Henri Beaufour, France) and of Dr. G. Onstermann (Medical Academy of ...... Hartwig, J. H., Thelen, M., Rosen, A, Janmey, P. A, Nairn, A. C., and Aderem, A.
Vol. 269, No.4, Issue of January 28, pp. 2877-2886, 1994 Printed in U.S.A.
THEJOUENAL OF BIOLOGICAL CHEMISTRY 0 1994 by T h e American Society for Biochemistry and Molecular Biology, Inc
Human Endothelial Cells Are Targets forPlatelet-activating Factor (PAF) ACTIVATION OF a AND STIMULATED BY PAF*
p PROTEIN KINASE C ISOZYMES IN ENDOTHELIAL CELLS (Received forpublication, April 21, 1993, and in revised form, August 30, 1993)
Federico BussolinoSP, Francesca SilvagnoS, Giuseppe Garbarinon, Costanzo CostamagnaS, Fiorella Sanavioll, Marco AreseS, Raffaella SoldiS, Massimo Agliettall, Giampiero PescarmonaS, Giovanni Camussi**, and Amalia BosiaS From the $Department of Genetics, Biology and Medical Chemistry, Wnstitute of Internal Medicine and lllepartment of Biological Sciences and Oncology, University of Torino and the **Department of Biochemistry and Biophysics, University of Napoli, Napoli, Italy
We evaluated the role of the protein kinase C (PKC) with subsequent passageof inflammatory cells and increaseof and its isozymes in the activation of human endothelialpermeability to macromolecules. cells (EC) stimulated by platelet-activating factor (PAF). These functions are controlled and mediated through the Exposure of confluent EC to PAF resulted in a rapid and ability of EC to express immediate early genesencoding tranconcentration-dependentredistributionof PKCfrom sregulators factors, undergo reprogramming, and respond to cyto- and produce potent mediators, suchas autacoids andpolypepcytosoltoplasma-membrane,rearrangementof skeleton ( i e . decrease in F-actin content and redistributides (reviewed in Gordon (1991) and Mantovaniet al. (1992)). tion of vinculin), and finally increase in the transendo- Among them is platelet-activating factor (PAF, 1-radyl-2-acethelia1 flux of 1251-albumin. StimulationECofwith oleyl- tyl-sn-glycero-3-phosphocholine),a mediator of cell-to-cell com12-myristate 13-acetate acetylglycerol or phorbol munication, which acts viaa G protein coupled receptor (Honda induced the modificationof the cytoskeletal structures et al., 1991). This receptor signals through the activation of and the increase of 1251-albumin clearance. Inhibitors of phosphatidylinositol turnover, Ca2+ transients, and protein kiPKC prevented the effects inducedby PAF on the cyto(reviewed in skeleton and on the barrier function of the EC mono- nase C (PKC)andtyrosinekinaseactivation Shukla (1992)). PAF has inflammatory activity, causing microlayer. Confluent EC expressed onlya,p, and E PKC isoforms. vascular leakage, vasodilation, contraction of certain smooth muscles, andactivation of inflammatory cells (reviewed in Biochemical and immunochemical analysis showed that the time course of thePKC isozymes translocation from Prescott et al. (1990)). EC produce PAF after stimulation by necrosis faccytosol to the membrane fraction of EC stimulated by thrombin, histamine, interleukin-1, and tumor tor-a (Camussiet a l . , 1983; Prescott et al.,1984; McIntyre et al., PAF was different: p isoform was redistributed more 1985; Bussolino et al., 1988; Lascasse and Rola-Pleszczynski, quickly than a isoform. PAF did not induce translocation ofPKC E. These results suggest that activation of 1990; Kuijpers et al.,1992). PAF synthesized by EC is partially PKC a and p is an important signal transduction path- expressed on the surface of the cells and aids in neutrophil way by which PAF activates endothelial monolayer and adhesion (Prescottet al.,1984; Zimmerman et a l . , 1990; Lorant modify its function of barrier to macromolecules. et al.,1991) and their migration across vessel walls(Kuijpers et al., 1992). PAF itself activates EC modifying their adhesive properties The vascular endothelium is a morphologically simple but for circulating cells (Prescott et al., 1984, Zimmerman et al. functionally complex tissue that forms an active barrier be- 1990; Renkonen et al., 19901, inducing prostacyclin and PAF tween thebloodstream and underlying tissues. During acute or synthesis (D’Humiers et al., 1986; Heller et al., 1992) and hychronic injury the integrity of endothelial monolayer and the perpolarization (Lerneret al.,1988), changing their shape by a biological characteristics of endothelial cells (EC)I aremodified rearrangement of cytoskeletal structures and increasing the permeability of EC monolayer to macromolecules (Handley et * This work was supported by the Associazione Italiana Ricerche sul al. 1984; Bussolino et al., 1987; Grigorian and Ryan, 1987). Cancro (AIRC), the Consiglio Nazionale delle Ricerche (CNR: target project ACRO, FATMA, and Ingegneria Genetica), by the Istituto Su- Early biochemical changes induced by PAF in EC includea rise periore di SanitaYVIAIDSProject),and by Telethon. This is Paper I11 in in intracellular Ca2+ and the breakdown of membrane phosAre Target for Platelet-activating pholipids with the generation the series “Human Endothelial Cells of inositol phosphates (Bussolino of publication of this article were defrayedin part by et al., 1985; Brock and Gimbrone, 1986; Grigorian and Ryan, Factor.” The costs the payment of page charges. This article must therefore be hereby 1987; Ryan et al., 1988). marked “advertisement” in accordancewith 18 U.S.C.Section 1734 The elevation of inositol phosphates and cytoplasmic Ca2+ solely to indicate this fact. 8 To whom correspondence should be addressed: Dept. of Genetics, levels generated by a G protein coupled receptor (i.e. PAF reBiology and Medical Chemistry, Via Santena 5bis., 10126 Torino, Italy. ceptor) are eventsconsidered linked to the activation of PKC Tel.: 39-11-6967954; Fax: 39-11-674040. (Nishizuka, 1986, 1988). PKC defines a family of serine/ The abbreviations used are: EC, endothelial cells; F-PHD, fluorescein-labeled phalloidin; MOG, 1-monooleyl-rue-glycerol;PAF, platelet- threonine kinases involved in cell-surface signal transduction factor, l-radyl-2-acetyl-sn-glycero-3-phosphocholine); activating ( R)PAF, l-O-octadecyl-2-acetyl-(R )-glycero-3-phosphocholine; lyso-PAF, OAG, 1-oleylacetyl-rac-glycerol; RT, reverse transcriptase; PCR,pol-O-octadecyl-2-lyso-sn-glycero-3-phosphocholine; (S)PAF, 1-0-octadec- lymerasechain reaction; PAGE,polyacrylamide gel electrophoresis; yl-2-acetyl-(S)-glycero-3-phosphocholine; PDD,4a-phorbol12,13-dideBSA, bovine serum albumin;Mops, 4-morpholinepropanesulfonicacid; canoate;PKC, proteinkinase C; PMA, phorboll2-myristate 13-acetate; bp, base pair; kb, kilobase pair.
2877
2878
Role of PKC a and p in Endothelium
for the control of rapid (i.e. granule release) and delayed (ie. growthand differentiation) cellular responses (Nishizuka, 1986,1988).Molecular analysis showed that PKC exists as two different groups. The first group includes the four subspecies initially identified, a, PI, PII, and 7, which are active in the presence of Ca2+ and phospholipids (Coussens et al., 1986; Parker et al., 1986; Ohno et al., 1987; Ono et d., 1986; Knopf et al., 1986). The kinases belonging to the second group (6, E , q, 8, A, and 6) have a commonstructure which is closely related to, but clearly distinct from, the four members ofthe other group,and they do not require Ca2+ for their activity (Ono et al., 1988, 1989; Ohno et al., 1988; Koide et al., 1992). In this study we present evidence that endothelial CY and P PKC participate in the second messenger pathways triggered by PAF and that PKC activation plays a role in the rearrangement of cytoskeleton caused by PAF stimulation.
