGTAAGGTGATGCTGTGCTTTGTCTAAGAACATGATTGTATAATTTGTTTAAGGAA TAATCTGAGTACCTGTGTGCTGAGTGCGTACTGGAGGAACCTGAACAACTTTCATAGATTCTCTGGCATGGGCTTCGGGCCTGAAACACCTGGCAAGAAAAGTGACATAGCCAGCAGCTT GAATCTGAGTACCTGCATGCTGGGCACGTACACACAAGACCTCAACAAGTTTCACACCTTCCCCAAAACTTCAATTGGGGTTGAAGCACCTGGCAAGAAAAGGGATGTGGCCAAGGACTT ACTAGCAGCTCCAGGAAGAAGGTTACATAAAGTTGAACTCACCATGCCTATTAATTTTGTATTAAACAACCCGATGTGAAGGCCTCAAGGACAATGTGTATGCTTGCATCCTGATAGATA TGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATCCCATGTGCGTGACGGACATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT

Swine CRSP2 Swine CRSP3 Swine CGRP Swine CT Mouse ␣CGRP Mouse ␣CGRP LNE

protamine 1 gene transcript. The testis samples, kindly provided by the National Institute of Livestock and Grassland Science (Tsukuba, Japan), were fixed as described above for in situ hybridization. The hybridization conditions (50% formamide at 37 ° C) gave hybridization signals using probes with similarities not less than 90% (data not shown). To assure no cross-hybridization, in situ hybridization was performed at an elevated temperature of 42 ° C. As a control cRNA probe, a 120 nt lambda phage sequence (LNE) (Table 2) bearing no similarity to any of the mammalian sequences registered in the DNA database was used in all the in situ hybridization experiments to verify that the hybridization system would give no nonspecific hybridization signals. To produce digoxigenin (DIG)-labeled cRNAs from probe sequences, the 120 nt single-strand DNA sequences were first chemically synthesized and subjected to PCR to generate double-strand DNA fragments. The resulting DNA fragments were then subjected to in vitro transcription to produce DIG-labeled cRNA with AmpliScribe T7Flash Transcription Kit (Epicentre, USA). The extent of the DIG labeling was monitored so as to be the same level among the cRNAs using the NBT/BCIP detection system (Roche Diagnostics, Japan).

In situ hybridization The procedure for in situ hybridization was the same as reported earlier (Ohtsuki et al., 1998) with the following exception: The hybridization was performed in a solution containing 50% formamide, 2!

SSC, 1.0 mg/ml tRNA, 1.0 mg/ml salmon sperm DNA, 1.0 mg/ml BSA, 1.0% SDS, and 3.0 ␮g/ml DIG-labeled RNA probe at 42 ° C for 26–64 h. Hybridization signals were detected with the NBT/BCIP system.

Phylogenetic analysis of amino acid sequences of the CT/CGRP family The amino acid sequences of the CT/CGRP precursor polypeptides in Eutheria were obtained from NCBI or UniProt database (http:// www.ncbi.nlm.nih.gov/sites/entrez?db=Protein&itool=toolbar or http://www.expasy.uniprot.org/). The accession numbers for the CT/ CGRP precursor polypeptides were as follows: Equus caballus CT: NP_ 001075323.1; Equus caballus CGRPI: NP_001078893.1; Equus caballus CGRPII: NP_001075397.1; Bos taurus CRSP1: NP_001001149.1; Bos taurus CGRPII (hypothetical protein LOC614663): NP_001069808.1; Sus scrofa CRSP1: NP_998907.1; Sus scrofa CRSP2: NP_998912.1; Sus scrofa CRSP3: NP_998911.1; Sus scrofa CGRP: BAF69067; Sus scrofa CT: BAF69066; Canis familiaris CRSP1: NP_001002948.1; Canis familiaris CRSP2: NP_001002947.1; Canis familiaris CGRP1: Q9MYV1; Canis familiaris CT: P41547; Mus musculus ␣CGRP: NP_001029126.1; Mus musculus ␤CGRP: NP_473425; Mus musculus CT: P70160; Rattus norvegicus ␣CGRP: P01256; Rattus norvegicus ␤CGRP: NP_612522.1; Rattus norvegicus CT: NP_059034.1; Homo sapiens ␣CGRP: NP_ 001029125.1; Homo sapiens ␤CGRP: NP_000719.1; Homo sapiens CT: NP_001732.1; and Oncorhynchus keta CT: P01263. The amino acid sequences thus obtained were subjected to phylogenetic analysis using


