identification and genetic diversity of pectolytic ... - SIPaV

Journal of Plant Pathology (2014), 96 (2), 271-279

Edizioni ETS Pisa, 2014

Dahaghin and Shams-Bakhsh

271

IDENTIFICATION AND GENETIC DIVERSITY OF PECTOLYTIC PHYTOPATHOGENIC BACTERIA OF MONO- AND DICOTYLEDONOUS ORNAMENTAL PLANTS IN IRAN L. Dahaghin and M. Shams-Bakhsh Plant Pathology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran

SUMMARY

Bacterial soft rot can be a destructive disease of ornamental plants. To identify the pathogenic soft rot bacteria occurring in ornamental plants in Tehran and Markazi provinces (Iran), 57 isolates were obtained from 12 different mono- and dicotyledonous hosts and investigated with regard to phenotypic, genotypic and pathogenicity features. Based on phenotypic characteristics, the bacterial strains were identified as Pectobacterium carotovorum subsp. carotovorum. This was confirmed by subspeciesspecific primers using PCR. Inoculation of all isolates into Aglaonema leaves confirmed the pathogenicity of the isolated strains. To assess the genetic diversity within Pectobacterium carotovorum subsp. carotovorum populations by rep-PCR, 26 isolates were selected according to their host and geographic distribution as well as two strains from Guilan province. Cluster analysis was conducted using the UPGMA method and revealed a possible close relationship between DNA fingerprints and geographical origins of isolates. Our results showed significant genetic variation among the populations of this pathogen. To the best of our knowledge, this is the first report of Pectobacterium carotovorum subsp. carotovorum on Peperomia obtusifolia, P. caperata, Pilea cadierei, Plectranthus australis, Saintpaulia ionantha and Kalanchoe tubiflora in Iran. Key words: Soft-rot bacteria, Pectobacterium carotovorum subsp. carotovorum, ornamental plant, diagnosis, PCR, survey

Clostridium, Dickeya and Pectobacterium (Pérombelon and Kelman, 1980; Liao and Wells, 1987; Krejzar et al., 2008). Pectobacterium carotovorum subsp. carotovorum (Pcc), one of the most important members of the soft rot bacteria group, has a wide geographical distribution and causes disease on numerous important crop and ornamental plants (Pérombelon and Kelman, 1980; Wright, 1998; Avrova et al., 2002; Pérombelon, 2002; Ma et al., 2007). This sub-species has been reported as a pathogen of an number of ornamental hosts (Table 1). In addition to Pcc, some other soft rotting bacteria with pectolitic activity, such as Dickeya chrysanthemi, Dickeya dieffenbachiae, Dickeya dadantii, Dickeya dianthicola (Parkinson et al., 2009), Pectobacterium atrosepticum, Pseudomonas marginalis, and Pseudomonas veronii (Wright and Burge, 2000; Hahm et al., 2003; Krejzar et al., 2008; Mikiciński et al., 2010) have been reported on different ornamental plants. In Iran, soft rot bacteria have previously been reported from ornamental plants including Fritillaria imperialis in Kermanshah and Isfahan (Mahmoudi et al., 2007) and Aglaonema sp., Dieffenbachia sp., Epipremnum aureum, Ficus elastic, Hippeastrum sp., Iris sp., Lampranthus sp., Maranta leuconeura, Peperomia sp., Philodendron spp., Sansevieria trifasciata, Schlumbergera bridgesii, Spathiphyllum sp. and Syngonium podophyllum from Mazandaran, Guilan, Golestan and Khorasan Razavi provinces (Baghaee-Ravari et al., 2010, 2011). However, there are no published data related to the distribution of bacterial soft rot on these plants in Tehran and Markazi provinces, which are the main ornamental plant propagation regions in Iran. In this study, we aimed at isolating and identifying the bacteria associated with soft rot of ornamental plants in two major growing areas of Iran and to evaluate the diversity of these isolates.

