Molecular Vision 2009; 15:2435-2441 Received 10 August 2009 | Accepted 16 November 2009 | Published 20 November 2009
© 2009 Molecular Vision
Glucocorticoids inhibit the innate immune system of human corneal fibroblast through their suppression of toll-like receptors Xiuming Jin,1,2 Qin Qin,2 Lili Tu,2 Jia Qu2 1Eye Center, Affiliated Second Hospital, School of Medicine, Zhejiang University, Hangzhou, P.R. China; 2School of Ophthalmology
and Optometry, Eye Hospital, Wenzhou Medical College, Wenzhou, P.R. China Purpose: To evaluate the effect of glucocorticoids on the expression and function of Toll-like receptors (TLRs) in human corneal fibroblasts (HCFs). Methods: Cultured HCF cells were stimulated with three different concentrations of hydrocortisone. The effect on the expression of TLR2 and TLR4 was determined by real-time PCR. The TLR2, TLR4, and pIκB-α proteins were compared by western blot. The release of IL-6 and IL-8 was measured using enzyme-linked immunosorbent assay in the presence and absence of TLR2 and TLR4-specific blocking antibodies. Results: Incubation of HCFs with hydrocortisone markedly inhibited the expression of TLR2 and TLR4 mRNAs and decreased the release of IL-6 and IL-8 in a dose-dependent manner. Western blot analysis confirmed that expression of TLR2, TLR4, and pIκB-α was also downregulated in response to hydrocortisone. The result of ELISA also showed the release of IL-6 and IL-8 can also be inhibited by hydrocortisone. However, all these inhibitions were counteracted after pretreatment with anti-TLR2 and anti-TLR4 monoclonal antibodies. Conclusions: Glucocorticoids, such as hydrocortisone, can inhibit the expression of TLR2 and TLR4 on HCFs, and thus may increase susceptibility to cornea infections. Our results suggest that topical glucocorticoids may affect the cornea’s innate immunity through TLRs.
The corneal innate immune system consists of multiple cell types. The first layer of defense is the corneal epithelium. Immediately beneath this layer of epithelial cells is the stromal layer (fibroblasts are the principal cellular component), followed by an innermost single layer of endothelial cells. Corneal fibroblasts probably contribute to the local accumulation and activation of leukocytes in the cornea, and play an important role in infectious inflammation [1,2]. Recently, Toll-like receptors (TLRs) have been shown to play an essential role in triggering the innate immune response by recognizing pathogen-associated molecular patterns (PAMPs), and in stimulating the activity of host immune cells against several microbial products [3]. A growing number of studies have shown that TLR1-10s are expressed on both human corneal epithelium and fibroblasts [4-6], and that they play an important role in cornea protection and defense against microbial infection [4,6-9]. Glucocorticoids are widely recognized as regulators of adaptive immunity and inflammation and have been extensively used clinically to suppress a large variety of inflammatory and immune responses [10]. Topically, corticosteroids are the most widely used agents and are the standard treatment of nearly every inflammatory disease of the anterior segment [11,12]. The molecular and cellular Correspondence to: Jia Qu, MD; Professor of Ophthalmology; Wenzhou Medical College; 270 Xueyuan Road; Wenzhou, Zhejiang, 325027; P. R. China; Phone: 011-86- 577-88824116; FAX: 011-86-577-88824115; email:
[email protected]
mechanisms involved in the anti-inflammatory actions of glucocorticoids are now becoming clearer. However, there is no convincing evidence that topical glucocorticoids suppress innate immune responses in the cornea or increase susceptibility to cornea infections. In this study, we investigated the effects of hydrocortisone on the expression of TLR2 and TLR4 in human corneal fibroblast cells (HCFs). The results demonstrated that the functional expression of TLR2 and TLR4 is greatly downregulated in HCFs by hydrocortisone. However, these inhibitions can be counteracted after pretreatment with antiTLR2 and anti-TLR4 monoclonal antibodies. These findings provide evidence for the important role of glucocorticoids on infection keratitis and indicate that the use of topical glucocorticoids may affect the cornea’s innate immunity through TLRs. METHODS Reagents and antibodies: Dulbecco’s Modified Eagle Medium, F12, fetal bovine serum (FBS), and phosphatebuffered saline (PBS) were obtained from Invitrogen-Gibco (New York, NY). All media and cytokines used for cell culture were endotoxin-minimized. Tissue culture dishes and six-well chamber slides were from BD (New York, NY). Hydrocortisone was obtained from Calbiochem (Darmstant, Germany). Affinity-purified, monoclonal, anti-human TLR2, TLR4, and normal mouse immunoglobulin G (IgG) were from eBioscience (San Diego, CA). Paired antibodies for human interleukin-6 (IL-6) and IL-8 enzyme-linked immunosorbent
