©2013 Poultry Science Association, Inc.
Identification and characterization of Yersinia enterocolitica isolated from raw chicken meat based on molecular and biological techniques H. Momtaz,*1 M. Davood Rahimian,† and F. Safarpoor Dehkordi† *Department of Microbiology, and †Young Researcher’s Club, College of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, PO Box 166, Shahrekord, Iran Primary Audience: Researchers, Veterinarians SUMMARY A PCR-based assay was developed to detect the occurrence of Yersinia enterocolitica in Iranian chicken meat samples and to evaluate plasmid- and chromosome-borne virulence genes. This feasible and informative method was able to provide a rapid and reliable characterization of field isolates. A total of 720 chicken meat samples were collected randomly from abattoirs in western Iran and tested by culturing and PCR methods. Of these, 132 (18.33%) were found to be positive for Y. enterocolitica by both methods. Isolates included biotypes 1A (0%), 1B (0%), 2 (18.18%), 3 (52.27%), 4 (17.42%), and 5 (12.12%), and serotypes included O:3 (36.84%), O:5,27 (59.84%), O:8 (5.30%), and O:9 (0%). Of the 46 Y. enterocolitica serotype O:3 isolates, the prevalence of virulence genes included yadA (82.60%), inv (100%), ail (95.65%), ystA (93.47%), and virF (58.69%). This study highlighted the importance of chicken meat as potential sources of Y. enterocolitica infection in Iran. Key words: biotyping, chicken meat, polymerase chain reaction, serotyping, virulence gene, Yersinia enterocolitica 2013 J. Appl. Poult. Res. 22:137–145 http://dx.doi.org/10.3382/japr.2012-00549
DESCRIPTION OF PROBLEM Foodborne diseases are a widespread and growing public health concern in developed and developing countries [1]. Yersinia enterocolitica is a gram-negative bacterium belonging to the genus Yersinia, family Enterobacteriaceae. Of the 12 species that comprise the genus, 3 are important in human pathogenicity, namely, Yersinia pestis, Yersinia pseudotuberculosis, and Y. enterocolitica. Yersinia pestis is the causative agent of the bubonic plague, whereas Y. pseudotuberculosis and Y. enterocolitica are 1
Corresponding author:
[email protected]
intestinal pathogens. Yersinia enterocolitica are widely distributed throughout the environment and have been isolated from raw milk, sewagecontaminated water, soil, seafood, humans, and many warm-blooded animals, such as poultry and, most important, pigs. The serotypes O:3, O:5,27, O:8, and O:9 are the most frequent causative agents of human illness [2]. A high prevalence of gastrointestinal illness, including fatal cases attributable to yersiniosis, is also observed in many developing countries, including Bangladesh [3], Iraq [4], Iran [5], and Nigeria [6], indicating major underlying food
138 safety problems in low- and middle-income countries. Worldwide, Y. enterocolitica infection occurs most often in infants and young children, with common symptoms such as fever, abdominal pain, and diarrhea, which is often bloody. Older children and young adults are not risk free. Occasionally, Y. enterocolitica-associated complications, such as skin rash, joint pains, or septicemia, can also occur [7]. The identification and further subspecies typing aimed at recognition of pathogenic Yersinia spp. are traditionally based on phenotypic tests. Yersinia enterocolitica can be classified into biotype 1A, generally regarded as nonpathogenic [8], and the pathogenic biotypes 1B, 2, 3, 4, and 5. Yersinia pseudotuberculosis and Y. enterocolitica can also be divided into serotypes with predictive values for pathogenicity. Serological and biochemical classifications, however, are time consuming and not generally available in routine laboratories. Alternative phenotypical tests, including calcium-dependent growth at 37°C [9], Congo red binding [10], pyrazinamidase testing [11], autoagglutination testing, and serum resistance testing [12–17], have limited predictive value for Y. enterocolitica pathogenicity. Test results are frequently ambiguous and their outcomes may be unreliable because they depend on the presence and expression of (plasmid-borne) virulence genes and the virulence plasmid pYV can easily be lost, depending on the culture conditions [10]. Therefore, pathogenic strain differentiation should not rely solely on the expression or detection of the virulence plasmid, but also on the detection of chromosomal virulence factors [10]. The detection of pathogenic Yersinia from these sources and laboratory diagnoses of Y. enterocolitica infections are based mainly on the isolation of bacteria from food and clinical specimens. Nevertheless, these methods, which require time-consuming enrichments and isolation procedures to distinguish pathogenic from nonpathogenic Yersinia, were shown to depend on the presence of the virulence plasmid, which can be lost during bacteriological isolation and enrichment procedures [18]. Rapid methods for the detection of pathogenic Yersinia species by PCR techniques have been reported previously [19, 20]. In other studies, the PCR method was developed to detect both Y. pseudotuberculosis
JAPR: Field Report and pathogenic Y. enterocolitica and to differentiate between these 2 species [18, 21]. The importance of poultry meat as a vehicle for the transmission of various diseases has been well documented, especially in countries where standards of hygiene are not strictly enforced. Chicken meat is a specific food category with respect to yersiniosis risk assessment. Currently, information is limited regarding the prevalence of Yersinia spp. in foods in Iran. Therefore, the present study was undertaken to determine the prevalence rate and serotyping of Y. enterocolitica in chicken meat in Shahrekord and Isfahan townships, Iran, by using culturing methods and PCR analysis to describe the distribution of Y. enterocolitica serotype O:3 virulence factors.