INTRODUCTION

Ornamental plants are often vulnerable to attack by pathogens because of intensive cultivation during production and suitable conditions for pathogen growth in greenhouses. An important disease which reduces the production efficiency and quality of these crops is bacterial soft rot (Agrios, 2005). Soft rot can be caused by several bacterial genera including Pseudomonas, Xanthomonas, Corresponding author: M. Shams-Bakhsh Fax: +98.2148292200 E-mail: [email protected]

MATERIALS AND METHODS

Bacterial isolates and media. Fifty-seven isolates of pectolytic bacteria were obtained from diseased ornamental plants of two different geographical regions of Iran, i.e. Tehran and Markazi provinces in 2009 and 2010 (Table 2). In addition, two Pcc strains previously isolated from Philodendron scandens in Guilan province (Baghaee-Ravari et al., 2011) were provided by Dr. S. Baghaee-Ravari. The type strains of Pcc (IBSBF-863 = ATCC15713), P. atrosepticum (IBSBF-1819 = ATCC33260), P. betavasculorum

272

Genetic diversity of pectolytic bacteria in Iran


Table 1. Ornamental host species of Pectobacterium carotovorum subsp. carotovorum and their origins. Hosts

Origins

References

Agave americana Aglaonema modestum Aglaonema spp. Aloe vera Amomum villosum Begonia hiemalis Begonia semperflorens Calanthe discolor Chamaecereus silvestrii Chlorophytum comosum Clivia miniata Crinum asiaticum Cymbidium pendulum Dianthus sp. Dieffenbachiae amoena Dieffenbachiae picta Disporum sp. Dracaena spp. Epipremnum pinnatum Fritillaria imperialis Gomphrena globosa Hosta plantaginea Iris spp. Kalanchoe blossfeldiana Kalanchoe spp. Lilium longflorum Musa nana Ornithogalum arabicum Paphiopedilum spp. Pelargonium graveolens Philodendron scandens Polygonatum sibricum Saintpaulia sp. Schlumbergera bridgesii Spathiphyllum wallisii Speirantha gardenii Syngonium podophyllum Tulipa spp. Wedelia chinensis Zantedeschia aethiopica Zantedeschia elliottiana Zantedeschia spp.

China China Jamaica, Iran China China Korea China China Korea China Korea China China China Turkey China China Puerto Rico Puerto Rico Iran China China Iran Florida Israel Korea China Kenya China China Iran China Korea Iran Argentina China Iran Turkey China Puerto Rico, Italy Taiwan New Zealand, Poland

Chen et al., 1994 Chen et al., 1994 Costa et al., 2006; Baghaee-Ravari et al., 2011 Chen et al., 1994 Chen et al., 1994 Choi and Lee, 2000 Chen et al., 1994 Chen et al., 1994 Kim et al., 2007 Chen et al., 1994 Choi and Lee, 2000 Chen et al., 1994 Chen et al., 1994 Chen et al., 1994 Cetinkaya-Yildiz et al., 2004 Chen et al., 1994 Chen et al., 1994 Cortes Monllor, 1990 Cortes Monllor, 1990 Mahmoudi et al., 2007 Chen et al., 1994 Chen et al., 1994 Baghaee-Ravari et al., 2011 Engelhard et al., 1986 Costa et al., 2006 Hahm et al., 2003 Chen et al., 1994 Costa et al., 2006 Chen et al., 1994 Chen et al., 1994 Baghaee-Ravari et al., 2011 Chen et al., 1994 Choi and Lee, 2000 Baghaee-Ravari et al., 2011 Alippi and López, 2009 Chen et al., 1994 Baghaee-Ravari et al., 2011 Boyraz et al., 2006 Chen et al., 1994 Cortes Monllor, 1990; Buonaurio et al., 2002 Lee et al., 2002 Wright, 1998; Mikiciński et al., 2010

(IBSBF-787 = ATCC43762), P. carotovorum subsp. odoriferum (IBSBF-1814 = ICMP11533) Dickeya chrysanthemi pv. chrysanthemi (IBSBF-231 = ATCC11663) obtained from the Instituto Biológico, Seção de Bacteriologia Fitopatologia (São Paulo, Brazi)) and the reference strain of P. wasabiae (SCRI 488) obtained from Scottish Crop Research Institute (Invergowrie, UK) were included for comparison in different tests. All bacterial isolates and strains were grown on nutrient agar (NA) at 25°C for 48 h. After incubation, representative single bacterial colonies were purified on King’s B medium and selected isolates were further characterized. All isolates and strains were stored in sterile water and in 30% (v/v) glycerol at −80°C. Pectolytic ability. Potato tubers were surface-sterilized with 96% ethanol, flamed and peeled aseptically, then sliced into disks about 7-8 mm thick. These were placed