m~ NaCl, routinely the elution of the enzyme was obtained by application of a step concentration gradient of NaCl in buffer B, and PKC was eluted with 4 ml of 120 m~ NaCl. A peak fraction containing PKC activity (-60 pg of protein) was applied to a hydroxylapatite-Ultrogel column (Bio-Rad)(0.7 x 20 cm) according to Melloni et al. (1989). The column was washed with 30 ml of buffer C followed by 50 ml of buffer C containing 40 m~ KPO,. PKC activities were eluted with a linear concentration gradient (100 ml)of KPOl (40-90 m ~ followed ) by 30 ml at 90 m~ and 20 ml at 200 m ~ The . flow rate was 0.5 ml/min, and fractions of 1ml were collected.PKC was measured in 100 plof eluted fractions. To measure the PKC translocation from cytosolic tomembrane fraction, 150-cm2Petri dishes (-7 mgof protein) (one dish used for the experiments of PKC translocation) or 450-cm2plates (one plate used for the experiments ofPKC isozymes translocation) were washed three times with medium 199-BSAand then stimulated at 37 "C for different periods of time in prewarmed medium 199-BSA. PKC Assay-Total PKC activity was quantified by measuring incorporation of 32Pfrom [y-32PlATP(Amersham Carp., >5000 Ci/mmol)into type 111-S histone (Castagna et al., 1982). 100p1 of test mixture (10 m~ MATERIALSANDMETHODS Tris-HC1, pH7.4,5 m~ MgCl,, 1.75 m~ CaCl,, 10 ~ M A T Pcontained ) 10 Reagents and Bu~ers-l-O-Octadecyl-2-acetyl-(R)-glycero-3-phos- pg of phosphatidylserine, 10 pg of l,a-diolein, 100 pg of 111-S histone, phocholine) ((R)PAF), l-O-octadecyl-2-lyso-sn-glycero-3-phosphocho-and 1pCi of [32PlATP.In some experiments, 111-Shistone was replaced line (lyso-PAF),and 1-0-hexadecyl-2-0-methyl-rac-glycerol were from by myelin basic protein (200 pg/ml). Nonspecific PKC activity was asBachem Feinkemikalien (Switzerland); H-7 (l-(5-isoquinolinylsulfo- sayed without cations and lipids but inthe presence of EGTA. Net PKC nyl)-2-methylpiperazine)from Seikagaku Co. (Miami, FL); CV-3988 activity was calculated by the difference betweentotal and nonspecific from Takeda Chemical Industries (Osaka, Japan); SRI63072 fromSan- PKC activity. doz Research Institute (East Hannover, NJ); H-89 (N-(2-(83-(4-bromoWestern BlotAnalysis-Samples containing PKC activity, eluted phenyl)-aminoethyl)-5-isoquinolinesulfonamide), and KT5720 from from DEAE-Sephacel or hydroxylapatite-Ultrogelcolumns were concenCalbiochem (La Jolla, CAI; myelin basic protein from Upstate Biotech- trated by a Centricon 30 apparatus (Grace Italiana S.p.A., Divisione nology, Inc. (Lake Placid, NY). BN52021and l-O-octadecyl-2-acetyl-(S)- Amicon, Milano, Italia). Proteins were directly solubilized in boiling glycero-3-phosphocholine((S)PAF)were a gift of Dr. P.Braquet (Institut Laemmli (1970) buffer with reducing agents. Proteins, separated by SDS-PAGE (lo%), were transferred to nitrocellulose sheets (AmerHenri Beaufour, France) and of Dr. G.Onstermann (Medical Academy of Erfurt, Republic of Germany), respectively. Polyclonal anti-rat PKC sham) (Towbin et al., 1979) and probed with rabbit antibody anti-synantibody was a gift ofDr.K. Huang (National Institutes of Health, thetic peptides (1:lOO dilution) containing sequences unique for differBethesda, MD); polyclonal antibodies anti-synthetic peptides contain- ent PKC isoforms. In some experiments 1pg/ml of specific peptide was ing specific sequence of PKC (I (AGNKVISPSEDRRQ), PKC p (GPKT- added to primary antibody solution to detect the specificity of antibody. PEEKTANTIUSKFD), and PKC y (NYPLELYERVRTG)were kindly lZ5I-ProteinA (35 mCi/mg, Amersham) or peroxidase-labeled goat antiprovided by Dr. M. Makowske (Memorial Sloan-Kettering Cancer Re- rabbit antibody (Amersham) visualized byECL system (Amersham) search Center, New York); polyclonalantibody anti-PKC c was obtained were used to detect antigen-antibody interaction. from Life Technologies Inc.; polyclonalantibody anti-PKC S was generNorthern Blot Analysis-%tal RNA was obtained from murine brain mouse, Charles River, Italy) and EC by the guanidine ated by immunizing rabbits with a specific synthetic peptide present in (B6 the PKC 6 sequence (Ogita et al., 1992)(LPETPETVGIYQGFEKK,syn- isothiocyanate/cesium chloride method (Chirgwin et al., 1979). Thirty thesized by Dr. G.Tarone, University of Torino) conjugatedwith keyhole pg of total RNA were electrophoresed on a 1%agarose gel containing limpet hemocyanin and then affinity-purified by passage of the serum 6.3% formaldehydein MOPS bufferand blotted on a Nylon Duralon-UV through a column of peptide conjugated to epoxy-activated Sepharose membrane (Stratagene, La Jolla, CA) by the traditional capillary sys6B beads (Pharmacia LKBBiotechnolgoy Inc.); monoclonal antibody tem in 10 x SSC (Maniatis et al., 1982).Pre-hybridization and hybridanti-vinculin (Vin 11-5)was obtained from Bio-Yeda (Israel). Reagents ization steps were performed over night in 50% deionized formamide, for SDS-PAGE were from Bio-Rad. AGNKVISPSEDRRQ and GPKT- 10%dextran sulfate, 5 x SSC, Denhardt's solution, 20 m~ sodium phosPEEKTANTIUSKFD peptides were synthesized by Dr. G.Tarone in our phate buffer, pH 6.8, 0.2% SDS, with 100 pdml denaturated salmon sperm DNA at 42 "C. In some experiments the hybridization was done department. All other reagents were from Sigma. Stock solutions of phorboll2-myristate 13-acetate (PMA),l-oleylace- in the presence of 100-fold excess of cold-specificcDNA. The cDNA tyl-rac-glycerol(OAG), 1-monooleyl-rac-glycerol(MOG), 4a-phorbol probes (kindly provided by Genetics Institute, Cambridge, M A ) for human PKC (I (length 129 bp), rat PKC p (166 bp), rat PKC y (183 bp) 12,13-didecanoate (PDD), calphostin C, staurosporine, KT5720, and (Knopf et al., 1986),rat PKC S (183 bp), rat PKC E (198 bp), rat PKC 5 BN52021were made in Me2S0. In each experiment, control and samples received the same volume of solvent, and the final solvent (197 bp) (On0 et al., 1988)were obtained as EcoRI-EamHI (Boeringher Manneheim) excision fragment from pGEM clones and were labeled concentration never exceeded 0.1%. (3000 T P Ci/mmol, Amersham) at 5 x lo8 to 1.6 x lo9 The buffers are as follows: medium 199-BSA, medium 199 supple- with [ ( I - ~ ~ P I ~ C cpndpg specific activity, by the random primer labeling method (Feinmented with 0.25% BSA and HEPES 20 m ~ pH , 7.4; buffer A, 10 m~ HEPES, 10 m~ 2-mercaptoethanol, 5 m~ EDTA, 10% glycerol, pH 7.5; berg and Vogelstein, 1983). Twenty-five ngof DNA in 2% low melting buffer B, buffer A containing 0.24 M sucrose, 0.43 m~ phenylmethylsul- point agarose (Life Technologies, Inc.) were labeled overnight at room temperature in a 50-pl final volume containing deoxynucleotides trifonyl fluoride, 0.1 m~ leupeptin, 0.005 l l l ~pepstatin, and 22 unitdml phosphates ( d N T P ) , random hexanucleotides (Amersham multiprime aprotinin; buffer C, 20 m~ KPO,, 10% glycerol, 1 m~ EDTA, 10 m~ 2-mercaptoethanol, pH7.5, supplemented with the same concentra- DNA labeling systems kit, Amersham), 50 pCi of [a-32PldCTP,and 2 units of Kienow enzyme (Amersham). Post-hybridization washes were tions of protease inhibitors in the buffer B. Partial Purification of PKC-PKC purification and characterization performed at high stringency (once in 2 x SSC, 0.1% SDS for 30min, once in 0.2 x SSC, 0.1% SDS for 30 min, and twice in 0.1 x SSC, 0.1% of its isoforms was done with confluent EC grown on 450-cm2 plates (Nunc Intermed, Roskilde, Denmark) (-20 mg of protein). After exten- SDS for 30 min) at 57 "C, and the membrane was exposed on autorasive washing with PBS, the cells werescraped in 15 ml of cold buffer B, diography with Hyperfilm-MP(Amersham) and intensifying screens at sedimented, and resuspended in 2 ml of buffer B. After sonication (6 -80 "C. Reverse Danscriptase-Polymerase Chain Reaction (RT-PCR) of PKC pulses of 10 s in ice bath, 100 W), cytosolic and membranous fractions were prepared by ultracentrifugation (100,000 x g , 1h, 4 "C).The mem- Isozymes-O.5 pg of total RNA was used for the synthesis of cDNA and brane fraction was resuspended in 1ml of buffer B containing 1%Triton PCR, using the standardprotocol of GENE AMP RNA PCRKit (PerkinElmer Cetus). A PCR was performed on a Perkin-Elmer Cetus DNA X-100. The cell fractions were applied to a DEAE-Sephacel column (Pharmacia) (0.9 x 2.5 c m ) equilibrated with buffer A (Kikkawa et al., thermal cycler (model 480). The following specific oligomers (TibMol1982). The kinase activity was eluted by application of a 15-ml linear biol Berlin GmbH, Berlin, Germany) for each PKC were used (Freireconcentration gradient of NaCl(O-O.2M) in buffer A at a flow rate of 0.2 Mair et al., 1991): PKC y, 5' CGGGCTCCCACATCAGATGAG 3' (upmumin. To established that PKC from EC eluted between 90 and 120 stream)and 5' GCAGGCGTCCTGGGCTGGCACC 3' (downstream)
-
Role of PKC 1
2
1
12-
01
and p in Endothelium
2879
A
2
15oc
300
*iI
5-
..