MATERIALS AND METHODS Sample Collection and Identification of Y. enterocolitica Biotypes In this study, which was conducted from December 2010 to September 2011, a total of 720 fresh raw chicken meat samples were randomly collected from 543 chicken shops in the cities of Isfahan and Shahrekord. All the chickens from which meat samples were taken at the Shahrekord and Isfahan abattoirs (located in the western part of Iran) were healthy. Separate 10-g breast muscle samples were collected using sterile scissors and tissue forceps and were put into a bag containing 90 mL of Peptone Sorbitol Bile broth (prepared in the laboratory as described in ISO method 10273:2003 [22]). The samples were transferred to the Food Microbiology Laboratory, Islamic Azad University–Shahrekord Branch, Shahrekord, Iran, in a portable insulated cooler. Samples were cultured on the day they were collected. After stomaching, 10 μL was streaked directly onto Y. enterocolitica chromogenic agar (YECA) [23] and cefsulodin-irgasan-novobiocin (CIN) plates [24], and 1 mL was transferred into 9 mL of irgasan-ticarcillin-potassium chlorate (ITC) broth [25]. The peptone sorbitol bile broth and ITC were incubated at 25°C for 48 h before a second streaking onto YECA and CIN. In addition, after 24 h of enrichment in ITC broth, an extra streaking on YECA and CIN was performed. All the plates were incubated at 30°C for 24 h.
Momtaz et al.: YERSINIA ENTEROCOLITICA IN RAW CHICKEN The presence of typical colonies on CIN (small and smooth, with a red center and translucent rim) and on YECA (small and fuchsia red) were checked. At least 2 typical colonies per plate were streaked onto Y. enterocolitica chromogenic medium [26], and these plates were incubated at 30°C for 24 h. This step on Y. enterocolitica chromogenic medium permitted rapid differentiation of the pathogenic Y. enterocolitica (red bull’s-eye-like colonies) from the nonpathogenic Y. enterocolitica (blue-purple colonies) [27]. Confirmation and biotyping of Y. enterocolitica were then done by biochemical assays. For this reason, the colonies were collected and put through several common tests, including oxidase and urease production, deamination of tryptophan, the behavior in Kligler agar, glucose fermentation, hydrogen sulfide production, gas formation from glucose, and lactose fermentation. The colonies that were urease and glucose positive, capable of the deamination of tryptophan and of lactose fermentation, oxidase negative, and did not produce hydrogen sulfide and gas from glucose were selected for further testing. Biochemical confirmation of the presence of lysine, ornithine, sucrose, rhamnose, and citrate was carried out, and the positive colonies underwent further testing for pathogens using salicin [26], esculin [26], and pyrazinamidase [26]. These individual biochemical tests allowed the samples to be divided into various biotypes [8]. Table 1 shows the reactions of the individual biotypes to various tests.
139
achieved using a Genomic DNA Purification Kit [29] according to the manufacturer’s instructions. The multiplex PCR method, using the following pair of specific primers, was used for the identification of specific pathogens in culture: primer A1 (5′-TTAATGTGTACGCTGGGAGTG-3′) and primer A2 (5′-GGAGTATTCATATGAAGCGTC-3′). On the basis of this sequence, a PCR product of 425 bp was expected. To specifically amplify the Y. enterocolitica 16S ribosomal RNA gene, a second set of primers, Y1 (5′-AATACCGCATAACGTCTTCG-3′) and Y2 (5′-CTTCTTCTGCGAGTAACGTC-3′), was used, resulting in a PCR product of 330 bp [30]. The PCR using primers rfbC1 5′-CGCATCTGGGACACTAATTCG-3′ and rfbC2 5′-CCACGAATTCCATCAAAACCACC-3′ [18] was used specifically for detection of the Y. enterocolitica serotype O:3. Polymerase chain reaction were performed in a total volume of 25 µL, including 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 200 µM each deoxynucleotide 5′-triphosphate [29], 25 pmol of each primer, 1.5 U of Taq DNA polymerase [29], and 3 µL (40 to 260 ng/µL) of DNA. Amplification reactions were carried out using a DNA thermocycler [31] as follows: heat denaturation at 94°C for 5 min, followed by 36 cycles of heat denaturation at 94°C for 45 s, primer annealing at 62°C for 45 s, and DNA extension at 72°C for 45 s. After the last cycle, the samples were kept at 72°C for 7 min to complete the synthesis of all strands [2].