in sterile Petri dishes with a sterile, moistened filter paper. A bacterial cell suspension was applied into shallow pits made in the centre of potato disks, and the dishes were incubated at 28°C. The inoculated disks were examined at 24 and 48 h for soft rot by probing the tissue surrounding the inoculum site with a loop to assess the ability to macerate them at 28°C (Bradbury, 1970; Schaad et al., 2001). Phenotypic tests. Isolates that were characterized as positive for pectolytic activity were tested with conventional biochemical and physiological tests including: Gram reaction (Suslow et al., 1982), oxidative and fermentative metabolism of glucose (Hugh and Leifson, 1953), oxidase and catalase activity (Schaad et al., 2001), production of levan from sucrose (Lelliott and Stead, 1987), fluorescent pigment production (King et al., 1954), hydrolysis of gelatine, lecithin and casein (Dickey and Kelman, 1988), indole



273

Table 2. Bacterial isolates used in this study. Number of isolates (from an area per host, with their collection numbers)

Geographical origin

Host

Plant part

2 (T-Za1*, T-Za2) 5 (M-Za3*, M-Za4, M-Za5, M-Za6, M-Za7*) 5 (T-Ag1, T-Ag2, T-Ag3*, T-Ag4, T-Ag5*) 1 (T-Ag6*) 4 (T-Ag7*, T-Ag8, T-Ag9, T-Ag10 ) 6 (M-Ag11*, M-Ag12*, M-Ag13, M-Ag14*, M-Ag15*, M-Ag16* ) 1 (T-Di1) 2 (T-Di2, T-Di3 ) 1 (T-Di4*) 1 (T-Di5*) 3 (M-Di6, M-Di7*, M-Di8) 4 (T-Sc1, T-Sc2, T-Sc3*, T-Sc4 ) 2 (T-Sc5, T-Sc6*) 7 (M-Sc7*, M-Sc8, M-Sc9*, M-Sc10, M-Sc11, M-Sc12, M-Sc13* ) 2 (M-Phi1*, M-Phi2 ) 3 (M-Pe.o1*, M-Pe.o2, M-Pe.o3 ) 1 (T-Pe.c1*) 1 (M-Pe.c2) 2 (M-Pl1, M-Pl2) 1 (M-Ka1*) 1 (M-Pi1*) 1 (M-Sy1) 1 (M-Sa1*)

Tehran-Pakdasht Markazi-Mahallat Tehran-Hashtgerd Tehran-Shahriyar Tehran Markazi-Mahallat Tehran-Hashtgerd Tehran-Pakdasht Tehran Tehran-Pakdasht Markazi-Mahallat Tehran-Hashtgerd Tehran-Pakdasht Markazi-Mahallat Markazi-Mahallat Markazi-Mahallat Tehran Markazi-Mahallat Markazi-Mahallat Markazi-Mahallat Markazi-Mahallat Markazi-Mahallat Markazi-Mahallat

Zantedeschia sp. Zantedeschia sp. Aglaonema sp. Aglaonema sp. Aglaonema sp. Aglaonema sp. Dieffenbachia sp. Dieffenbachia sp. Dieffenbachia sp. Dieffenbachia sp. Dieffenbachia sp. Scindapsus sp. Scindapsus sp. Scindapsus sp. Philodendron sp. Peperomia obtusifolia Peperomia caperata Peperomia caperata Plectranthus australis Kalanchoe tubiflora Pilea cadierei Syngonium sp. Saintpaulia ionantha

Stem Root and tuber Leaf and stem Leaf Leaf Leaf Leaf Leaf Stem Leaf Leaf Leaf Leaf Leaf Leaf Leaf Root and stem Root and stem Leaf Stem Leaf Leaf Leaf