43

1

3

2

4

5

(A) CRSP1 4

3

2

1

5

(B) CRSP2 2

1

3

4

5

6

3

4

5

6

(C) CRSP3

Fig. 1. Schematic representation of the exon-intron organizations of porcine CRSP1 (A), CRSP2 (B), CRSP3 (C), human CT/␣CGRP (D), and human ␤CGRP (E). Outlines of exons and introns are schematically indicated by boxes and lines, respectively. The exons corresponding to the 5ⴕ-noncoding region, signal peptide, flanking peptide, CT-like peptide, CT-like pseudo-exon, CGRP-family peptide and 3ⴕ-noncoding region are shown as illustrated in the figure.

2

1 (D) CT/α CGRP 1

2

4

3

5

(E) β CGRP 1 kbp 5‘-noncoding region

signal peptide

flanking peptide

CT-like pseudo-exon

CGRP-family peptide

3’-noncoding region

CT-like peptide

CRE aAAgTTtACCATGACGTCAAACTGtCCTtAAATTCCtGCTCACTTTgcGtGtGTTttTcG aAAgTTtACCATGACGTCAAACTGtCCTtAAATTCCtGCTCACTTTgcGtGtGTTttTcG atAcTagtCCggtttGTtAcAC----CTCAgcaaCggGaaCcCccctgGtcacTTtgaaG gAAaTTcACCATGACGTCAAACTGcCCTCAAATTCCcGCTCACTTTaaGgGcGTTacTtG * * ** ** * ** ** * * * * * * ** * RRE CRE CRSP1 TTGGTGCccaccaacctCCCCACCccCtCCCACCcccgCCATCAATGACCTCAAATGCAA CRSP2 TTGGTGCccaccaacctCCCCACCccCtCCCACCcccgCCATCAATGACCTCAAATGCAA CRSP3 agGGT---------tttCatacaatcCtCCCACCtccgCtATCAgTGACCTCAAATGCgA hCT/αCGRP TTGGTGC----------CCCCACCatCcCCCACCatttCCATCAATGACCTCAAATGCAA *** * * ****** * **** ************* * AP-1 CRSP1 ATACAAGTGGGgtGGTCCTGtTGGATgCTCCAccTTCTGGAcGCAaGtaGtgAC-aCAAt CRSP2 ATACAAGTGGGgtGGTCCTGtTGGATgCTCCAccTTCTGGAcGCAaGtaGtgAC-aCAAt CRSP3 ATACAAGTGcGgtGGTtCTGtTaaATtCTCCAccTTCcGGAAGCAaGtaccgAtaatcct hCT/α CGRP ATACAAGTGGGacGGTCCTGcTGGATcCTCCAggTTCTGGAAGCAtGagGgtAC-gCAAc ********* * *** *** * ** ***** *** *** *** * CRE * CRSP1 CRSP2 CRSP3 hCT/αCGRP

CRSP1 CRSP2 CRSP3 hCT/αCGRP

Fig. 2. Alignment of nucleotide sequences in 5ⴕ-upstream regions of porcine CRSP1, CRSP2 and CRSP3 with human CT/␣CGRP. (A) Alignment of nucleotide sequences adjacent to the transcription initiation site of three CRSPs and human CT/␣CGRP (hCT/␣CGRP). Asterisks below hCT/␣CGRP indicate the nucleotides conserved in all genes. When at least one nucleotide residue of three CRSPs is in common with that of hCT/␣CGRP in the same column, the common residues in CRSPs and hCT/␣CGRP are shown in uppercases. Potential transcription factor binding sites are boxed, and an RRE-like sequence in CRSP3 is boxed with dashed lines. Transcription initiation sites and following sequences within exon 1 are boxed by broken lines. (B) Alignment of HLH/OCTs (helix-loop-helix and octamer) and their adjacent sequences in the 5ⴕupstream regions of CRSP1, CRSP2 and hCT/ ␣CGRP. (C) Schematic alignment of PRE-1s inserted in the 5ⴕ-upstream regions of CRSP1, CRSP2 and CRSP3. Each PRE-1 is shown by a box.