200
0
w
.'. A
G
' b
1
"
c
B
11 22
'0
$01
1 2
500
100
Cl
bV G 3.2-
UR 6.: 42-
a
-1
3 (r
0
0 0
50
100
150
200
Fractions
1:
E
D
B
F
1
2
3
4
B 1
A
2
1
2
B
1
2
C
1
2
D
FIG. 1.Expressionof PKC genes in EC. Panel A, Northern hybridization of total RNA (30 pg)from EC (lanes 1) and from murine brain (lanes 2 ) with cDNA probes specific for mRNA of a (A), p ( B ) ,y (C), 6 (D),E ( E ) , and 5 ( F ) . X-ray films were exposed for 7-10 days with intensifylng screens. The numbers on the left of the lines indicate the size of the transcript kilobases. in Panel B, total RNAfrom murine brain (lane 1 ) and EC (lane 2 ) was reverse-transcripted and amplified by PCR as described under "Materials andMethods" by using specific primers for PKC y (A), 6 ( B ) ,E (C), and 5 (D). Products of amplification were analyzed on a 1% agarose gel and visualized by ethidium bromide fluorescence.
FIG. 2. Biochemical and immunological detection of Q and fl PKC isozymes in EC. Panel A, resolution of PKC activity by hydroxylapatitechromatography. Cytosolic PKC waspartial purified by DEAE-Sephacel chromatography, applied toa Ultrogel-hydroxylapatite column and eluted with a KPO, gradient (- - - -). PKC activity was quantified by measuring incorporationof 32Pfrom [y-32PlATPinto type 111-Shistone as described under "Materials and Methods." (0)cytosolic tested without cationsand lipids but in the activity; (+)cytosolic activity PaneZ B , immunoblot analysis of partially presence of EGTA (0.5 m). (Knopf et al., 1986); PKC 6,5' CACCATCTTCCAGAAAGAACG 3' (up- purified PKC with specific antibodies for PKC a and PKC p. Fractions stream) and5' CTTGCCATAGGTCCCGTTGTTG 3' (downstream) (On0 corresponding to peak 1 (fractions 65-93) and 2 (fractions 110-150) were et al., 1988); PKC E , 5' CATCGATCTGTCGGGATCATCG 3' (upstream) were concentrated by a Centricon 30 apparatus, and proteins and 5' CGGTTGTCAAATGACAAGGCC 3'(downstream) (Ono et al., separated by SDS-PAGE (10%) and then transferredto nitrocellulose. 1988); PKC [,5' GCATGGGGTGGATGGGATCAAAA3' (upstream) and The immunoreactivity for PKC a (lane 2 ) was detected in the second 5' GTA'ITCATGTCAGGG'ITGTCTG 3' (downstream) (Ono al., et 1988). peak and that for PKC p (lane 1) in the first peak. Lanes 3 (antibody The PCR protocol for the amplification of PKC y, PKC E , and PKC 5 anti-PKC p) and 4 (antibody anti-PKCa)represent Westernblot analyses in thepresence of the specific immunogenic specific peptide (1pg/ cDNAs was 1min a t 94 "C, 1min a t 55 "C, 2 min at 72 "C for 30cycles; ml). Antibody anti-PKC a did not recognize PKC in the first peak, nor 1 min at 94 "C, 1 min at 55 "C, 10 min at 72 "C for the lastcycle. The does antibody anti-PKC p recognize material in the second peak (not protocol for the amplification of PKC E cDNA was 1min at 94 "C, 1min shown). 1251-proteinAwasused to detect the immunoreactive bands and a t 60 "C, 1min at 72 "C for 2 cycles; 30 s a t 94 "C, 30 s a t 60 "C, 1min x-ray films wereexposed for 25 days. a t 72 "C for 30 cycles; 30 s a t 94 "C, 30 s a t 60 "C, 10 minat 72 "C for the last cycle. 10 pl of the amplified solution wererun in 1.8% agarose-gel 300 rn sucrose, 50m NaCI, 3 m MgC12, 0.5% Triton X-100, pH 7.4) electrophoresis(Maniatiset al., 1982) andstainedwith 0.5 pg/ml (Bussolino et al., 1987). Staining for F-actin was performed with fluoethidium bromide. The productsof PCR were analyzed and identified by rescein-labeled phalloidin (F-PHD) (200n~ for 20 min at 37 "C in the Southern blot analysis with the specific cDNAs labeled a s described dark), for vinculin with specific monoclonal antibody (diluted 1:500) before a t a specific activity of 2.5 x loRc p d p g . followedby fluorescein-tagged rabbit anti-mouse IgG. PKC was deFluorescence Microscopy Studies-EC were g r o w n at confluence on tected by a goat anti-rat PKC (diluted 1:50) followed by fluoresceinglass coverslips coated with rat collagen (1 pg/ml). Monolayers were tagged rabbit anti-goat IgG. The primary antibody was replaced by stimulated as described under "Results," washed twice with PBS, and non-immune I g G mouse in controls. Coverslips mounted in PBS-glycfixed with isotonic formaldehyde (3%) solution, pH 7.6, containing 2% erol (l:l,v/v) were observed by a Zeiss Axiophot microscope equipped for sucrose, and then permeabilizedby Triton X-100buffer (20 m~ Hepes, epifluorescence.
-
Role of PKC a and p in Endothelium
2880
; t
0 0
5
10
15
20
0.1
1
10
o l 0 0
100
Minutes FIG.3. Effect of (R)PAFon PKC activation in EC.Panel A, time-courseof (R)PAF-inducedPKC activation. Confluent EC (150-cmzPetri dish) were stimulated in 15 ml of medium 199-BSAat 37 "C with 50 n~ (R)PAF. Cytosolicand membrane fractions were prepared by ultracentrifugation (100,000 x g, 1h at 4 "C) as described under "Materials and Methods" and applied to a DEAE-Sephacel column (0.9x 2.5 cm). PKC activity was T P type 111-S histone. Net PKC activity eluted with 4 ml of 120 m~ NaCl and quantified by measuring incorporation of 32Pfrom [ Y - ~ ~ P Uinto resulted from the difference of substrate phosphorylation in the presence of Ca2+,phosphatidylserine, and diolein, or of EGTA as detailed under "Materials and Methods." (0)cytosolic fraction; (0) membrane fraction. Panel B , dose-dependent effect of (R)PAF-induced PKC activation. Confluent EC were stimulated for 5 min at 37 "C with different concentrations of (R)PAF and processed as above. Percent translocation refers to the netPKC activity translocated from cytosol tothe membrane fraction. Results are the mean values f S.D. of three determinations in one typical experiment out of three performed with similar results. Fluorimetric Studies-The assay of F-actin was done with a slight modification of the method of Rotrosen and Gallin (1986).EC monolayers grown on 24-well plates were stained with F-PHD as previously described, and F-actin was extracted with methanol (1 d w e l l , 1 h at 37 "C in the dark).Measurement of F-actin from the fluorescence of the intracellular F-PHD was performed with a Perkin-Elmer fluorimeter (LS5 model) at room temperature. Standard monocromator settings were 495-nm excitation (5-nm slit) and 525-nm emission (10-nm slit). Fluorescence was read after 3 min. To compensate for small difference in the cell number, 10 m~ ethidium bromide was added to stain the cell nucleus, and thefluorescence (excitation 360 nm; emission 580nm) was recorded. All F-PHD values were corrected for autofluorescence of cells. The data areexpressed as theratio of F-PHD fluorescenceand ethidium bromidefluorescence,which reflects the F-actin amount per EC in arbitrary units. Control experiments showed that F-PHD and ethidium bromide staining were linearly correlated (r2= 0.93) when cells were plated between 0.5 and 1.4 x lo5 celldcoverslip. Cell Cultures-Human EC derived from umbilical cord veins were grown in medium 199 (Life Technologies, Inc.) supplemented with 20% fetal calf serum (Imine, Santa Ana, CA), endothelial cell growth factor (100 pg/ml), and porcine heparin (100 pglml), and cells were used at early passages (EN)(Camussi et al., 1983). 1251-AlbuminEndothelial Permeability Assay-The EC permeability was determined by calculating the ratio of lZ5I-albuminin the upper and lower chambers of the filter chamber assembly (Costar Europe Ltd., Badhoevedorp, The Netherlands, with a 0.2-pm pore diameter, 24-mm dish diameter) (Bussolino et al., 1987). The upper chamber contained 200 p~ bovine serum albumin and 0.1 pCi of 1261-albumin(3 mCi/mg, DuPont NEN) in 2 ml of medium 199.f i r 1-h incubation in continous agitation at 37 "C,5% CO,, the base-line permeability was determined. 4.6 f 0.7% of 1251-albumin(mean f S.D. of three experiments done in duplicate) added to the upper chamber was recoveredin the lower. The base-line permeability of the membrane without EC was 58.0 5 5.6% (mean -c S.D. of three experiments). Stimuli were added to the upper chamber, and incubation was continued for 1 h. Radioactivitywas counted in the lower chamber,and the resultsare expressed as percent change of albumin clearance = (cpm lZ6I-albuminafter stimulus - cpm lZ6I-albumincontroVcpm 1251-albumincontrol) x 100.