* Isolates used for genetic diversity investigation

production and nitrate reduction (Gerhardt et al., 1981), hydrogen sulfide production from sodium thiosulfate (Dye, 1968), ability to grow at 37°C in nutrient broth and in 5% sodium chloride on nutrient agar, production of reducing substances from sucrose, anaerobic degradation of arginine, hydrolysis of starch, phosphatase and urease activity, malonate and citrate utilization, acid production from trehalose, lactose, α-methyl glucoside, D-(+)-arabitol, D-(+)-melibiose, D-(−)-tartrate, L-glutamate, raffinose, sorbitol, maltose and cellubiose (Schaad et al., 2001). Pathogenicity test. Inoculation was carried out by injecting 100 μl of bacterial suspension (107 CFU ml−1) into the expanded leaves of Aglaonema with a syringe. The inoculated plants were placed in a moist chamber at 28°C with 85-90% relative humidity. Plant reactions were recorded 4, 5 and 7 days after inoculation (Kim et al., 2007). Two independent experiments were performed and four leaves per isolate or strain were inoculated. Positive (Pcc ATCC 15713) and negative (water) controls were included in these experiments. Bacterial DNA extraction. DNA was extracted from bacterial cells by phenol-chloroform extraction (Sambrook and Russell, 2001). Total genomic DNA of each isolate was extracted from cultures grown for 24 h at 28°C in nutrient broth (NB). Aliquots (1.5 ml) of bacterial suspension were transferred to microtubes, centrifuged at 13,000g for 10 min, and the supernatant was discarded. The pellet was resuspended in 500 μl extraction buffer (0.5 M Tris-HCl, pH 7.5, 0.4 M EDTA, 1% SDS, 0.2 mg ml−1 proteinase K) and incubated at 65°C in a water bath for 45 min. Equal

volumes of phenol-chloroform (1:1) were added to the tube, aqueous and organic phases were mixed by gentle inversion until the phases were completely mixed. The samples were subsequently centrifuged at 10,000 g for 15 min at room temperature to separate the aqueous phase from the organic phase. The upper aqueous phase was transferred to a clean tube, then an equal volume of chloroform was added to it, mixed and centrifuged as above. The upper phase was transferred to a new tube and DNA was precipitated with 0.1 vol. of 3 M sodium acetate pH 5.2 and 0.7 vol. of cold isopropanol. After precipitation, tubes were kept at −20°C for at least 30 min and centrifuged at 14,000 g for 10 min. Supernatant was discarded and DNA was washed with 70% ethanol, air-dried, resuspended in 50 μl of TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) and stored at −20°C for further use. Molecular identification. PCR was carried out using the species specific primers Y1 (5’TTACCGGACGCCGAGCTGTGGCGT -3’) and Y2 (5’CAGGAAGATGTCGTTATCGCGAGT -3’) selected from a pectate lyase-encoding gene of the Y family (Darrasse et al., 1994) amplifying a 434 bp band in Pectobacterium carotovorum subspecies and two primer pairs; the subspecies-specific EXPCCF (5’- GAACTTCGCACCGCCGACCTTCTA -3’) and EXPCCR (5’- GCCGTAATTGCCTACCTGCTTAAG -3’) amplifying a 550 bp band from Pcc (Kang et al., 2003). PCR reactions were performed in a total volume of 25 μl consisting of 50 ng of template DNA, 0.5 U of Taq polymerase (CinnaGen, Iran), 2.5 μl of 10× PCR buffer (100 mM Tris- HCl, 500 mM KCl pH 8.4), 2 mM MgCl 2, 200 μM dNTPs, and 10 pmol of each primers.

274



Table 3. Biochemical and physiological characteristics of ornamental isolates compared with type and reference strains. Pectobacterium carotovorum subsp. carotovorum (Pcc), Pectobacterium carotovorum subsp. odoriferum (Pco), Pectobacterium atrosepticum (Pa), Pectobacterium betavasculorum (Pb), Pectobacterium wasabiae (Pw) and Dickeya chrysanthemi pv. chrysanthemi (Dcc). Ornamental strains

Characters

Dcc

Pw

Pb

Pa

Pco

Pcc

+ FA − + + + + + + + + +

+ FA − + + − − − + + − −

+ FA − + + − − − − − + +

+ FA − + + − − − − − + −

+ FA − + + − − − + + + +

+ FAb − + + − − − + + − +

+ + − − + − + + −

+ − − − + − + + −

− + − − − − − + −

+ + + + + − − − −

+ + + + + − + + −

+ + + + + + + + +

+ + − − + − + + −

+ (96.5%)− + (98.2%)−

+ + + −

+ − − −

− − + −

+ − − −

− − + +

+ − + −

+ FA − + + (61.4%)− − − (96.5%)+ (98.2%)+ (98.2%)− (91.2%)+

a

Type and reference strains

Potato soft rot O/Fa Oxidase Catalase Nitrate reduction Indole Production Phosphatase Lecithinase Gelatinase Caseinase Rssc Growth at 37°C Acid production from: Lactose Trehalose Maltose á -Methylglucoside Raffinose Sorbitol D-(+)-Melibiose D-(+)-Cellobiose D-(+)-Arabitol Utilization of: Citrate Malonate L-Glutamate D-Tartarate