44

CCtGGGGCtcAGGAtCttTCCtCtCATTGGTTGCctgGagCTctgGGAcCaccCCaGAtt CCtGGGGCtcAGGAtCttTCCtCtCATTGGTTGCctgGagCTctgGGAcCaccCCaGAtt CttGGGGCtcAGGAttttTCCcCtCATTGGTTGCctgGagtTccaGGAcCaccCtgGAtt CCaGGGGCaaAGGAcCccTCCgCcCATTGGTTGCtgtGcaCTggcGGAaCtttCCcGAcc * ***** **** *** * ********** * * *** * * ** TATA +1 CRSP1 CAgAGCGGCGGGAATAAGAGCAGctGCTGGtGCgGGGAaGggTtAGAGgCACTaCCCAcC CRSP2 CAgAGCGGCGGGAATAAGAGCAGctGCTGGtGCgGGGAaGggTtAGAGgCACTaCCCAcC CRSP3 CACAGCaGCGGGAATAAGAGCAGctGCTGGtGCTGaGAGGCATtAGAagCACTGCCCAGC hCT/αCGRP CACAGCGGCGGGAATAAGAGCAGtcGCTGGcGCTGGGAGGCATcAGAGaCACTGCCCAGC A ** *** **************** ***** ** * ** * * *** **** **** *

-217 -217 -207 -207

-157 -157 -158 -157

-98 -98 -98 -98

-38 -38 -38 -38 +23 +23 +23 +23

CRSP1 gAtTGgGGtaGaTGtGGGcACaGGGCtGGAATcacAgGTCaCTGGaACATCTTGGCAAAC -987 CRSP2 gAtTGgGGtaGaTGtGGGcACaGGGCtGGAATcacAgGTCaCTGGaACATCTTGGCAAAC -973 hCT/αCGRP aAgTGcGG-gGgTGgGGGtACgGGGCcGGAATagaAtGTCtCTGGgACATCTTGGCAAAC -966 * ** ** * ** *** ** **** ***** * *** **** ************** HLH OCT CRSP1 AGCAGCCGGAAGC-AAGGGGCAGCTGgGCAAAtGGtTctgggacattgatgGGCttAGaT -928 CRSP2 AGCAGCCGGAAGC-AAGGGGCAGCTGgGCAAAtGGtTctgggacattgatgGGCttAGaT -914 hCT/αCGRP AGCAGCCGGAAGCaAAGGGGCAGCTGtGCAAAcGGcT------------caGGC--AGgT -914 B ************* ************ ***** ** * *** ** *

Exon1

CRSP1 CRSP2 CRSP3 C


Exon1

PRE-1 PRE-1 PRE-1

PRE-1

PRE-1

Exon1 200 bp

the Bayesian Method (MrBayes 3.1.2: Ronquist and Huelsenbeck, 2003). As an outgroup control for the phylogenetic analysis, CT of Oncorhynchus keta (chum salmon) was used.

Results

HSA11

MMU7 (B: in Mb)

(A)