2435
Molecular Vision 2009; 15:2435-2441
© 2009 Molecular Vision
TABLE 1. PRIMERS FOR REAL-TIME PCR. Target gene VEGF TLR2 TLR4 GAPDH
Locus NM004716 NM003264 NM003266 NM204305
Forward sequence (5’–3’) ACCCCAGGTCAGACGGACAGAA TCTCCCATTTCCGTCTTTTT GAAGCTGGTGGCTGTGGA CCCCACACACATGCACTTACC
Reverse sequence (5’–3’) GGAATCCCCAAAGACCAGCAAT GGTCTTGGTGTTCATTATCTTC TGATGTAGAACCCGCAAG TTGCCAAGTTGCCTGTCCTT
assays (ELISA) were from BD. RNeasy Mini kits were purchased from Qiagen (Valencia, CA) for RNA extraction. RNA PCR kits were from Promega (Fitchburg, WI), and ethidium bromide, DNA molecular size markers, and agarose were from Gene Tech (Shanghai, China). SYBR Green PCR kits were from Applied Biosystems (Foster City, CA). Isolation and culture of human corneal fibroblasts: Four human corneas were obtained from the Eye Bank of Wenzhou Medical College (Wenzhou, China). The donors were Chinese males and females ranging in age from 23 to 28 years. After the center of each donor cornea was punched out for corneal transplantation surgery, the remaining rim of the tissue was used for the present experiments. Human material was used in strict accordance with the basic principles of the Declaration of Helsinki. Corneal fibroblasts were prepared and cultured as described previously [13]. Each cornea was digested separately with collagenase to provide a suspension of corneal fibroblasts. The cells from each cornea were cultured independently in DMEM supplemented with 20% FBS in 60 mm dishes until they had achieved ≥90% confluence, then these digested cells were moved from the 60 mm dishes to a 25 cm2 culture flask. They were used for the present study after four to six passages. Purity of the corneal fibroblast cultures was judged on the basis of cell morphology and reactivities with antibodies to cytokeratin, as previously described [14]. All the cells were negative for cytokeratin, suggesting that the cultures were not contaminated by epithelial cells. Cell challenge: The cells were stimulated with different concentrations of hydrocortisone (1, 10, or 100 μg/ml). For extracting total RNA, the cells were incubated under the stimulation of hydrocortisone for 48 h at 37 °C, and then harvested. For ELISA, the supernatants were incubated under the stimulation of hydrocortisone for 48 h at 37 °C, then collected and stored at −80 °C after centrifugation, until use. TLR blocking experiments were conducted by incubating HCFs with monoclonal antibodies against TLRs. HCFs were incubated at room temperature with either anti-TLR4, antiTLR2, both anti-TLR4 and anti-TLR2, or IgG control antibodies for 60 min. Cells were then treated with hyphal fragments for 48 h at 37 °C, and the supernatants were collected in order to evaluate the releases of IL-6 and IL-8. Real-time PCR: Total RNA prepared from confluent monolayers of HCFs was used to evaluate the constitutive expression of TLR2 and TLR4 mRNA. A negative control (the
Amplicon size (bp) 60 125 213 100
PCR without a preceding RT step) for each sample was run in order to assess whether there was residual genomic DNA in the DNase-treated samples. Real-time PCR was performed in an ABI PRISM 7500 Sequence Detection System Thermal Cycler (Applied Biosystems). Real-time PCR was performed on a volume of 15 μl containing 1.5 μl (50 ng) of cDNA and 13.5 μl of master mix containing 7.5 μl of mix (SYBR Green PCR Master Mix, Applied Biosystems, UK), 0.75 μl of each primer (10 pmol/l), and 4.5 μl of diethyl pyrocarbonate-treated water. The primers are listed in Table 1. The program was set at 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing at 60 °C for 60 s. The melting curve was analyzed by elevating the temperature from 60 °C to 95 °C while monitoring fluorescence. SYBR green fluorescence was monitored after