Oxidative fermentative test; b Facultatively anaerobic; cReducing substance from sucrose

PCR amplification was carried out using a thermal cycler (Mastercycler gradient, Eppendorf, Germany) with the following thermal regime: initial denaturation at 94°C for 5 min, followed by 35 amplification cycles of 94°C for 30 sec, 60°C (EXPCCR/ EXPCCF) and 65°C (Y1/Y2) for 45 sec, and 72°C for 1 min, ending with extension at 72°C for 10 min. In all cases, amplified DNA fragments were detected by electrophoresis in a 1.5% agarose gel stained with 0.5% ethidium bromide. GeneRule (Fermentas, Lithuania) and Mide Range DNA ladders (Jena Bioscience, Germany) were used as size markers. Repetitive extragenic palindromic-based polymerase chain reaction (rep-PCR). To assess the genetic diversity within Pcc populations using rep-PCR, 26 isolates were selected according to their host and geographic distribution as well as two strains from the Guilan province and Pcc (ATCC15713) and Dickeya chrysanthemi pv. chrysanthemi (ATCC11663) as reference strains. These isolates were subjected to rep-PCR genomic fingerprinting using REP 1R and REP 2I, ERIC 1R and ERIC 2I and BOX1A primers (Versalovic et al., 1994). PCR reactions were performed in a total volume of 25 μl consisting of 50 ng of template DNA, 0.5 U of Taq

polymerase (CinnaGen, Iran), 2.5 μl of 10× PCR buffer (100 mM Tris- HCl, 500 mM KCl pH 8.4), 2 mM MgCl 2, 200 μM dNTPs, and 10 pmol of each primers. PCR amplification was carried out using the same thermal cycler as above with the following conditions: initial denaturation at 94°C for 7 min; 35 cycles of denaturing at 94°C for 1 min, and annealing at 48, 52 or 50°C for 1 min with either REP, ERIC or Box primers, respectively; and extension at 72°C for 3 min. Final extension was performed at 72°C for 10 min and the reactions products were held at 4°C until used. PCR products were separated by electrophoresis on 2% agarose gel in 1× TBE buffer (100 mM Tris, 500 mM boric acid, 1 mM EDTA), at 80 V for 3 h and stained with 0.5% ethidium bromide. One Kb GeneRuler™ ladder (Fermentas, Lithuania) were used as size marker. Data analysis. DNA bands obtained on the gel were scored as present (1) or absent (0) and the readings were processed as a binary matrix. The similarity of all pairwise combinations was determined using Jaccard’s coefficient (Jaccard, 1908) and clustering were performed by the unweighted pair group method with arithmetic mean (UPGMA) using NTSYS, version 2.1 (Rohlf, 2000).



275

as Gram reaction, fermentative metabolism, oxidase and catalase activity, acid production from α- methylglucoside, trehalose, lactose and sorbitol demonstrated the presence of bacteria identical to the inoculated isolates.

Fig. 1. Amplification of a specific 550 bp band generated with EXPCCF/EXPCCR primers (above) and a 434 bp band generated with Y1 and Y2 primers (below) in bacterial strains. M (above); molecular marker (GeneRuler™ 100 bp plus DNA ladder); M (below); molecular marker (Mid range DNA ladder); lane 1, Pcc ATCC 15713T; lane 2, M-Pl2; lane 3, M-Phi2; lane 4, M-Sc11; lane 5, M-Sc12; lane 6, M-Pe.o2; lane 7, M- Pe. o3; lane 8, M-Pe.c2; lane 9, M-Sy1; lane 10, M-Pl1; lane 11, T-Di2; lane 12, T-Di3; lane 13, T-Za2; lane 14, T-Ag7; lane 15, T-Sc1; lane 16, M-Sc10; lane 17, M-Ka1; lane 18, M-Za4; N: negative control. RESULTS