TABLE I Specificity of (R)PAF-induced PKC activation in endothelial cells EC were treated for 10 min at 37" C with medium 199-BSA with or without CV-3988, BN52021, or SRI63072,and thenstimulated for 5 min with the indicated agonists. The numbers indicated the means f S.D. of four determinations in one typical experiment. Treatment
Net PKC activity"
Cytosol
Membrane
cpm 1 x 1P
None (R)PAF, 50n~ (S)PAF, 50 n~ LYSO-PAF,500 n~ 10 CV3988, p~ 0.48 CV3988,10 p~ + (R)PAF,50 n~ BN52021,5 p~ BN52021,5 p~ + (R)PAF,50 n~ SRI63072,20 p~ SRI63072, 20 p~ + PAF, 50 n~
2.12 f 0.32 0 0.92 f 0.26 0.81 0.14 2.13 f 0.18 0 1.93 f 0.350.07 2 0.03 0 2.31 1.93 f 0.120.12 f 0.04 2.09 f 0.36 0 2.31 f 0.42 0 2.50f 0.75 0 1.61 2 0.54 0.21 f 0.03
*
Net PKC activity resulted from the difference of substrate phosphorylation in thepresence of CAz+,phosphatidylserine and diolein, or ofEGTA as detailed under "Materials and Methods." Values are 32P incorporated in 40 pg of histone.
ine, but two groupscan be differentiated by the requirement of Ca2+.The first group includes a,PI, PII, and y isozymes, which are active in the presence of Ca2+,while the second consists of 6, E , 7 , 0, A, and 5 forms, which are Ca2+-insensitive(reviewed in Asaoaka etal. (1992)).We examined the capacity of confluent human EC to express mRNA of subspecies representative of these two groups (a,P, y, 6, E , and 5) by Northern blot analysis orbyRT-PCR (Fig. 1). When RNA from EC was analyzed by Northern blot we detected transcripts only for PKC a and p, whereas RNA extracted from mouse brain, used as positive control, hybridized with all cDNA tested. Two major bands (8 and 3.2 kb) of EC and brain RNA hybridize with a-cDNA, the RESULTS transcripts that hybridize with p-cDNA were of 12 and 5 kb in EC and of 8 and 2.5 kb in brain suggesting a differential splicEndothelial Cells Express a, P, and e PKCIsozymes-The members of the PKC family are dependent on phosphatidylser- ing. The size of transcripts of differentPKC isoforms in mouse
Role of PKC
CY
and p in Endothelium
2881
brain agreed to that reported in the literature (Knopf et al., stimulus level after 15 min. The effect of (R)PAF was dosewhen EC were 1986; Ohno et al., 1987; Ono et al., 1988) (Fig. lA). To confirm dependent. The effect wasalreadyevident the specificity of transcripts of a and /3 isoforms expressed in stimulated with 1 M (R)PAF andreached maximum values at EC, Northern blots were performed in the presence of a 100- 50-100 nM (Fig. 3 B ) . After 15 min, PKC disappeared in the fold excess of cold specific cDNA. In these conditions, the EC membrane fraction, probably due to the activation of proteotranscripts of PKC a and p were not detected (not shown). To lytic enzymes (Nishizuka, 1986, 1988). As shown in Table I, specific receptor antagonists of ( R)PAF did not change the subconfirm these results and to use a more sensitive technique, RNA extracted by EC was analyzed by RT-PCR choosing spe- cellular distribution of PKC activity in unstimulated cells, but cific primers for PKC y , 6, E, and 5 (Fig. ll?). Amplification of almost completely prevented (R)PAF-induced translocation of RNA from EC and from mouse brain by using specific primers for PKC E gave a band of 731 bp, which corresponds to the selected region of this isoform and isrecognized by the specific cDNA in Southern blots (not shown). The use of primers for PKC y, 6, and 5 gave specific bands only when brain RNA was amplified (Fig. ll?). It was important to establish whether PKC isozyme gene expression in EC was accompanied by production of these enzymes. Consistent with the results reported in othercells and tissues (Nishizuka,1986,19881, a single peakof protein kinase activity, identified as PKC by its absolute requirements for Ca2+ and phospholipids for activity, was detected in the cytosolic fraction of confluent EC by DEAE-Sephacel chromatography. The PKC eluted at 90-120 mM NaCl and was absent in the membrane fraction of the cells (not shown). The fractions eluted from DEAE-Sephacel column containing PKC activity were pooled and applied to a hydroxylapatite column, which resolves a,p, and y isozymes into three distinct peaks (Huang et al., 1986). The kinaseactivity, Ca2+/phospholipid-dependent, appeared as two peaks. The first peak eluted at approximately 50 m~ KP04and represents 30% of the total PKC kinase activity present in the EC cytosol. The second peak eluted at about 75 mM KP04and accounts for the 70% of the totalactivity (Fig. 2A ). To detect theproteins as PKC isozymes, eluates were concentrated, separated bySDS-PAGE electrophoresis, and transferred to nitrocellulose. The membranes were incubated with polyclonal rabbit antibodies directed against peptides specific for a,p, and y isozymes of PKC (Makowske et al., 1988) in the presence or absence of the peptides used to raise them. After incubation with '251-protein A and autoradiography, a band of 80 kDa was detected when peak 1 was probed with antibody anti-PKC p and peak 2with anti-PKCa (Fig. 2B 1. The detection of these immunoreactive bands was inhibited by addition of corresponding peptide to the primary antibody solution (Fig. 2 B ) . A protein present in both peaks cross-reacted with a polyclonal antibody anti-rat brainPKC, but not with an antibody anti-PKC y (not shown). Since we detected also a transcript of PKC E, the presence of the specific protein in cytosolic or membrane fraction of EC was confirmed by immunoblot analysis using a polyclonal antibody anti-PKC E after purification of PKC activity on a DEAE-Sephacel column. The specific antibody reacted with a 90-kDa protein detectable only in the cytosol of EC (not shown and Fig. 6). The immunoreactive band had a molecular weight similar to that of PKC E of brain (Koide et al., 1992). We detected this band only with a n enhanced chemiluminescence technique using as second antibody an anti-rabbit antisera coupled to peroxidase, but not with the less sensitive technique based on 1251-proteinA. These data together with the low level of mRNA detected only with RTPCR suggest that PKC E was present in levels much smaller than those of a and p isozymes. Activation of PKC a and p in Endothelial Cells Stimulated by PM-In resting and confluent EC, PKC was totally recovered FIG.4. Effect of PMA and (R)PAF'on the immunofluorescence in thecytosolic fraction. Exposure of EC to 50 n~ ( R)PAF for 5 localization of PKC in EC. The cells grown on collagen-coated glass m ) or with (RjPAF(50 nu) for 15 min decreased cytosolic PKC activity to 40% of the control coverslips were treated with PMA(10 and 5 min, respectively in1 ml of medium 199-BSAat 37 "C.Fixed and value and increased PKC activity in the membrane fraction permeabilized cells were incubated with a goat-anti-rat PKC antibody correspondingly (Fig. 3 A ) . The PKC redistribution after addi- (1:50) followed by a fluorescein rabbit anti-goat IgG. A, control; B , PMA; tion of (R)PAF peaked after 5 min and returned to the pre- c, (R)PAF.