Serotyping Selected strains with typical characters were serotyped using the commercial antisera O:3, O:5, O:8, and O:9 [28]. The individual colonies were isolated and suspended in physiological solution. A drop of antiserum specific to the individual pathogenic serotype O:3, O:5,27, O:8, or O:9 was then added to the suspensions. PCR Identification of Y. enterocolitica The bacterial strains biochemically identified as Y. enterocolitica and cultivated on CIN medium were tested using the PCR method. Purification of DNA from bacterial colonies was
Table 1. Biochemical tests used for biotyping Yersinia enterocolitica Test
1A
Salicin (acid production in 24 h) + Esculin (24 h) +/− Xyloza (acid production) + Trehaloza (acid production) + Indol production + Ornithine decarboxylase + Inositol (acid production) + Sorbose (acid production) + Pyrazinamidase + Lipase activity + 1
v = variable.
1B 2 − − + + + + + + − +
− − + + v + + + − −
3
4
5
− − + + − + + + − −
− − − − − v1 + − − − + + + + + − − − − −
JAPR: Field Report
140 Table 2. Primers used for detection of the various genes of Yersinia enterocolitica
Amplicon length, bp
Gene
Primer name
Primer sequence, 5′–3′
yadA
yadA1 yadA2 YC1 YC2 Ail1 Ail2 Pr2a Pr2c VirF1 VirF2
CTTCAGATACTGGTGTCGCTGT ATGCCTGACTAGAGCGATATCC CTGTGGGGAGAGTGGGGAAGTTTGG GAACTGCTTGAATCCCTGAAAACCG ACTCGATGATAACTGGGGAG CCCCCAGTAATCCATAAAGG AATGCTGTCTTCATTTGGAGCA ATCCCAATCACTACTGACTTC TCATGGCAGAACAGCAGTCAG ACTCATCTTACCATTAAGAAG
inv ail ystA virF
Primers specific to the ail, ystA, yadA, virF and inv genes of Y. enterocolitica serotype O:3 are listed in Table 2. Multiplex PCR reactions were performed in 50-µL volumes containing 5 µL of DNA template, 0.2 mM concentrations of deoxynucleoside triphosphates, 5 µL of 10× PCR buffer, 3 mM MgCl2, 1 µM concentrations of each forward and reverse primer, 1.25 U of Taq DNA polymerase [29], and 2% Tween 20. The thermal cycling conditions were as follows: 1 cycle of denaturation at 95°C for 10 min; 25 cycles of melting at 95°C for 45 s, annealing at 60°C for 60 s, elongation at 72°C for 70 s; and a final extension at 72°C for 10 min. Amplified samples were analyzed by electrophoresis (120 V, 208 mA) in 1.5% agarose gel and stained by ethidium bromide. A molecular weight marker with 100-bp increments (100-bp ladder) [29] was used as the size standard.
RESULTS AND DISCUSSION Biochemical and PCR results showed that 132 Y. enterocolitica strains (18.33%) were isolated (representative of 132 different colony morphologies) out of 720 samples. The highest occurrence belonged to the Y. enterocolitica O:5,27 serotype, although strains O:3 and O:8 were also detected. However, serotype O:9 was not found. Additionally, biotype 3 was detected in samples the most often, occurring in up to 52.27% of samples. The second most frequent biotype of the chicken strain Y. enterocolitica 2 also occurred frequently (18.18%). However, biotypes 1A and 1B were not detected in the poultry strain Y. enterocolitica (Table 3).