Identification of isolates. All 57 isolates obtained in 2009 and 2010 from diseased ornamental plants were identified as Pcc based on biochemical features, with few exceptions in some biochemical tests (Table 3). They were all Gram-negative, facultative anaerobic, catalase-positive, and oxidase-negative, were not fluorescent on King’s B (KB) medium, induced soft rot symptoms on potato slices, , reduced nitrate to nitrite but not sucrose, and hydrolysed gelatine and casein, but not starch and arginine. All strains produced H2S but not lecithinase, phosphatase and urease. They were tolerant to 5% NaCl and able to grow at 37ºC but did not produce levan. Other characteristics are listed in Table 3. The majority of the isolates showed the same biochemical properties as the Pcc reference strain. However, seven isolates differed from the Pcc reference strain in a few properties such as production of reducing substances from sucrose (T-Di2 and T-Di3), casein (M-Za5) and gelatine hydrolysis (M-Za5 and M-Ag12), growth at 37ºC (M-Ag16, T-Di2, T-Di3, M-Pe.o2 and M-Sy1), utilization of malonate (T-Di2 and T-Di3) and D-tartarate (T-Di3). Pathogenicity test. All 57 isolates and the type strain (Pcc ATCC 15713) caused disease symptoms when Aglaonema leaves were inoculated. Symptoms appeared 5-7 days post inoculation as water-soaked lesions with yellow margin, which expanded and turned necrotic . No soft rot symptoms were observed on control leaves injected with sterile water. Re-isolations from lesions of inoculated leaves and assessment by biochemical and physiological tests such

Molecular identification. Based on phenotypic characteristics, the bacterial strains were identified as Pectobacterium carotovorum. To confirm their identity as the subspecies carotovorum, PCR reactions were performed using specific sets of primers including Y1/ Y2 and EXPCCF/EXPCCR. All 57 isolates and the type strain Pcc ATCC 15713 produced the expected 434 bp fragment using Y1 and Y2 primers, while only 46 isolates produced the expected 550 bp fragment in PCR amplifications with EXPCCF/EXPCCR primers (Fig. 1). Rep-PCR genomic fingerprinting. ERIC, REP and BOX primers gave a total of 84 well-resolved bands as reproducible genomic PCR profiles. Thirty nine bands were identified using ERIC (ranging from approximately 150 to 7,000 bp), 23 bands by REP (ranging from 150 to 6,000 bp) and 22 bands by BOX-PCR (ranging from 250 to 3,500 bp). PCR profiles generated by the ERIC, REP and BOX primers showed differential banding patterns among Pcc strains originating from different regions and hosts (shown for ERIC and REP in Fig. 2). The separate dendrograms (data not shown) obtained for each primer set revealed high variation among Pcc isolates. This high genetic diversity was shown not only by isolates from distinct hosts and geographical origins but also within isolates collected from a single host or geographical origin. The dendrogram obtained from the combined data for all primers is shown in Fig. 3. UPGMA analysis showed that Pcc strains could be differentiated into seven clades and three single isolates at the 37% similarity level. Clade I and clade IV contained three and two strains from Tehran, respectively, clade III contained two strains from Guilan, clades V, VI and VII included two, three and two strains from Markazi, respectively. Only clade II contained isolates from both Tehran and Markazi provinces and encompassed five strains from Tehran and six strains from Markazi. In clade V, M-Sc9 and M-Phi1 strains (isolated from Scindapsus sp. and Philodendron sp., respectively) shared 96% similarity, which represented the closest genetic relationship in this analysis. However, rep-PCR proved to be limited in its capability to cluster Pcc isolates based on the host origins. For example, three Pcc strains from Dieffenbachia spp. were separated into three different clades (I, II and IV), rather than groupingin one clade. DISCUSSION

This study has focused on the characterization of soft-rotting bacteria isolated from infected ornamental plants in two major growing areas of

276



Fig. 2. Genomic DNA fingerprinting patterns of 28 Pcc isolates from different ornamental plants and two reference strains, generated by ERIC-PCR (a) and REP-PCR (b). M: molecular marker (GeneRuler™ 1 kb DNA ladder); N: negative control; lane 1, DccATCC 11663; lane 2, Pcc ATCC 15713; lane 3, T-Za1; lane 4, T-Ag3; lane 5, T-Sc3; lane 6, T-Ag5; lane 7, T-Ag6; lane 8, T-Di4; lane 9, T-Ag7; lane 10, T-Di5; lane 11,T-Sc6; lane 12, T-Pe.c1; lane 13, M-Za3; lane 14, M-Za7; lane 15, M-Sa1; lane 16:M-Ag11; lane 17, M-Ka1; lane 18, M-Pe.o1; lane 19, M-Pi1; lane 20, M-Ag12; lane 21, M-Ag14; lane 22, M-Di6; lane 23, M-Sc7; lane 24, M-Sc9; lane 25, M-Phi1; lane 26, M-Ag15; lane 27, M-Ag16; lane 28, M-Sc13; lane 29, G-Phi3; lane 30, G-Phi4.