Role of PKC a and p in Endothelium
2882
0
5
10
15
20
0
5
20
15
10
Minutes
Minutes
FIG. 5. Time course of PKC CY (Panel A ) and PKC f3 (Panel B ) activation in EC stimulated with (R)PM. Confluent EC(450-cm2plates) were stimulatedin 35 ml of medium 199-BSA a t 37 "C with 50n.~(R)PAF. PKC isozymes in thecytosolic and membrane fractions were separated as described in the legend to Fig. 2. Fractions corresponding to PKC p (65-90) and to PKC a (115-150) were pooled and concentrated with a Centricon 30 apparatus, and netPKC activity was measured a s described under "Materials andMethods." Results are the mean values f S.D. of three determinations inone typical experiment out of two performed with similar results. ( 0 )cytosolic fraction; (0)membrane fraction.
the enzyme. 50 n~ (S)PAF and 500 nM lyso-PAF were ineffective. The effect of (R)PAF on PKC redistribution in EC was also evaluated by immunofluorescence technique. A polyclonal antibody anti-rat PKC revealed a diffuse cytosolic distribution of the immunoreactive PKC in resting EC (Fig. 4A). The treatment of the cells with 100 n~ (R)PAF for 5 min markedly decreased the cytosolic staining andincreased the immunofluorescence of the plasma membrane in about5 0 4 0 % of the cells (Fig. 4C). PMAhad a similar effect in 90% of the cells (Fig. 4B). To evaluate theeffect of (R )PAF on the redistributionof a,(3, and E PKC isozymes, EC were stimulated with 50 nM (R)PAF. After DEAE-Sephacel purification, PKC in cytosolic and membrane fractions were further separated by a hydroxylapatite column to study thebehavior of a and (3 isozymes. After (R )PAF treatment, a and (3 isozymes in the cytosol were decreased. PKC /3 activity was reduced rapidly in thecytosol (about 70%), and it appeared after 2 min inthe membranefraction (Fig. 5B ). The decrease of PKC a in the cytosol (about 50%) was slower and reached the maximum a t 7 min (Fig. 5 A ) . The different time courses of the redistribution of a and (3 isozymes in EC treated with (R )PAF were confirmed by immunoblotting studies. The immunoreactive 80-kDa protein recognized by polyclonal rabbit antibodies directed against peptides specific for a and (3 isozymes decreased in the cytosol with a kinetics similar to that demonstrated with biochemical techniques (Fig.6). Thetranslocation of PKC E was studied only by immunoblot analysis on DEAE-Sephacel-purified PKC from EC. After stimulation with 50 n~ (R)PAF, the amount of immunoreactive 90-kDa protein recognized by anti-PKC E antibody in cytosol did not change, indicating that PAF does not translocate this isoform of PKC (Fig. 6). Rearrangement of Cytoskeleton in Endothelial Cells Stimulated by PAF and OAGLUpon staining with F-PHD that specifically binds F-actin, resting EC showed a n elaborate arrayof microfilament bundles of the stress fiber type and flattened elongated shape (Fig. 7 A ) . Furthermore, EC showed scattered streaks of vinculin localization, which corresponds to areas of focal contact of the ventral membranewith adhesion substratum (Fig. 7B). According to our previous observations (Busso-
0' 5' 10' 15' -zs.
i
80 Kd-
80 Kd-'
, A .\?.(Roc"-".
B
"" 90Kd-
c
c
FIG.6. Immunoblot analysis of cytosolic PKC from EC stimulated with (R)PAF. ConfluentEC (one 150-cm2Petri dish was used to study a and p isoforms and three 150-cm2dishes for the E isoform) were stimulated in 15 ml of medium 199-BSA a t 37 "C with 50 n~ (RIPAF, and cytosolic PKC was purified by DEAE-Sephacel chromatography. After concentration by Centricon 30 apparatus, the samples were subjected to SDS-PAGE, and proteins were transferred to nitrocellulose. Immunoblot analysis was carried out by specific rabbit antibody antisynthetic peptides containing sequences unique to PKC p (Panel A), PKC a (Panel B ), and PKC E (Panel C ) (1:IOO dilution). InPanels A and B lZ5I-protein A was used to detect the immunoreactive bands, and x-ray films were exposed for 10 days. The immunoreactive band in Panel C was detected by ECL technique.
lino et al., 19871, within 15 min after addition of 100 n~ (R)PAF (Fig. 7C) or 200 p~ OAG (not shown), an activator of PKC, stress fibers partially disappeared, while F-actin appeared to be predominantly associated with the cell periphery. The same treatment of the cells with (R)PAF subverted the focal localization of vinculin, and this protein was detected in a diffuse and faintly stained cytoplasmic pattern (Fig. 70). To determine whether the morphological changes described above reflected a depolymerization of actin, orF-actin redistribution within EC, we quantitate F-actin content. (R)PAF and OAG, but not (S)PAF, lyso-PAF, or MOG, caused a decrease of F-actin content (Table 11). Effect of Inhibition ofPKCActivation on the Effects ofPAFon Cytoskeleton-Six putative PKC inhibitors, H7 (Hidaka et al., 1984), sphingosine (Hannun et al., 1986), palmitoylcarnitine (Ganong et al., 1986), calphostin C (Kobayashi et al., 1989). 1-0-Hexadecyl-2-methyl-rac-glycerol (Salari et al., 1992) and bisindoylmaleimide (Toullec et al., 1991) were applied in the
Role of PKC
o!
and Endothelium p in
2883
FIG.7. Effect of palmitoylcarnitine on (R)PAF-inducedredistribution of F-actin and vinculin in EC. The cells grown on collagencoated glass coverslips were fixed and permeabilized as described under "Materials and Methods" and then stained withF-PHD (A, C,and E )or with monoclonal antibody-antivinculin (diluted 1:500) followed by fluorescein-tagged rabbit anti-mouse I& (B,D,and F ) . Control EC show an elaborate array of microfilament bundles of stress fibers type(A) and numerous vinculin-containing streaks(B). After 15 min of treatment with (R)PAF(100nM), EC progressively lose their network of stress fibers with the accumulationof F-actin at the peripheryof the cells, and vinculin streaks disappear0 ) . The pretreatmentof EC for 10 min a t 37 "C with palmitoylcarnitine (50 y), which does not alter the distribution of F-actin or vinculin (not shown), abolishes theeffect of (R)PAF (100 n ~ 15, min) (E and F ) .
above systems. The pretreatment of EC with 50 p palmitoylcarnitine for 10 min prevented the rearrangement of stress fibers (Fig. 7E) and the redistribution of vinculin induced by 100 n~ (R)PAF (Fig. 7F). Similarly, H7, sphingosine, and palmitoylcarnitine prevented in a dose-dependent manner the effect of (R )PAF or OAG on F-actin content (Table 111).The dosedependent effect of two highly specific inhibitors of PKC, calphostin C and 1-0-hexadecyl-2-methyl-rac-glycerol(Kobayashi et al., 1989; Salari et al.,1992), is shown in Table IV. Both inhibitors blocked the (R )PAF-induced F-actin depolymerization, and the minimal active dose was 300 TIM and 5 p, respectively. H-89 and KT5720, two inhibitors ofCAMP-dependent protein kinase (Chijiwa et al., 1990; Kase et al., 1987) were ineffective. Effect of PAF on Endothelial Cell Permeability-Addition of (R )PAF to EC monolayers resulted in concentration-dependent increases in '2sI-albumin clearance rates within 1 h, confirming our previous findings (Bussolino et al., 1987). OAG (200 p),and PMA (50 nM) increased also 12sI-albumin clearance (Fig. 8). MOG (200 p.d and PDD (50 nM), which do not activate PKC, were unable to increase '2sI-albumin clearance rates above base-line values (Fig. 8). Effect of Znhibition of PKC Activation on PAF-induced Endothelial Cell Permeability-Preincubation of EC monolayer with H7, sphingosine, calphostin C, bisindoylmaleimide, 1-0-hexa-
decyl-2-methyl-rac-glycerol, and palmitoylcarnitine before the addition of (R)PAF or OAG significantly reduced the agonistmediated increase in EC permeability (Table 111). The dosedependent effect of calphostin C and 1-0-hexadecyl-2-methylrac-glycerol is similar to that shown in blocking the (R)PAF effect on F-actin content (Table IV). DISCUSSION
Activation of PKC is associated with translocation of the enzyme from cytosolic to membrane fraction; such translocation occurs in response to agonist-stimulated diacylglycerol synthesis, and this event can be mimicked by phorbol ester and cell permeant diacylglycerol analogues. Nanomolar concentrations of (R )PAF promote partial translocation of PKC from cytosol to the membrane fraction of EC. Immunohistochemical studies performed on PAF-stimulated and fixed cells confirm the biochemical data and show that PKC localizes into the plasmamembrane. The phenomenon is specific since the enantiomer(S)PAFand lyso-PAF were inactive, and PKC activation is blocked by specific PAF receptor antagonists. The redistribution of PKC is instrumental for the cytoskeleton rearrangement and the increasein permeability to albumin caused by PAF. This conclusion is based on the following observations: (a)OAG and PMA, which activate PKC, increase
Role of PKC a and p in Endothelium TABLEI1 Effect of PKC activators and protein kinase inhibitors on F-actin content in EC EC were treated for 15 min at 37" C in medium 199-BSAwith or without indicated drugs and then stimulated for min 30 with the indicated agonists. The numbers indicated the means S.D.of four experiments done in duplicate. F-Actin content (arbitrary units)
Treatment
200 200
None 0.8 (R)PN, 50 m (S)PAF,50 m 500 ~ I M LYSO-PAF, OAG, p MOG, p H7, 10 p 0.8 H7, 10 p + (R)PAF, 50 m H7, 10 p + OAG, 200 w Palmitoylcarnitine, 50 p Palmitoylcarnitine, 50 p + (R)PAF, 50 m Palmitoylcarnitine, 50 p + OAG, 200 p Sphingosine, 20 w Sphingosine, 20 w + (R)PAF, 50 m Sphingosine, 20 p + OAG,200 p Calphostin C, 10 p Calphostin C, 10 p + (R)PAF 50 m Calphostin C, 10 w + OAG, 200 p 1-0-Hexadecyl-2-0-methyl-rac-glycerol, 30 1-0-Hexadecy1-2-0-methyl-rae-glycero1, 30 (R)PAF, 50 m l-O-Hexadecyl-2-O-methyl-rac-glycerol, 30 p + OAG, 200 p Bisindoylmaleimide, 10 p Bisindoylmaleimide, 10 p + (R)PAG, 50 m p Bisindoylmaleimide, 10 p + OAG, 200 H-89, 20 H-89,20w + (R)PAG, 50 I ~ M H-89,20p + OAG, 200 KT5720,20p KT5720,20 p + (R)PN, 50 m KT5720,20p + OAG, 200 p
+
5.1 2.8 0.6" 4.8 * 1.1 4.6 2 1.0 3.1 2 0.6" 5.5 f 0.9 5.7 4.62 1.3 5.2 2 0.7 6.0 f 1.4 5.5 f 0.9 5.0 * 1.0 4.8* 1.0 4.1 f 0.1 4.4 * 0.9 5.0 f 0.3 4.9 * 0.6 4.8f 0.2 5.3 * 0.2 4.9 * 0.3 4.6f 0.4 5.1f 0.2 5.1f 0.2 4.8 f 0.3 5.2 0.6 3.1 2 0.1" 2.8f 0.5 4.8* 0.2 3.4* 0.5" 2.90.3
" p < 0.05or lower uersus control by t test.