Reference
849
[10]
570
[49]
170
[21]
145
[50]
590
[20]
The most common serotype or biotype found in the samples was O:5,27/2, which occurred in 42 out of 132 samples (31.8%). Other common strains included O:3/4 and O:5,27/3, with occurrences of 36 (27.3%) and 17 (12.9%), respectively, out of 132 samples (Table 4). For gene detection, ail, yadA, inv, ystA, and virF were PCR-amplified, and the individual amplified fragments were subjected to agarose gel electrophoresis (Figure 1). Table 5 shows the occurrence of virulence genes (ail, yadA, inv, ystA, virF) in isolates of Y. enterocolitica O:3 strains. In the current study, the ystA gene was found in 93.47% of isolates. The genes yadA and virF were identified in 82.60 and 58.69% of Y. enterocolitica O:3 isolates, respectively. The ail gene was found in 95.65% of isolates, and the inv gene was identified in all the strains. Yersinia enterocolitica is a common gramnegative foodborne enteric pathogen found in water, dairy products, and meats. It is one of the most common causes of foodborne gastro-
Table 3. Prevalence of Yersinia enterocolitica biotypes and serotypes isolated from chicken meat1 Item Biotype 1A 1B 2 3 4 5 1
n = 132 isolates.
Positive samples, no. (%) — — 24 (18.18) 69 (52.27) 23 (17.42) 16 (12.12)
Momtaz et al.: YERSINIA ENTEROCOLITICA IN RAW CHICKEN
141
Table 4. Prevalence of Yersinia enterocolitica serotypes/biotypes isolated from chicken meat1
Table 5. Prevalence of Yersinia enterocolitica serotype O:3 virulence genes isolated from chicken meat1
Serotype/ biotype
Positive serotype/ biotype, no.
Gene
O:3/2 O:3/3 O:3/4 O:3/5 O:5,27/2 O:5,27/3 O:5,27/4 O:5,27/5 O:8/2 O:8/3 O:8/4 O:8/5
3/4 3/34 36/14 4/4 42/16 17/24 12/4 8/2 3/4 2/11 2/5 —/10
1
n = 132 isolates.
enteritis in Western and Northern Europe. The incidence is also increasing in the United States and Canada, although this may be a result of improved surveillance and detection methods [32, 33]. Foodborne outbreaks have been asso-
yadA inv ail ystA virF
Positive samples, no. (%) 38 (82.60) 46 (100) 44 (95.65) 43 (93.47) 27 (58.69)
1
n = 46 isolates.
ciated with virtually all pathogenic serovars, but serovar O:8 has characteristically been associated with more catastrophic human infections, whereas O:3 and O:9 have been linked to milder cases [8, 32]. It seems that this present study is the first prevalence report of direct detection and identification of Y. enterocolitica in poultry meat in the west of Iran. Our results revealed that the contaminated raw chicken meat is one of the main sources of human infection caused by Y. enterocolitica.
Figure 1. Agarose gel electrophoresis of PCR products amplified with a multiplex PCR method for the ail (170 bp), yadA (849 bp), inv (570 bp), ystA (145 bp), and virF (590 bp) genes from Yersinia enterocolitica serotype O:3. M = 100-bp DNA ladder [29].
142 The aim of the present study was to evaluate the occurrence and antimicrobial resistance of Y. enterocolitica and to identify and characterize chromosomal and plasmid-encoded virulence genes. The recent development of sensitive, specific PCR assays for the detection of Yersinia organisms has greatly improved the ability to study this organism in fresh and fixed samples. Because Y. enterocolitica is a common foodborne pathogen and is implicated in such a wide range of gastrointestinal diseases, the development of a PCR assay that could be used to assign Y. enterocolitica-positive specimens to a particular biogroup has significant implications for clinical diagnosis, microbiological research, and epidemiological studies [34–36]. In the present study, both molecular and cultural methods were used to characterize Y. enterocolitica isolates in chicken meat. Results showed that 132 of the 720 (18.3%) chicken meat samples studied were found to be infected with Y. enterocolitica. Out of 132 samples positive for Y. enterocolitica, the most prevalent biotypes were 1A (0%), 1B (0%), 2 (18.18%), 3 (52.27%), 4 (17.42%), and 5 (12.12%), and the most prevalent serotypes were O:3 (34.84%), O:5,27 (59.84%), O:8 (5.30%), and O:9 (0%). Multiplex PCR assay results showed that the chromosomal virulence genes included inv (100%), ail (95.65%), and ystA (93.47%), and the plasmid-encoded virulence factors included yadA (82.60%) and virF (58.69%) out of the total of 46 Y. enterocolitica serotype O:3 