SSC2

(C: in Mb) 0

10

110

ADM

SW2442 50

KIAA0155

Genome organization of CRSP1, CRSP2, and CRSP3 A swine genomic library was screened for CRSP1, CRSP2 and CRSP3, as described above. DNAs of lambda phage clones thus obtained were subjected to sequence analysis, and revealed to be the following: The CRSP1 and CRSP2 were 3.1 and 3.7 kb in length, respectively, and consisted of 5 exons (Fig. 1). Exon 1, 2, 3, 4 and 5 corresponded to the 5ⴕnon-coding region, signal peptide, N-terminal intervening peptide, CRSP1 or CRSP2 peptide, and 3ⴕ-non-coding region, respectively (Fig. 1). The CRSP3 spanning 5.1 kb consisted of six exons (Fig. 1). Exon 1–6 corresponded to the 5ⴕ-non-coding region, signal peptide, N-terminal intervening peptide, CT-like peptide, CRSP3 peptide, and 3ⴕ-noncoding region, and exon-intron organization is similar to that of human CT/␣CGRP (Fig. 1). We designated a 32 amino acid residue CT-like peptide encoded in exon 4 as CT-2. Interestingly, the amino acid sequence of porcine CT-2 showed a higher similarity with that of human CT (59%) than with that of porcine CT (41%) (data not shown). The mRNA encoding CT-2, however, was not detected in 19 examined tissues even using the highly sensitive RT-PCR method as mentioned in Materials and methods (data not shown). The nucleotide sequence of the 5ⴕ-upstream region of exon 2 in CRSP1 showed an extremely high similarity with that of CRSP2. The sequence similarity of CRSP1 to CRSP2 in the 5ⴕ-upstream region over 4.4 kb of exon 2 was found to be more than 98% except for insertion of a PRE-1, SINE in CRSP2 (Yasue and Wada, 1996). The nucleotide sequence reported in this paper has been submitted to the DDBJ/GenBank/EMBL Data Bank with Accession Nos. AB164322 for porcine CRSP1, AB164323 for porcine CRSP 2 and AB164324 for porcine CRSP3. Analysis of 5ⴕ-upstream sequences of three CRSPs The 5ⴕ-upstream sequences of the three CRSPs were subjected to alignment analysis with those of human and mouse CT/␣CGRP as well as with those of human and mouse ␤CGRP. The upstream sequences of the three CRSPs and human CT/␣CGRP showed a significant alignment similarity (Fig. 2A, B). As shown in Fig. 2A, a high similarity was observed in the three CRSPs and human CT/␣CGRP up to 190 nt upstream from the exon 1 start site: In the sequence, CRE and TATA were detected as common elements in the three CRSPs and human CT/␣CGRP. In addition, an RAS element (RRE)-like sequence was found in CRSP3 at the position where an RRE element was found in CRSP1, CRSP2, and human CT/␣CGRP (Fig. 2A). Further comparison was done for a more upstream region of CRSP1, CRSP2, and human CT/␣CGRP, revealing an overlapped helix-loop-helix (HLH) and octamer (OCT) recognition sequence (HLH-

(D: IMpRH, in cR) ADM

SWR1338 11

111 100

FLJ20727 DKK3 KIAA0750 PARVA TEAD1

12

112

13

113

150

MGC13007 PTH3 14

114

200

CALCP 15

115 250

(CALCA)

␤ CGRP (CALCB)

HSSOX6

PDE3B

20

SW1857 40

PDE3B

CT/␣ CGRP

(E: IMNpRH, in cR) 0

MGC13007 PTH3

(pseudo-)

KIAA0155 FLJ20727 DKK3 KIAA0750 TEAD1

16

116

PDE3B CRSP2 CRSP3 CT/CGRP CRSP1 SW747 SW1026

CRSP2 60

CT/CGRP CRSP3

80 CRSP1

300

PIK3C2A

17

HSSOX6 PIK3C2A

117 350

SW2167 S0170

Fig. 3. Assignment of porcine CRSP1, CRSP2, CRSP3, and CT/CGRP to RH maps and their correspondences to human and mouse chromosome maps. CRSP1, CRSP2, CRSP3, and CT/CGRP were assigned to IMpRH map and IMNpRH map. Positional correspondence of genes located in the vicinity of CRSP1, CRSP2, CRSP3, and CT/CGRP among SSC2, mouse chromosome (MMU) 7, and human chromosome (HSA) 11 are shown in this figure. (A) Ideogram of HSA11; (B) physical map of HSA11; (C) physical map of MMU7; (D) IMpRH map; (E) IMNpRH map.