transendothelial albumin clearance and induce depolymerization and redistribution of F-actin and disorganization of vinculin; ( b ) the inactive analogs of OAG and PMA do not increase albumin clearance neither reduce F-actin content; ( c ) PKC inhibitors prevent the transfer of albumin across EC monolayer and the cytoskeleton rearrangement induced by PAF; and ( d ) PKC redistribution occurs prior to the increased permeability and the activities on cytoskeleton induced by PAF and at the same concentrations of mediator. Furthermore, PKC has been implicated in the increase of albumin clearance also in bovine EC (Lynch et al., 1990; Oliver,1990) and in regulation of cytoskeleton in EC (Antonov et al., 1986; Nielsen and Wood, 1989) and in othercell types (Jaken et al., 1989; Miyata et al., 1989; Apgar, 1991; Phatak et al., 1988; Burridge et al., 1988; Pardi et al., 1992). Although we have proved an important role of PKC in alteration of ECcytoskeletal structures andpermeability, we cannot exclude the role of other kinasesactivated by PAF (reviewed in Shukla (1992)) and active on proteins of the cytoskeleton (reviewed in Stossel (1989) and Stein and Bronner (1989)). The heterogeneity of the PKC gene family suggests that different isoforms may have specific physiologic role. Different levels of expression of various isoforms have been correlated with cellular growth (Persons et al., 1988) and differentiation (Makowske et al., 1988; Melloni et al., 1989; Mischak et al., 1991; Tsutsumi et al., 1993),and neuronal functions (reviewed in Huanget al., 1989a). More recently, redistribution of a specific isoformhas been matched to a specific cellular event. PKC a activation is implicated in arachidonate release from MadinDarby canine kidney cells stimulated with bradykinin (Godson
TABLE I11 Effect of PKC activators and proteinkinase inhibitors on EC permeability The EC permeability was determining by calculating the ratio of 1251-albuminin the upper and lower chamber filter of chamber assembly as described under "Materials and Methods." EC were treated for 15 min at 37" C in medium 199-BSAwith or without indicated drugsthen stimulated for 60 min with the indicated agonists added to upper chamber. Radioactivity was counted the lower chamber and the results are expressed as follows: percent change albumin clearance- (cpm 1261-albumin &r stimulus - cpm lZ5I-albumincontrokpm 1251-albumin control) x 100.The numbers indicated the means * S.D. of three experiments done in triplicate. 'lkeatment
H7, 10 w r ~ ~ H7, 10 m + (R)PAF. 50 m H7; 10 b + OAG, 200 p Palmitoylcarnitine, 50 p Palmitoylcarnitine, 50 p + (R)PAF, 50 m Palmitoylcarnitine, 50 p + OAG, 200 w Sphingosine, 20 p Sphingosine, 20 p + (R)PAF, 50 m Sphingosine, 20 p + OAG, 200 p Calphostin C, 1 w Calphostin C, 1 w + (R)PAF, 50 2 1 ~ Calphostin C, 1 p + OAG, 200 w l-O-Hexadecyl-2-O-methyl-ruc-glycerol, 30 p 1-0-Hexadecy1-2-0-methyl-rac-glycero1, 30 p + (R)PAF, 50 m l-O-Hexadecyl-2-O-methyl-rac-glycerol, 30 w + OAG, 200 p Bisindoylmaleimide, 10 p Bisindoylmaleimide, 10 p + (R)PAF, 50 m Bisindoylmaleimide, 10 p + OAG, 200 w H-89, p 20 H-89,20w + (R)PAF, 50 1 1 ~ H-89,20p + OAG, 200 1.1~ KT5720.20UM K"5720,20 b + (R)PAF, 50 m KT5720,20M
C Change
albumin clearance
52.8f 9.6 30.1 f 12.6 5.7f 0.8 24.6f 11.3 15.2* 7.7 3.0 f 1.4 15.5 f 6.9 11.0 f 5.5 9.8 2 3.5 24.1 f 10.1 10.1* 5.9 3.1 f 2.2 14.2 0.5 22.1 * 0.9 11.3* 2.2 22.2f 3.9 24.65.4 8.1 2 1.7 32.1f 3.0 23.2f 3.9 3.6* 1.1 44.3 f 2.1 52.8 f 3.9 8.8 * 2.2 53.1 * 2.4 42.1 f 1.3
et al., 1990), in the antiproliferative effect of interferon-a on et al.,1990),and in the expression of class I1 HeLa cells (Pfeffer antigens of the major histocompatibility complex in rat EC stimulated by interferon-y (Matilla, 1991);PKC a and p translocate in nuclear envelope in NIH 3T3 (Leach et al.,1989) and in HL-60 (Hocevar and Fields, 1991) cells, respectively, mediating PKC-induced changes in gene expression; and PKC e regulates the synthesis and release of prolactin from GH4C1 cells (Kileyet al.,1991).To determine the relative involvement of PKC isoforms in the activation of EC by PAF we used hydroxylapatite chromatography and isoform-specificantibodies in immunoblotting procedures. In confluent human EC only a, @, and E were present, whereas y, 6, and 4 were undetectable. These observations agree with the known tissue-specificdistribution of isoforms, the y form being almost exclusively foundin the central nervous system, the other isoforms forms being found in peripheral tissue (Ono et al., 1988; Mischak et al., 1991; Strulovici et al.,1991; Tsutsumi et al.,1993). Biochemical and immunochemical analysis revealed that, when EC were challenged with ( R)PAF, e isoform remains incytosol, whereas a and p forms translocate from cytosol to the membrane fraction, but with a different time course; p isoform was activated more quickly than a enzyme. Two principal elements can differently regulate PKCisoforms, the sequential availability of Ca2+levels and the diverse concentrations and/or molecular species of diacylglycerol and phospholipids (Jaken et al., 1989 Bell and Bums, 1991; Asaoaka et al., 1992). During PAF activation, the changes concerning these cofactors of PKC may explain the differenttime
Role of PKC a and p in Endothelium TABLEIV Dose-dependente#& of calphostin C and l-O-HeradeeyE-2-O-methyE-rac-glycerol on (R)PAF-induced changes in F-actin and EC permeability EC were treated for 15 min at 37O C in medium 199-BSA with or without the indicated concentrations of calphostin C and 1-0-hexadecyl-2-0-methyl-rac-glycerol. Content of F-actin and changes in permeability were evaluated a h r 30 and 60 min of (R)PAF-stimulation, respectively, as detailed in Tables I1 and 111. Means * S.D. of four determinations on one experiment out of two. F-actin (arbitrary