strains. The results of our study are the same as those of other studies [37] and showed that of the 6 biotypes and 50 serotypes of Y. enterocolitica isolated, the incidences of Y. enterocolitica serotype O:5,27 and biotype 3 were the highest in chicken meat. However, the results of other studies showed that biotype 1A was the most heterogeneous and encompassed a wide range of serotypes, and the serotypes O:5, O:6,30, O:6,31, O:7,8, and O:10, as well as O-nontypable strains, were isolated the most often. Another study [38] showed that the pig is the major reservoir of pathogenic Y. enterocolitica of bioserotype 4/O:3, the most common type found in humans; however, our study revealed that O:5,27/2 was the most frequent serobiotype of Y. enterocolitica isolated from chicken meat
JAPR: Field Report samples. Therefore, our study showed that the O:5,27/2 serobiotype of Y. enterocolitica caused the most human infections through consumption of contaminated chicken meat. Our results indicated that ystA, with an incidence of 93.47%, was one of the most prevalent virulence genes of Y. enterocolitica that was isolated from chicken meat samples. However, in previous studies, pathogenic yst-positive Y. enterocolitica strains were isolated from ground beef [39] but were not detected in chicken samples [40], which was inconsistent with our results. In addition to chicken meat, chicken eggshell surfaces are a source of Y. enterocolitica [41]. A study conducted in Argentina [42] showed that 38.65% of meat samples were contaminated with Y. enterocolitica, which was higher than our results (18.33%). All Y. enterocolitica 2/O:9 strains gave results related to virulence by phenotypic tests and exhibited the genotype virF+myfA+ail+ystA+, whereas biotype 1A strains showed the genotype virF−myfA− ail+ystA+ystB+. Another study [43] showed that the positive rates of virulence genes tested in 160 Y. enterocolitica isolates were inv (100%), ail (94%), ystA (93%), ystB (7.5%), ystC (5%), yadA (89%), and virF(82%) in patients with diarrhea. In an Indian study [44], 81 strains of Y. enterocolitica biovar 1A were isolated from diarrheic human stools (51 strains), wastewater (18 strains), pig throats (7 strains), and pork (5 strains). Virulence-associated genes, including ail, virF, inv, myfA, ystA, ystB, ystC, tccC, hreP, fepA, fepD, fes, ymoA, and sat, were detected by PCR amplification in 81 clinical and nonclinical strains of Y. enterocolitica biovar 1A. All strains lacked ail, virF, ystA, and ystC genes. The distribution of other genes with respect to clonal groups revealed that 4 genes (ystB, hreP, myfA, and sat) were associated exclusively with strains belonging to clonal group A [44]. In a German study, a total of 151 Y. enterocolitica strains, isolated from humans, animals, and the environment, were identified and found to belong to biovars 1A (n = 22), 1B (n = 13), 2 (n = 12), 3 (n = 31), 4 (n = 63), and 5 (n = 10). Additionally, their susceptibilities to 71 antibiotics were examined, and 99% of all Yersinia strains were found to be resistant to amoxicillin. The results of this study showed that unambiguous state-
Momtaz et al.: YERSINIA ENTEROCOLITICA IN RAW CHICKEN ments cannot be made about the natural antibiotic susceptibility of Y. enterocolitica to certain β-lactams and fosfomycin. The data indicated a complex regulation of β-lactamases in Y. enterocolitica. Some β-lactamases were found more frequently or were expressed predominantly in specific biovars [45]. In a study on pathogenic virF-positive Y. pseudotuberculosis and Y. enterocolitica found in migratory birds in Sweden [46], 468 fecal samples from 57 different species of migratory birds were collected. In total, Yersinia spp. were isolated from 12.8% of the collected samples. The most commonly found species was Y. enterocolitica, which was isolated from 5.6% of samples. In addition, 10 Y. enterocolitica strains, all from barnacle geese, belonged to bioserotype 3/O:3, which is associated with human disease. Two of the strains were pathogenic, carrying the virF gene within their plasmids [46]. In a Dutch study [30], a duplex PCR assay targeting the ail and 16S ribosomal RNA genes of Y. enterocolitica was developed specifically to identify pathogenic Y. enterocolitica from pure culture. Validation of the assay was performed with 215 clinical Yersinia