OCT) (Fig. 2B), which has been shown to be effective in the regulation of human CT/␣CGRP transcription (Tverberg and Russo, 1992; Lanigan et al., 1993). When the upstream regions of the three CRSPs were examined with respect to PRE-1, one PRE-1 and four PRE-1s were found in CRSP2 and CRSP3, respectively. However, no correspondence with the PRE-1 positions was observed between the upstream regions of CRSP2 and CRSP3 (Fig. 2C). Assignment of three CRSPs and CT/CGRP to swine chromosome (SSC) In order to elucidate possible human and mouse counterparts of CRSPs, the CRSPs together with CT/CGRP were assigned to SSC using RH mapping as described in the Materials and methods section. The RH mapping revealed that the CRSPs and CT/CGRP were localized in SSC2. The arrangement of the CRSPs and CT/CGRP along SSC2 was calculated with genes and markers that had been assigned to


45

CRSP1

CRSP2

CRSP3

CT

HE

A

B

C

D

Fig. 4. Expression of CRSP1, CRSP2, CRSP3, and CT genes in porcine brain. In situ hybridizations were performed using cRNA probes to examine the expression of CRSP1, CRSP2, CRSP3, and CT genes in porcine brain using a 5! objective lens to obtain general images of tissues expressing genes. Line (A) cerebrum; line (B) hippocampus; line (C) hypothalamus; line (D) pons/midbrain; line (E) thalamus; and line (F) tractus opticus. Rightmost column is haematoxylin-eosin staining of respective tissues. Scale bars represent 200 ␮m.

E

F

the positions close to those of the CRSPs and CT/CGRP using the CarthaGene software (Fig. 3). The positional order of the genes located in the vicinity of the CRSPs and CT/ CGRP was the same as the order in human and mouse, demonstrating that the chromosomal regions examined were conserved among swine, human, and mouse. When the order of the genes was examined using the IMNpRH panel DNAs giving higher resolution than the IMpRH panel DNAs (Yerle et al., 2002), the order thus obtained was the same as that obtained using the IMpRH panel DNAs except that CT/CGRP and CRSP3 were assigned to separate positions (Fig. 3). As for CRSP3, since the gene was shown to contain a CT-2 peptide similar to human CT and porcine CT, it may be inferred that CRSP3 was generated by ‘gene duplication’ of CT/CGRP after the ancestry species of swine branched off from the common ancestry species of swine, human and mouse.

46


Gene expression sites of CRSP1, CRSP2, and CRSP3 in porcine brain in comparison with those of mouse ␣CGRP and ␤CGRP As reported in our previous paper, mRNAs of CRSP1, CRSP2, CRSP3, and CGRP were detected in porcine brain as well as thyroid gland using an RT-PCR method (Katafuchi et al., 2003b). In the present study, localizations of CRSP1, CRSP2, CRSP3, and CGRP mRNAs in the brain were examined by in situ hybridization using cRNA probes as described in Materials and methods. Also in mouse brains, expression of ␣CGRP and ␤CGRP were examined using cRNA probes specific for respective genes. In parallel with the above hybridizations, control in situ hybridizations were performed on the tissue samples using LNE and CT probes, revealing apparently no signals (data not shown for LNE, or CT probes in Fig. 4). The results with the CT probe were consistent with those of RT-PCR obtained in our pre-