Iran. On the basis of biochemical, physiological and molecular techniques, all isolates originating from both monocotyledonous (Aglaonema spp., Dieffenbachia spp., Scindapsus sp., Philodendron sp., Syngonium podophyllum and Zantedeschia spp.) and dicotyledonous hosts (S. ionantha, P. obtusifolia, P. caperata, Pilea cadierei, Plectranthus australis and K. tubiflora) were identified as Pectobacterium carotovorum. These isolates could definitely be identified as Pcc, however, there were a few strains with differences in some phenotypic characteristics including ability to grow at 37°C, ability to hydrolyze gelatine and casein, reduction of sucrose and utilization of malonate and Dtartrate and also in the reaction with subspecific primers. Unusual Pcc strains with similar atypical biochemical features have previously been reported (Seo et al., 2002; Yahiaoui-Zaidi et al., 2003; Yap et al., 2004; Fiori et al., 2005; Mahmoudi et al., 2007; Gallelli et al., 2009; Alvarado et al., 2011; Baghaee-Ravari et al., 2011). It appears that the presence of such strains with different properties could be the result of high mutation rates in the Pcc genome. To confirm the results obtained by phenotypic tests, PCR reaction was performed using specific sets of primers, including Y1 and Y2 (Darrasse et al., 1994) and EXPCCF/ EXPCCR (Kang et al., 2003). Although a 434 bp fragment was amplified from all isolates using Y1 and Y2

primers, 11 out of 57 isolates failed to produce amplification fragments with EXPCCF/EXPCCR primers, whereas biochemical tests showed that they belong to Pcc. Similar results were also reported by Baghaee-Ravari et al. (2011). Inoculation of all Pcc strains on selected hosts under artificial conditions induced disease symptoms in different mono- and dicotyledonous plants indicating that these strains are not host-specific, in agreement with results by Mahmoudi et al. (2007). Among the 12 Pcc hosts checked in this study, six species, viz. P. obtusifolia, P. caperata, Pilea cadierei, Plectranthus australis, S.ionantha and K. tubiflora are reported for the first time as hosts of Pcc in Iran. Considering the vast distribution and the high potentiality of this pathogen to infect a wide range of plant species (Ma et al., 2007), it can be expected that it will be recovered from many other families of ornamental plants. Most of the isolates in this study (82%) were from monocotyledonous hosts and belonged to the family Araceae, implying that this family’s members are possibly more susceptible to Pcc infection, this being in agreement with the work of Norman et al. (2003). Rep-PCR is a powerful tool to analyze bacterial genomes and to assess diversity at the species, subspecies, or strain levels (Louws et al., 1999). The fingerprints obtained



277

Fig. 3. Dendrogram of genetic similarity of 28 Pectobacterium carotovorum subsp. carotovorum isolates from different ornamental plants. The similarity is the result of the combined data of REP, ERIC and BOX primer sets using UPGMA analysis and Jaccard’s coefficient. Pcc = Pcc ATCC 15713T.

from REP, ERIC, and BOX PCR markers were polymorphic and showed significant genetic variation among Pcc strains originating from different ornamental plants. Previously, a considerable degree of diversity in Pcc populations had been reported by many others (Avrova et al., 2002; Yahiaoui-Zaidi et al., 2003; Yap et al., 2004; Costa et al., 2006; Pitman et al., 2008; Gallelli et al., 2009; Alvarado et al., 2011; Baghaee-Ravari et al., 2011; Tavassoli et al., 2011; Terta et al., 2011). The grouping of the 26 Pcc isolates into seven clades and three single isolates following rep-PCR reflected, to some extent, a correlation between rep-PCR genomic profiles and their geographical origin, showing that Pcc isolates collected from the same area tend to cluster together. The linkage between rep-PCR results and the geographic origin of bacterial strains had previously been recognized (Scortichini et al., 2001). Louws et al. (1994) believe that one of the important reasons for this phenomenon is that the selection for one geographically suitable area can influence the genetic map of a bacterium also the dispersion of these repetitive units in its genome. This work supports this idea and in some cases these relations were observed. Louws et al. (1994) stated that selection for a specialized niche seems to impact the distribution of repetitive regions through the genome, and consequently produces specific fingerprint profiles for each strain. Our findings are in accordance with previous conclusions about linkage of BOX-PCR profiles with the geographical origin of Pcc populations from potato (Tavasoli et al., 2011), although it is worth noting that Terta et al. (2011) did not observe any correlation between ERIC-PCR groups and geographic areas of Pcc strains from the same host. Furthermore, the combined dendrogram (Fig. 3), shows that rep-PCR