each elongation period. Samples were amplified with GAPDH primers for determination of the initial relative quantity of cDNA in each sample, and then all PCR products were normalized to that amount. Negative controls (without template) were produced for each run. Samples were amplified in triplicate, averages were calculated, and differences in Ct data were evaluated by Sequence Detection Software V1.3.1 (Applied Biosystems). For data analysis, we used the comparative Ct method (ΔΔCt method) with the following formula: ΔCt=Ct (Target, TLR) − Ct (Endo, GAPDH). The comparative ΔΔCt calculation involved finding the difference between the ΔCt of treated cells and the mean value of the ΔCt from the untreated cells. Fold increase in the expression of specific mRNA in treated cells compared to untreated cells was calculated as 2-(ΔΔCt). Data are expressed as relative quantities (RQs), and differences are shown in the figures as the expression ratio of the normalized target gene, according to the software results. Immunofluorescent staining: HCFs were seeded onto LabTek tissue culture chamber slides without FBS for 24 h. The cells were then washed with Hank's Balanced Salt Solution (Invitrogen-Gibco) and stimulated with 10 μg/ml hydrocortisone for 48 h. The slides were then fixed in 4% paraformaldehyde for 15 min and washed with 10× Trisbuffered saline (TBS) 3 times for 5 min each. Fixed cells were incubated in a blocking buffer of 5% BSA (Proliant) and 0.1% Triton X-100 in PBS for 30 min at room temperature. Cells were then incubated with one or the other of the following dilutions of primary antibodies for 1 h at room temperature: primary mouse anti human TLR2 and TLR4 monoclonal
2436
Molecular Vision 2009; 15:2435-2441
antibodies (20 μg/ml in 5% BSA-PBS) or with mouse IgG (control). The secondary antibodies, conjugated to Cy3, were diluted 1:200 in 5% BSA-PBS and incubated for 1 h at room temperature. Coverslips were washed three times in PBS for 5 min, mounted (Vectashield; Vector Laboratories, Burlingame, CA), and viewed with a fluorescence microscope (Zeiss microscope Imager Z1, Zeiss, Germany). The DNAintercalating dye, DAPI dihydrochloride, was used to stain nuclei. For the negative control, preimmune mouse serum was substituted for the primary antibody. Western blot: Cells challenged with hydrocortisone were lysed in RIPA buffer (150 mM NaCl, 100 mM Tris-HCl [pH 7.5], 1% deoxycholate, 0.1% SDS, 1% Triton X-100, 50 mM NaF, 100 mM sodium pyrophosphate, 3.5 mM sodium orthovanadate, proteinase inhibitor cocktails, and 0.1 mM phenylmethylsulfonyl fluoride [PMSF]). Protein concentration was determined using the bicinchoninic acid (BCA) assay (Micro BCA; Pierce Biotechnology, Rockford, IL). Equal amounts of protein were mixed with SDS-PAGE protein loading buffer and boiled for 5 min. Proteins were separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis in a Tris/glycine/SDS buffer (25 mM Tris, 250 mM glycine and 0.1% SDS) and electro-blotted onto nitrocellulose transfer membranes. After blocking with 5% nonfat milk for 1 h, membranes were washed three times with TBST for 5 min and incubated overnight with polyclonal antibodies against TLR2, TLR4, and pIκB-α (1:1,000 dilution in 5% nonfat milk) in TBST. GAPDH was used as the control. After washing three times in TBST, membranes were incubated with secondary HRP-conjugated anti-mouse IgG for 1 h. The membranes were again washed with TBST three times, and one time in TBS, for 5 min each. Immune complexes were visualized with an enhanced chemiluminescence reagent (Pierce). Results were quantified by capturing the exposed x-ray film image and using area measurements from image analysis software. Enzyme-linked immunosorbent assays: The concentration of IL-6 and IL-8 in the cell culture supernatant fluids was determined by ELISA. The assay was performed according to manufacturer’s instructions. Results from two representative experiments are presented as the mean±SEM of triplicate cytokine measurements. Statistical analysis: Data are expressed as mean±SEM of triplicates from experiments repeated three times that yielded similar results. The statistical significance of differences was determined with the non-parametric Wilcoxon test and Student’s t test using SPSS, version 11.5. Differences were considered statistically significant at p