Cr

Hip

Oncorhynchus keta CT

P/Mi Mus musculus CT 0.91

NB

Rattus norvegicus CT

α CGRP

Homo sapiens CT Equus caballus CT Sus scrofa CT

0.56

8W

Canis familiaris CT Sus scrofa CRSP3

1.00 0.63

0.99

Sus scrofa CRSP2

NB

0.95

Bos taurus CGRPII Canis familiaris CRSP2

0.98

β CGRP

1.00 0.75

0.92

8W

0.97

Sus scrofa CRSP1 Bos taurus CRSP1 Canis familiaris CRSP1

Equus caballus CGRPI

Mus musculus β CGRP

0.62

1.00

Rattus norvegicus β CGRP

0.76

Mus musculus α CGRP

NB

1.00

0.1

Rattus norvegicus α CGRP

1.00

Homo sapiens β CGRP 0.94

HE

Homo sapiens αCGRP

Equus cabllus CGRPII

8W

LNE

8W

0.99

Fig. 5. Expression of ␣CGRP and ␤CGRP genes in mouse brain. In situ hybridizations were performed using cRNA probes to examine the expression of ␣CGRP and ␤CGRP genes in mouse brain using a 20! objective lens. Column Cr represents cerebrum regions; column Hip hippocampus regions; and column P/Mi pons/midbrain regions. Line NB represents tissues from newborn mice; Line 8W tissues from 8week-old mice. Line LNE represents the results of in situ hybridization using a negative control cRNA probe for tissues of 8-week-old mouse (see Materials and methods). Line HE represents haematoxylin-eosin staining of respective tissues. Scale bars represent 50 ␮m.

vious study (Katafuchi et al., 2003b). Furthermore, these results obtained with LNE and CT probes confirmed that the in situ hybridization system in the present study did not generate non-specific hybridization signals. CRSP1, CRSP2, and CRSP3 sense transcripts were detected in nerve cells of porcine cerebrum, hippocampus, hypothalamus, pons/midbrain, and thalamus. Additionally, CRSP2 sense transcripts were detected in glia-like cells of pons/midbrain and in meninx of tractus optics. The hybridizations indicated that signal intensities of the transcripts of

0.59

Sus scrofa CGRP

Canis familiaris CGRP1

Fig. 6. Phylogenetic analysis of amino acid sequences of the CT/ CGRP family. The amino acid sequences of the CT/CGRP precursor polypeptides in Eutheria, which were obtained from NCBI or UniProt database were subjected to phylogenetic analysis using the Bayesian Method. As an out-group control for the phylogenetic analysis, CT of Oncorhynchus keta (chum salmon) was used. Numbers at the branches represent posterior probabilities and the scale bar indicates substitutions/site.

CRSP2 were much higher than those of CRSP1 and CRSP3. When probed with CGRP, the tissues appeared not to give specific hybridization signals. This observation together with the fact that CGRP mRNA was detected in the brain tissues at a level comparable to that for mRNAs of CRSPs by the RT-PCR method (Katafuchi et al., 2003b) raised the possibility that CGRP sense transcript existed in regions other than those examined in the present study, or that CGRP was expressed rather uniformly in the tissues. Taken together, these findings clearly indicate different expression sites between transcripts of CRSPs and CGRP. In mouse brain, ␣CGRP sense transcripts were detected in nerve cells of cerebrum, hippocampus, and pons/midbrain in newborns, and only in nerve cells of pons/midbrain in adult (Fig. 5). ␤CGRP sense transcripts were detected in the same manner as for ␣CGRP sense transcripts, but ␤CGRP sense transcripts appeared to be far fewer than ␣CGRP sense transcripts (Fig. 5). These results taken together indicate that swine CGRP and mouse CGRPs have


47

similar expression profiles in the brain of adult animals, but the expression profiles of CGRPs do not correspond to any expression profiles of CRSPs. Phylogenetic analysis of amino acid sequences of the CT/CGRP family In order to obtain further information to ascertain their physiological roles, we performed phylogenetic analysis for amino acid sequences of the CT/CGRP precursor polypeptides using the Bayesian Method. As shown in Fig. 6, strong evidence indicates that porcine CRSP2 and CRSP3 were generated by gene duplication in the swine ancestry species that were separated from the common ancestry species of Artiodactyla. The cluster of porcine CRSP2 and CRSP3 is shown to further include bovine CGRPII (which we deduce to be CRSP2) and canine CRSP2. Porcine CRSP1 is shown to form another cluster with bovine and canine CRSP1, and with equine CGRPI (which we identified as CRSP1). These findings taken together indicate that the ancestry gene of CRSP2/ CRSP3 and CRSP1 may be traced back to the common ancestry species before Artiodactyla was established in Eutheria. The phylogenetic tree in Fig. 6 further indicates that CRSP1, CRSP2, CRSP3, ␣CGRP, and ␤CGRP would have branched off from a progenitor gene in the common ancestor of mammalian species. Discussion