strains and 40 strains of other bacterial species. Within an assay time of 4 h, this assay offered a very specific, reliable, and inexpensive alternative to conventional phenotypic assays used in clinical laboratories to identify pathogenic Y. enterocolitica. The specificity of the duplex PCR assay was examined by isolating genomic DNA from 27 different Y. enterocolitica serogroups [30]. Lambertz et al. [47] showed that current methods for detection of the pathogenic Y. enterocolitica bacterium in food are time consuming and inefficient. Thus, they developed and evaluated an in-house TaqMan probe-based real-time PCR method for the detection of this pathogen. The complete method consists of overnight enrichment, DNA extraction, and real-time PCR amplification. In addition, the method was tested on naturally contaminated food. In all, 18 out of 125 samples were positive for the ail gene. A study by Thisted Lambertz and DanielssonTham [48] showed that pigs were the main reservoir of foodborne pathogenic Y. enterocolitica. Pork meat collected from refrigerators and local shops frequented by yersiniosis patients (n = 48) were examined for the presence of pathogenic Yersinia spp. The researchers used combined
143
culturing and PCR methods for detection, and a multiplex PCR was developed for detection of virulence genes (yst, rfbC, ail, virF). In all, 118 pork products (91 raw and 27 ready-to-eat) were collected. Pathogenic Yersinia spp. were detected by PCR in 9.89% (9 of 91) of the raw pork samples but in none of the ready-to-eat products. Thoerner et al. [10] developed a PCR-based assay for the detection of plasmid- and chromosome-borne virulence genes in Y. enterocolitica and Y. pseudotuberculosis to investigate the distribution of these genes in isolates from various sources. They compared results of PCR genotyping, based on 5 virulence-associated genes of 140 strains of Y. enterocolitica, with phenotypic tests, such as biotyping and serotyping, and with virulence plasmid-associated properties, such as calcium-dependent growth at 37°C and Congo red uptake. They suggested that genotypical data correlated well with biotypical data. The study found that only ystB was present in biotype 1A, although 40 Y. pseudotuberculosis isolates were PCR-tested for the presence of inv, yadA, and lcrF. All isolates were inv positive, and 88% of the isolates contained the virulence plasmid genes yadA and lcrF. To the authors’ knowledge, contact with chicken feces and a lack of hygiene in chicken slaughterhouses are the 2 most frequent reasons chicken meat is contaminated with Y. enterocolitica, which can easily spread to and cause yersiniosis in humans.
CONCLUSIONS AND APPLICATIONS
1. The existence of Y. enterocolitica in poultry meat indicates a carrier state and the possibility of shedding the microorganism into the environment. It shows that chickens are an important bacterial reservoir and a potential source of human infection. 2. A limited number of studies have investigated the occurrence and characterization of Y. enterocolitica in Iran. These findings support the hypothesis that chicken meat is a possible source of gastroenteritis caused by Y. enterocolitica and may be a reservoir of infection in Iran.
JAPR: Field Report
144
3. We conclude that control of Y. enterocolitica in chicken meat is crucial for managing infection. Maintaining hygiene at poultry slaughterhouses; checking and monitoring the slaughterhouse staff; preventing the contact of poultry carcasses with the slaughterhouse bed, soil, and feces; using clean and sanitary water for washing the carcasses; and finally, thoroughly cooking the chicken for oral use are the main principles for preventing human disease.