Treatment
units)
None (R)PAF', 50 m (R)PW, 50 m + calphostin C, 10 m (R)PAF', 50 xm + calphostin C, 100 I" (R)PM, 50 xm + calphostin C, 3.7 300 I" (R)PAF, 50 rn + calphostin C, 4.1 500 m (R)PAF,50 m + calphostin C, 1 p (R)PAF, 50 m + 1-0-Hexadecyl-20-methyl-rac-glycerol,50 xm (R)PAF, 50m + l-O-hexadecyl-20-methyl-rac-glycerol, 500 I" (R)PAF, 50 m + l-O-hexadecyl-20-methyl-rac-glycerol, 5 p~ (R)PM, 50 m + l-O-hexadecyl-23.8 0-methyl-rac-glycerol, 10 p (R)PM, 50 m + l-O-hexadecyl-20-methyl-rac-glycerol,30 p
46 Change
albumin clearance
5.1 f 0.8 2.3 2 0.5 2.3 f 0.7 59.1
6.7 f 2.5 55.2 f 8.9 f 10.4
2.7 + 0.3
53.5 f 6.7
= 0.6" f
0.5"
4.4 f 0.P 2.5 f 0.6
41.3 * 6.2" 27.8 f 6.7' 21.4 f 8.1" 54.0 f 10.3
2.6 2 0.8 Not
tested
3.0 f 0.1" 39.2
f 4.7"
* 0.3"34.3
f 5.9"
0.4-
4.0
26 * 9.1"
2885
the different rate of distribution of isoforms two in EC. Recently, it hasbeen shown that PKC a and PKC f? differ in their sensitivity to proteolytic cleavage by the Ca2+-dependentproteases andby calpains I and I1 (Huang et al.,1989b,Pontremoli et al. 1990), suggesting that the level of cytosolic Ca2+elicited by PAF may be critical in the down-regulation of a specific isoform. A second aspect i s to understand the connection between the redistribution of a and f? isoforms induced by PAF and the reorganization of cytoskeletal structures leading to the increased permeability to macromolecules. Several reports suggest the interaction of PKC with the cytoskeleton. Many cytoskeletal proteins are in vitro good substrates for PKC. These include vinculin (Werth and Pastan,19841, laninin (Kawamoto and Hidaka, 19841, intermediate filaments (Inagaki et al., 1988), and the myristoylated, alanine-rich C kinase substrate, an actin cross-linking protein the activity of which is inhibited by PKC-mediated phosphorylation (Hartwig et al.,1992). More recently Jaken et al. (1989) showed that a subset ofPKC a colocalizes with vinculin and talin in focal contacts between cells and matrix. We speculate that translocation of PKC a should be relevant in the effect of PAF on vinculin redistribution, but future work will have to concentrate on such aspects of EC activation by PAF. Acknowledgments-We thank Dr.M.Makowske for providing the antibodies anti-PKC a, p, and y , Dr. K. P. Huang for an aliquot of anti-rat PKC antibody, and Dr. G. Osterman for (S)PAF,and Genetics Institute for cDNA of PKCisozymes.
p < 0.05 or lower uersus (R)PAF-stimulated cells by t test.
REFERENCES Asaoaka, Y.,Nakamura, S.,Yoshida, K., and Nishizuka, Y. (1992) Zknda Biochem. Sci. 17, 414-417 Antonov, A. S., Lukashev, M. E., Romanov, Y.A,, Tkachuk, V. A,, Repin, V. S.,and Smirnov, V. N. (1986) Proc. Natl. Acad. Sci. U.S. A. 83,9704-9708 Apgar, J. R. (1991) J. Cell Biol. 112,1157-1163 Bell, R. M., and Burns, D. J. (1991) J. Biol. Chern. 266, 46614664 Bratton, D.L., Dreyre, E., Kailey, D. M., Fadok, V. F., Clay, K L., and Henson, P. M. (1992) J. Immunol. 148,514-523 Bmck, T. A,, and Gimbmne, M. A (1986)Am. J . Physiol. 260, H1086-H1092 Burridge, K. Fath, K, Kelly, T., Nuckolls, T., and Turner, C. (1988)Annu.Reo. Cell Biol. 4, 487-582 Bussolino, F., Aglietta, M., Sanavio, F., Stacchini, A., Lauri, D., and Camussi, G . (1985) J. Immunol. 136,274&2753 Bussolino, F., Camuasi. G., Aglietta, M., Braquet, P., Bosia, A,, Peecarmona, G.. Sanavio, F., D'Urso, N., andMarchisio, P.C.(1987) J. Immunol. 139,2439-2446 Bussolino, F., Camussi, G., and Baglioni, C. (1988) J. Biol. Chem.283,11856-
1
2 3 4
5 6 7
11861
0
0
20
40
60
80
YO alkmin clearance FIG. 8. Effect oiPKC activatorm on EC monolayer permeability to l~I-albumin. Confluent EC were stimulated for 1 h a t 37 "C in 2 ml of medium 199 containing 200 p bovine serum albumin and 0.1 pCi of lZ6I-albumin,and permeability was determined by calculating the ratio of lZ6I-albuminin the upper and lower chamber of a filter chamber assembly. Percent albumin clearance = (cpm lZ6I-albuminaRer stimulus - cpm 1261-albumincontroYcpm lZ6I-albumincontrol) x 100. 1, control; 2, 1m (R)PAF;3,10 I" (R)PAF;4,50 m (R)PAF;5,50 rn PMA, 6,50 m PDD, 7,200 p OAG; 8,200 p MOG. Results are the mean values + S.D. of three experiments done in duplicate.
Camussi, G., Aglietta, M., Malavasi, F., Tetta, C., Sanavio, F., Piacibello, W.,and Bussolino, F. (1983) J . Immunol. 131,2397-2403 Castagna, M., Takai, Y.,Kaibuchi, K,. Sano, K, Kikkawa, U., and Nishizuka, Y. (1982) J. Biol. Chem. 257, 7847-7851 Chijiwa, T.,Mishima, A,, Hagiwara, M., Sano, M., Hayashi, K, Inoue, I., Naito, K , Toshioka, T., and Hidaka, H. (1990) J. Biol. Chem. 266,52674272 Chirgwin, J. M., h y b y l a , A E., MacDonald,R. J., and Rutter, W. J. (1979) Biochemistry 18,5294-5299 Coussens, L., Parker, P. A., Rhee, L.. Yang-Feng, T. L., Chen, E., Waterfield, M. D., Franke, U., and Ullrich, A. (1986) Science 239,859466 D'Humiers, S.,Russo-Marie, F., and VargaRig, B. B. (1986) Euz J . Phnrmacol. 131, 13-19
Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 Freire-Moar, J., Cheminski, H., Hwang, F., Ransom, J., and Webb, D. (1991. J. Immunol. 147,40&411 Ganong, B. R., Loomis, C. R., Hannun, Y. A., and Bell, R. M. (1986) Proc. Natl. Acad Sei. U.S.A. 83,1184-1188 Godson, C., Weiss. B. A., and Insel, P. A. (1990) J. Biol. Chem. 246, 8369-8372 Gordon, J. (1991) Vascular Endothelium: Interactions with Circulating Cells, Elsevier Scientific Pub]. B. V., Amsterdam Grigorian, G . Y.,and Ryan, U. S. (1987) Cire. Res. 61,389495 Handley, D. A., Arbeeny, C. M., Lee, M. L., van Valen, R. G., and Saunders, R. N. (1984) Immunophnrmacology 8,137-144 Hannun,Y. A., Loomis, C. R.,Mem1,A. H., Jr., andBell, R.M. (1986) J. Biol. Chem.