CRSP1 and CRSP2 were found to consist of five exons (Fig. 1), which code for the signal peptide, N-terminal intervening peptide, and CRSP1 or CRSP2 peptide, respectively (Fig. 1). CRSP3 was found to consist of six exons (Fig. 1), which code for the signal peptide, N-terminal intervening peptide, CT2 (CT-like peptide), and CRSP3 peptide. The exon-intron structure of CRSP3 is almost identical to that of human CT/␣CGRP (Fig. 1). The RT-PCR method was used to examine for the existence of mRNA of CT-2, but it was not detected in the 19 examined tissues. CRSPs and CT/CGRP were assigned to SSC2 by RH mappings, and the order of genes in the chromosomal region containing CRSPs and CT/ CGRP was demonstrated to be conserved in the syntenic human and mouse chromosomes. Based on the present synthenic analysis of swine, mouse, and human chromosomes, CRSP1, CRSP2, and CT/CGRP were concluded to correspond to human (mouse) ␤CGRP, human CALCP (pseudogene), and human (mouse) CT/␣CGRP, respectively. Swine CRSP1 and CRSP2 were deduced to diverge from ancestor genes of ␤CGRP and CALCP, respectively. In contrast, CRSP3 did not have a corresponding gene in human and mouse, located in the vicinity of CT/␣CGRP, and its exon-intron organization was highly similar to that of CT/␣CGRP. This would suggest its generation by duplication of CT/␣CGRP in the evolution and divergence process of swine, human, and mouse from the common ancestry species. Expression sites of CRSPs in the porcine brain were examined in comparison with those of porcine CGRP and mouse CGRPs by the in situ hybridization system. In mouse CGRPs,

48


the expression patterns of ␣CGRP and ␤CGRP were similar to each other, though there were great differences in the expression level between neonate and adult mice. In brains of the 3-month-old pig and 8-week-old mouse, the expression of CGRPs, though little, was similar. In contrast, the three CRSPs, particularly CRSP2, showed marked expression in various areas of the pig brain that are distinct from CGRP, suggesting the separate physiological functions of these peptide groups. Among the CRSPs, the unique expression pattern of CRSP2 indicated that its physiological roles are different from those of CRSP1 and CRSP3 in swine. The nucleotide sequences in the 5ⴕ-upstream regions of CRSPs are highly conserved and show high sequence similarities with that of human CT/␣CGRP, including responsive elements. This indicates that expression of CRSPs would be regulated in a manner similar to that of human CT/ ␣CGRP. As described above, however, in situ hybridization analysis resulted in marked differences in the expression profiles between CRSPs and CGRP in swine, although RTPCR analysis of these genes in the brain regions showed similar expression profiles. The differences observed between in situ hybridization and RT-PCR methods may reflect the authentic expression and distribution of CGRPs at cellular or subcellular levels. The findings of the phylogenetic analysis shown in Fig. 6, however, are at odds with the above inference, based on the syntenic analysis of gene structure, that CRSP3 was generated by the gene-duplication of CT/CGRP. Based on the differences between the expression sites of CRSPs and CGRPs along with their phylogenetic relationships, it is surmised that CRSP1, CRSP2, and CRSP3 have followed a much different evolutional path from CGRPs to gain functions different from those of ␣CGRP and ␤CGRP. Moreover, CRSP1, CRSP2, and CRSP3 possibly have their own distinct functions in animal species including pigs. Since the CRSP1, CRSP2, and CRSP3 are expressed in nerve cells of porcine brain, and CRSP2 especially shows higher expression in nerve cells of hippocampus, CRSPs might be involved in signal transductions related to functions such as memory retaining. Genomic, biochemical, physiological and histological analyses of CGRPs and CRSPs in lower vertebrates would provide a more solid basis to understand the structure and physiological function of these peptides. In conclusion, this study has demonstrated a close evolutionary relationship between CRSPs and CGRPs, and suggested their divergence from an ancestor gene. These two peptide groups are deduced to acquire sequence diversity, different expression profiles and functions during the evolutionary process, which are still within the limits of the CT/CGRP family. Acknowledgements The authors are grateful to Dr. Kangawa of the National Cardiovascular Center Research Institute and to Dr. Kubo of the National Institute of Animal Health for valuable discussion and to Ms. A. Okabe, Y. Takada and S. Fujiwara of the National Cardiovascular Center Research Institute for their expert technical assistance.