REFERENCES AND NOTES 1. Schlundt, J. 2002. New directions in foodborne disease prevention. Int. J. Food Microbiol. 78:3–17. 2. Vázlerová, M., and I. Steinhauserová. 2006. The comparison of the methods for the identification of pathogenic serotypes and biotypes of Yersinia enterocolitica: Microbiological methods and PCR. Czech J. Food Sci. 24:217–222. 3. Butler, T., M. Islam, M. R. Islam, A. K. Azad, M. I. Huq, P. Speelman, and S. K. Roy. 1984. Isolation of Yersinia enterocolitica and Y. intermedia from fatal cases of diarrhoeal illness in Bangladesh. Trans. R. Soc. Trop. Med. Hyg. 78:449–450. 4. Kanan, T. A., and Z. A. Abdulla. 2009. Isolation of Yersinia spp. from cases of diarrhoea in Iraqi infants and children. East. Mediterr. Health J. 15:276–284. 5. Soltan-Dallal, M. M., and K. Moezardalan. 2004. Frequency of Yersinia species infection in paediatric acute diarrhoea in Tehran. East. Mediterr. Health J. 10:152–158. 6. Okwori, A. E., P. O. Martínez, M. Fredriksson-Ahomaa, S. E. Agina, and H. Korkeala. 2009. Pathogenic Yersinia enterocolitica 2/O:9 and Yersinia pseudotuberculosis 1/O:1 strains isolated from human and non-human sources in the Plateau State of Nigeria. Food Microbiol. 26:872– 875. 7. Rahman, A., T. S. Bonny, S. Stonsaovapak, and C. Ananchaipattana. 2011. Yersinia enterocolitica: Epidemiological studies and outbreaks. J. Pathogens 2011:1–11. (Article no. 239391) 8. Bottone, E. J. 1997. Yersinia enterocolitica: The charisma continues. Clin. Microbiol. Rev. 10:257–276. 9. Kaneko, S., and T. Maruyama. 1987. Pathogenicity of Yersinia enterocolitica serotype O3 biotype 3 strains. J. Clin. Microbiol. 25:454–455. 10. Thoerner, P., C. I. Bin Kingombe, K. Bögli-Stuber, B. Bissig-Choisat, T. M. Wassenaar, J. Frey, and T. Jemmi. 2003. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl. Environ. Microbiol. 69:1810–1816. 11. Kandolo, K., and G. Wauters. 1985. Pyrazinamidase activity in Yersinia enterocolitica and related organisms. J. Clin. Microbiol. 21:980–982. 12. Aulisio, C. C., W. E. Hill, J. T. Stanfield, and R. L. Sellers. 1983. Evaluation of virulence factor testing and
characteristics of pathogenicity in Yersinia enterocolitica. Infect. Immun. 40:330–335. 13. Bhaduri, S., C. Turner-Jones, M. M. Taylor, and R. V. Lachica. 1990. Simple assay of calcium dependency for virulent plasmid-bearing clones of Yersinia enterocolitica. J. Clin. Microbiol. 28:798–800. 14. Bhaduri, S., C. Turner-Jones, and R. V. Lachica. 1991. Convenient agarose medium for simultaneous determination of the low-calcium response and Congo red binding by virulent strains of Yersinia enterocolitica. J. Clin. Microbiol. 29:2341–2344. 15. Bhaduri, S., and B. Cottrell. 1997. Direct detection and isolation of plasmid-bearing virulent serotypes of Yersinia enterocolitica from various foods. Appl. Environ. Microbiol. 63:4952–4955. 16. Farmer, J. J. 3rd, G. P. Carter, V. L. Miller, S. Falkow, and I. K. Wachsmuth. 1992. Pyrazinamidase, CR-MOX agar, salicin fermentation-esculin hydrolysis, and d-xylose fermentation for identifying pathogenic serotypes of Yersinia enterocolitica. J. Clin. Microbiol. 30:2589–2594. 17. Riley, G., and S. Toma. 1989. Detection of pathogenic Yersinia enterocolitica by using Congo red-magnesium oxalate agar medium. J. Clin. Microbiol. 27:213–214. 18. Weynants, V., V. Jadot, P. A. Denoel, A. Tibor, and J. J. Letesson. 1996. Detection of Yersinia enterocolitica serogroup O:3 by a PCR method. J. Clin. Microbiol. 34:1224– 1227. 19. Fenwick, S. G., and A. Murray. 1991. Detection of pathogenic Yersinia enterocolitica by polymerase chain reaction. Lancet 337:496–497. 20. Wren, B. W., and S. Tabaqchali. 1990. Detection of pathogenic Yersinia enterocolitica by the polymerase chain reaction. Lancet 336:693. 21. Nakajima, H., M. Inoue, T. Mori, K. Itoh, E. Arakawa, and H. Watanabe. 1992. Detection and identification of Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica by an improved polymerase chain reaction method. J. Clin. Microbiol. 30:2484–2486. 22. ISO (International Organization for Standardization). 2003. Microbiology of food and animal feeding stuffs— Horizontal method for the detection of presumptive pathogenic Yersinia enterocolitica. ISO10273:2003. Int. Organ. Stand., Geneva, Switzerland. 23. AES Chemunex, Combourg, France. 24. Oxoid, Basingstoke, UK. 25. Fluka, Buchs, Switzerland. 26. Merck, Darmstadt, Germany. 27. Denis, M., E. Houard, A. Labbé, M. Fondrevez, and G. Salvat. 2011. A selective chromogenic plate, YECA, for the detection of pathogenic Yersinia enterocolitica: Specificity, sensitivity, and capacity to detect pathogenic Y. enterocolitica from pig tonsils. J. Pathogens 2011:1–8. 28. Abcam, Cambridge, MA. 29. Fermentas, St. Leon-Rot, Germany. 30. Wannet, W. J., M. Reessink, H. A. Brunings, and H. M. Maas. 2001. Detection of pathogenic Yersinia enterocolitica by a rapid and sensitive duplex PCR assay. J. Clin. Microbiol. 39:4483–4486. 31. Eppendorf Mastercycler 5330, Eppendorf-NethelHinz GmbH, Hamburg, Germany. 32. Lamps, L. W., J. M. Havens, L. J. Gilbrech, P. H. Dube, and M. A. Scott. 2006. Molecular biogrouping of pathogenic Yersinia enterocolitica: Development of a diag-