course of translocation of a and p isoforms. Along this line, PAI? induces hydrolysis of phosphatidylinositol (reviewed in Shukla (1992))and phosphatidylcholine (Uhing et al.,1989),known to 261, 12604-12609 generate different types of diacylglycerols(reviewedin Bell and Hartwig, J. H., Thelen, M., Rosen, A, Janmey, P. A, Nairn, A. C., and Aderem, A. Bums (1991)). Furthermore, PAF can induce plasma mem(1992) Nature 366,618422 brane physical changes (i.e. enhancement of transbilayer move- Heller, R., Bussolino, F., Ghigo, D., Garbarino, G., Peacarmona, G.. Till, U., and Bosia, A. (1992) J. Immunol. 149, 3682-3688 ments) (Brattonet al., 19921, thus interfering inthe association Hidaka, H., Inagaki, M.. Kawamoto, S., and Sasaki, Y. (1984) Biochemistry 23, 5036-5041 of PKC isozymes to the membrane. Also the different mechaB. A, and Fields, A. P. (1991) J. Biol. Chem. 266,2843 nisms and kinetics of down-regulation of PKC a and PKC f?, Hocevar, Honda, Z.. Nakamura, M., Miki, I., Minami, M., Watanabe, T..Seyama, Y., Okado, which lead to the termination of the signal, may be critical for H., Toh, H., Ito, K, Myamotn, T., and Shimizu, T. (1991) Nature 34s. 342346
Role of PKC a and Endothelium p in
2886
Huang. K P., Nakabayashi, H., and Huang, F.L. (1986)Proc. Natl. Acad. Sci U. S. A. 89.8535-8539 Huang, K P., Huang, F. L., Nakabayashi, H., and Yoshida, Y. (1989a)Adu. E m . Med. Biol. 26421-28 Huang, F. L., Yoshida, Y., Cunha-Melo, J. R., Beaven, M. A,, and Huang, K. P. (1989b)J. Biol. Chem. 264,4238-4243 Inagaki, M., Gonda, Y., Matauyama, M., Nishizawa, K., Nishi, Y.,and Sata, C. (1988)J. Biol. Chem. 263,59704978 Jaken, S., Leach, K, and Klauck, T. (1989)J. Cell Biol. 109, 697-704 Kase, H., Iwahashi, K, Nakanishi, S., Matsuda, K , Yamada, K, Takahashi, M., Murakata, U., Sato, A,, and Kaneko, M. (1987)Biochern. Biophys. Res. Commun. 142,436440, Kawamoto, S., and Hidaka, H. (1984)Biochem. Biophys. Res. Commun. 118,736 742 Kikkawa, U., Minakuchi, R., Takai, Y., and Nishizuka, Y.(1982)Methods Enzymol. 99.288-298 Kiley, S . C., Parker, P. J., Fabbro, D., and Jaken, S . (1991)J. Biol. Chem. 266, 23761-23768 Knopf, J. L.,Lee, M.,Sultzman, L. A,, Kriz, R. W., h m i s , C. R., Hewich, R. M.,and Bell, R. M. (1986)Cell 46, 491-502 Kobayashi, E., Nakano, H., Morimoto, M. N., and Tamaoki, T (1989)Biochim. Biophys. Res. Commun. 169,4843 Koide, H., Ogita, K., Kikkawa, U., and Nishizuka, Y. (1992)Proc. Natl. Acad. Sci. U. S . A. 89, 1149-1153 Kuijpers, T.W.,Hakkert, B. C.,Hart, M. H. L., and Rooe, D. (1992)J. Cell Biol. 117, 565-572 Lacasse C., and Rola-Pleszczynski, M. (1990)J. Leukocyte Biol. 49, 245-252 Laemmli, U. K. (1970)Nature 227, 680-685 Leach, K L.,Powers, E. A,, Ruff,V.A,, Jaken, S., and Kaufmann, S . (1989)J. Cell Bwl. 108,685-695 Lerner, R., Lindstrom, P., and Palmblad, J. (1988)Biochem. Biophys. Res. Commun. 153,8054310 Lorant, D. E.,Patel, K D., McIntyre, T. M., McEvert, R. P., Prescott, S . M., and Zimmerman, G . A. (1991)J. Cell Biol. 116,223-234 Lynch, J. J., Ferro, T.J., Blumenstock, F. A,, Broekenauer, A. M., and Malik, A, B. (1990)J. Clin. Inuest. 1991-1998 Makowske, M., Ballester, R., Cayre, Y.,and Rosen, 0.M.(1988)J. Biol. Chem. 263, 34024410 Maniatis, T.,Fritsch, E. F., and Sambrook, J. (1982)Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Mantovani, A,, Bussolino, F., and Dejana, E. (1992)FMEB J. 6,2591-2599 Matilla, P. (1991)FEBS Lett. 289,8&90 McIntyre, T.M., Zimmerman, G . A,, Setoh, K, and Prescott, S . M. (1985)J. Clin. Invest. 76,271-280 Melloni, E., Pontremoli, S., Vlotti, P. L., Patrone, M., Marks, P. A,, and Riflrind, R. A. (1989)J. Biol. Chem. 264, 18414-18418 Mischak. H., Kolch, W., Goodnight, J., Davidson, W.F., Rapp, U., RoseJohn, S., and Mushinski, J. F. (1991)J. Immunol. 147.39814987 Miyata, Y.,Nishida, E., Koyasu, S., Yahara, I., and Sakai,H. (1989)J. Biol. Chem. 264,15565-15568 Nieleen. T. B., and Woo, D. K (1989)T I s s w & Cell 21, 813-823 Nishizuka, Y.(1986)Science 2S3,305-312 Nishizuka, Y.(1988)Nature 334,661-665 Ogita, K., Miyamoto, S., Yamaguchi, K , Koide,H., Fujisawa, N., Kikkawa, U.,
86.
Sahara, S., Fukami, Y., and Nishizuka, Y.(1992)Proc. Natl. Acad. Sci.
U.S. A
89. 1592-1596
Ohno, S., Kawasaki, H., Imajoh, S., Suzuki,I C , Inagaki, M., Yokokura, H., Sakoh, T., and Hidaka, H. (1987)Nature 326, 161-167 Ohno, S., Akita,Y., Konno, Y.,Imajoh S., and Suzuki, K (1988)Cell 69,731-741 Oliver, J. A. (1990)J. Cell. Physiol. 146, 536-542 Ono, Y., Kurokawa, T., Kawahara, IC, Nishimura, O., Marumoto, O., Igarashi, K, Kikkawa, U., and Nishizuka, Y.(1986)FEBS Lett. 203, 111-115 Ono, Y., Fujii, T., Ogita,K., Kikkawa, U., Igarashi, IC, and Nishizuka, Y.(1988)J. Biol. Chem. 263,6927-6932 Ono, Y.,Fqjii, T., Ogita, K, Kikkawa, U., Igarashi, K , and Nishizuka, Y. (1989) Proc. Natl. Acad. Sci. U. S. A 86,30993103 Pardi, R., Inverardi, L., Rugarli, C., and Bender, J. R. (1992)J. Cell Biol. 116, 1211-1220 Parker, P. A., Coussens, L., lbtty, N., Rhee, L.,Young, S., Chen, E., Stabel, S., Waterfield, M. D., and Ullrich, A. (1986)Science 233,853459 Persons, D.A., Wilkinson, W. O., Bell,R.M., and Finn, 0.J. (1988)Cell 62. 447-458 Pfeffer, L. M., Strulovici, B., and Saltiel, A. R. (1990)Proc. Natl. Acad. Sci U. S. A 87,65374541 Phatak, P. D., Packman, C.H., and Lichtman, M.L. (1988)J. Immunol. 141, 292S2934 ~. Pontremoli, S., Melloni, E., Sparatore, B.. Michetti, M., Salamino, F., and Horecker. B.L. (1990)J. Biol. Chem. 266.706712 Prescott, S . M., Zimmerman, G. A:, and McIntyre, T.M. (1984)Proc. Natl. A c a d . Sci. U. S. A 81, 3934-3938 Preseott, S . M., Zimmerman, G . A., and McIntyre, T. M. (1990)J. Biol. Chem. 266. 17381-17384 Renkonen, R.. Mattila, P., and Ustinov, J. (1990)S c a d . J. Immunol. 31,523-527 Rotrosen, D., and Gallin, J. I. (1986)J. Cell Biol. 103, 2379-2386 Ryan, U. S., Grigorian, G . Y., Avdonin, P. V., and Bregestovski. P. (1988)in New D e & in Lipid Mediators Research, Platelet Activating Factor and Cell ImmunoZogy (Braquet, P., ed) pp. 144-158, Karger, Baael Salari, H., Dryden, P., Devenport, R., Howard, S., Jones, K, and Bittman, R. (1992) Bimhim. Biophys. Acta 1134,81438 Shukla, S . D. (1992)FASEB J. 6,2296-2301 Stein, W. D., and Bronner, F. (1989)Cell Shape: Determinants, Regulation and Regulatory Role, Academic Press, San Diego Stossel, T. P. (1989)J. Biol. Chem. 264, 18261-18264 Strulovici, B., Daniel-Issakani, S., Baxter, G., Knopf, J.,Sultzman, L., Chenvineki, H., Nestor, Jr. J., Webb,D. R., and Ranson, J. (1991)J. Biol. Chem. 266, 16~73 lbullec, D., Pianetti, P., Coste, B., Bellevergue, P., Grand-Perret, T.,qjakane, M., Baudet, V.,Boursier, E., Loriolle, E , Boissin, P., Duhamed, D., Chamn, D., and Kirilovsky, J. (1991)J. Biol. Chem 266, 15771-157781 Towbin, H., Staehelin, T., and Gorden, J. (1979)Proc. Natl. Acad. Sci U. S . A 76, 435cL-4354 Tsutaumi, A., Kubo, M., Fuji, H., Freire-Moar, J., Turck, C. W., and Ransom, J. T. (1993)J. Immunol. 160, 174&1754 Uhing, R. J., Prpic, V., Hollenbach, P. W.,and Adams, D. 0.(1989)J. Biol. Chem 264,9224-9230 Werth, D. K., and Pastan, I. (1984)J. Biol. Chem. 269,5264-5270 Zimmerman, G. A., McIntyre, T. M., Mehra, M., and Prescott, S . M. (19901J. Cell Biol. 110, 529-540 ~
~~~
~
~