References Isumi Y, Minamino N, Katafuchi T, Yoshioka M, Tsuji T, et al: Adrenomedullin production in fibroblasts: its possible function as a growth regulator of Swiss 3T3 cells. Endocrinology 139: 2552–2563 (1998). Katafuchi T, Kikumoto K, Hamano K, Kangawa K, Matsuo H, Minamino N: Calcitonin receptorstimulating peptide, a new member of the calcitonin gene-related peptide family. Its isolation from porcine brain, structure, tissue distribution, and biological activity. J Biol Chem 278:12046–12054 (2003a). Katafuchi T, Hamano K, Kikumoto K, Minamino N: Identification of second and third calcitonin receptor-stimulating peptide in porcine brain. Biochem Biophys Res Commun 308: 445–451 (2003b). Katafuchi T, Hamano K, Minamino N: Identification, structural determination, and biological activity of bovine and canine calcitonin receptor-stimulating peptides. Biochem Biophys Res Commun 313:74–79 (2004). Lanigan TM, Tverberg LA, Russo AF: Retinoic acid repression of cell-specific helix-loop-helix-octamer activation of the calcitonin/calcitonin gene-related peptide enhancer. Mol Cell Biol 13:6079–6088 (1993). Lin HY, Harris TL, Flannery MS, Aruffo A, Kaji EH, et al: Expression cloning of an adenylate cyclase-coupled calcitonin receptor. Science 254:1022–1024 (1991).

McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, et al: RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature 393:333–339 (1998). Milan D, Hawken R, Cabau C, Leroux S, Genet C, et al: IMpRH server: an RH mapping server available on the Web. Bioinformatics 16: 558– 559 (2000). Ohtsuki T, Furuya S, Yamada T, Nomura S, Hata J, et al: Gene expression of noncollagenous bone matrix proteins in the limb joints and intervertebral disks of the twy mouse. Calcif Tissue Int 63:167–172 (1998). Quandt K, Frech K, Karas H, Wingender E, Werner T: MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23:4878–4884 (1995). Ronquist FR, Huelsenbeck JP: MrBayes: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574 (2003). Schiex T, Chabrier P, Bouchez M, Milan D: Boosting EM for radiation hybrid and genetic mapping WABI’2001 (Workshop on Algorithm in Bioinformatics), pp 2149 (LNCS, Springer, New York 2001).

Shimogiri T, Kiuchi S, Hiraiwa H, Hayashi T, Takano Y, et al: Assignment of 204 genes localized on HSA17 to a porcine RH (IMpRH) map to generate a dense comparative map between pig and human/mouse. Cytogenet Genome Res 112:114–120 (2006). Tumbelson ME, Schook LB: Advances in swine in biomedical research, in Tumbelson ME, Schook LB (eds): Advances in Swine in Biomedical Research, pp 1–4 (Plenum Press, New York 1996). Tverberg LA, Russo AF: Cell-specific glucocorticoid repression of calcitonin/calcitonin generelated peptide transcription. Localization to an 18-base pair basal enhancer element. J Biol Chem 267:17567–17573 (1992). Yasue H, Wada Y: A swine SINE (PRE-1 sequence) distribution in swine-related animal species and its phylogenetic analysis in swine genome. Anim Genet 27: 95–98 (1996). Yerle M, Pinton P, Robic A, Alfonso A, Palvadeau Y, et al: Construction of a whole-genome radiation hybrid panel for high-resolution gene mapping in pigs. Cytogenet Cell Genet 82: 182–188 (1998). Yerle M, Pinton P, Delcros C, Arnal N, Milan D, Robic A: Generation and characterization of a 12,000-rad radiation hybrid panel for fine mapping in pig. Cytogenet Genome Res 97:219–228 (2002).


49