Momtaz et al.: YERSINIA ENTEROCOLITICA IN RAW CHICKEN nostic PCR assay with histologic correlation. Am. J. Clin. Pathol. 125:658–664. 33. Wesley, I. V., S. Bhaduri, and E. Bush. 2008. Prevalence of Yersinia enterocolitica in market weight hogs in the United States. J. Food Prot. 71:1162–1168. 34. Lamps, L. W., K. T. Madhusudhan, J. K. Greenson, R. H. Pierce, N. A. Massoll, M. C. Chiles, P. J. Dean, and M. A. Scott. 2001. The role of Yersinia enterocolitica and Yersinia pseudotuberculosis in granulomatous appendicitis: A histologic and molecular study. Am. J. Surg. Pathol. 25:508–515. 35. Lamps, L. W., K. T. Madhusudhan, J. M. Havens, J. K. Greenson, M. P. Bronner, M. C. Chiles, P. J. Dean, and M. A. Scott. 2003. Pathogenic Yersinia DNA is detected in bowel and mesenteric lymph nodes from patients with Crohn’s disease. Am. J. Surg. Pathol. 27:220–227. 36. Havens, J. M., E. Montgomery, J. K. Greenson, M. A. Scott, and L. W. Lamps. 2003. Pathogenic Y. enterocolitica DNA is detected in gastrointestinal malakoplakia . Mod. Pathol. 16:1200A. (Abstr.) 37. Cocolin, L., and G. Comi. 2005. Use of a cultureindependent molecular method to study the ecology of Yersinia spp. in food. Int. J. Food Microbiol. 105:71–82. 38. Fredriksson-Ahomaa, M., and H. Korkeala. 2003. Low occurrence of pathogenic Yersinia enterocolitica in clinical, food, and environmental samples: A methodological problem. Clin. Microbiol. Rev. 16:220–229. 39. Vishnubhatla, A., D. Y. Fung, R. D. Oberst, M. P. Hays, T. G. Nagaraja, and S. J. Flood. 2000. Rapid 5′ nuclease (TaqMan) assay for detection of virulent strains of Yersinia enterocolitica. Appl. Environ. Microbiol. 66:4131– 4135. 40. Fredriksson-Ahomaa, M., and H. Korkeala. 2003. Molecular epidemiology of Yersinia enterocolitica 4/O:3. Adv. Exp. Med. Biol. 529:295–302. 41. Estrada, C. S., C. Velázquez Ldel, G. I. Favier, M. S. Genaro, and M. E. Escudero. 2012. Detection of Yersinia spp. in meat products by enrichment culture, immunomagnetic separation and nested PCR. Food Microbiol. 30:157– 163. 42. Favier, G. I., M. E. Escudero, and A. M. de Guzmán. 2005. Genotypic and phenotypic characteristics of Yersinia enterocolitica isolated from the surface of chicken eggshells obtained in Argentina. J. Food Prot. 68:1812–1815.
145
43. Zheng, H., Y. Sun, Z. Mao, and B. Jiang. 2008. Investigation of virulence genes in clinical isolates of Yersinia enterocolitica. FEMS Immunol. Med. Microbiol. 53:368– 374. 44. Bhagat, N., and J. S. Virdi. 2007. Distribution of virulence-associated genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation. FEMS Microbiol. Lett. 266:177–183. 45. Stock, I., and B. Wiedemann. 1999. An in vitro study of the antimicrobial susceptibilities of Yersinia enterocolitica and the definition of a database. J. Antimicrob. Chemother. 43:37–45. 46. Niskanen, T., J. Waldenström, M. Fredriksson-Ahomaa, B. Olsen, and H. Korkeala. 2003. virF-positive Yersinia pseudotuberculosis and Yersinia enterocolitica found in migratory birds in Sweden. Appl. Environ. Microbiol. 69:4670–4675. 47. Lambertz, S. T., C. Nilsson, S. Hallanvuo, and M. Lindblad. 2008. Real-time PCR method for detection of pathogenic Yersinia enterocolitica in food. Appl. Environ. Microbiol. 74:6060–6067. 48. Thisted Lambertz, S., and M. L. Danielsson-Tham. 2005. Identification and characterization of pathogenic Yersinia enterocolitica isolates by PCR and pulsed-field gel electrophoresis. Appl. Environ. Microbiol. 71:3674–3681. 49. Rasmussen, H. N., O. F. Rasmussen, J. K. Andersen, and J. E. Olsen. 1994. Specific detection of pathogenic Yersinia enterocolitica by two-step PCR using hot-start and DMSO. Mol. Cell. Probes 8:99–108. 50. Ibrahim, A., W. Liesack, M. W. Griffiths, and R. M. Robins-Browne. 1997. Development of a highly specific assay for rapid identification of pathogenic strains of Yersinia enterocolitica based on PCR amplification of the Yersinia heat-stable enterotoxin gene (yst). J. Clin. Microbiol. 35:1636–1638.
Acknowledgments
The authors thank M. Reiahi, M. Momeni, and E. Tajbakhsh at the Biotechnology Research Center of the Islamic Azad University of Shahrekord for their valuable technical support.