markers could not differentiate Pcc isolates according to the host origin. However, a few isolates from the same host tended to group closely. For example, T-Ag6 and T-Ag7 isolates from Aglaonema spp. and G-Phi3and G-Phi4 isolates from Philodendron scandens were clustered close to each other (Fig. 3). The present analysis reveals that rep-PCR was unable to differentiate between Pcc strains from monocotyledonous and dicotyledonous hosts, while the opposite was reported by Yishay et al. (2008) using AFLP and ITS-PCR markers and analysis of 16S rRNA. In summary, it can be concluded that the main causal agent of soft rot disease in monoand dicotyledonous ornamentals in the major production regions of Iran belongs to Pcc and that a significant genetic variation occurs within its populations. REFERENCES Agrios G.N., 2005. Plant Pathology. Fifth Ed. Elsevier Academic Press, London, UK. Alippi A., López A., 2009. First Report of Pectobacterium carotovorum subsp. carotovorum on Spathiphyllum wallisii in Argentina. Plant Disease 93: 842. Alvarado I.C.M., Michereff S.J., Mariano R.L.R., Souza E.B., Quezado-Duval A.M., Resende L.V., Cardoso E., Mizubuti E.S.G., 2011. Characterization and variability of soft rotcausing bacteria in Chinese cabbage in North Eastern Brazil. Journal of Plant Pathology 93: 173-181. Avrova A.O., Hyman L.J., Toth R.L., Toth I.K., 2002. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi. Applied and Environmental Microbiology 68: 1499-1508.

278


Baghaee-Ravari S., Rahimian H., Shams-Bakhsh M., LopezSolanilla E., Antúnez-Lamas M., Rodríguez-Palenzuela P., 2011. Characterization of Pectobacterium species from Iran using biochemical and molecular methods. European Journal of Plant Pathology 129: 413-425. Baghaee-Ravari S., Shams-Bakhsh M., Rahimian H., Safaie N., 2010. Phenotypic and genotypic diversity of pectolytic erwinias isolated from ornamental hosts in some northern parts of Iran. Iranian Journal of Plant Pathology 46: 61-64. Boyraz N., Bastas K., Maden S., Yasar A., 2006. Bacterial leaf and peduncle soft rot caused by Pectobacterium carotovorum on tulips in Konya, Turkey. Phytoparasitica 34: 272-280. Bradbury J., 1970. Isolation and preliminary study of bacteria from plants. International Journal of Pest Management 16: 632-637. Buonaurio R., Caglioti C., Pires M.M., Moretti C., Innocenti M., 2002. Occurrence of a soft rot of calla (Zantedeschia aethiopica) caused by Pectobacterium carotovorum subsp. carotovorum in central Italy. Phytopathologia Mediterranea 41: 152-156. Cetinkaya-Yildiz R., Mirik M., Aysan Y., Kusek M., Sahin F., 2004. An outbreak of bacterial stem rots of Dieffenbachia amoena caused by Erwinia carotovora subsp. carotovora in the Eastern Mediterranean Region of Turkey. Plant Disease 88: 310. Chen S., Wang J., Fang Z., 1994. On bacterial soft rot pathogens of some ornamentals in China. Acta Phytopathologia Sinica 24: 159-164. Choi J.E., Lee E.J., 2000. New bacterial soft rot of ornamental foliage plants by Erwinia carotovora subsp. carotovora in Korea. Plant Disease Research 6: 19-22. Cortes Monllor A., 1990. Erwinia carotovora pv. carotovora, causal agent of soft rot disease in some crops in Puerto Rico. Journal of Agriculture of the University of Puerto Rico 74: 8392. Costa A., Eloy M., Cruz L., Janse J., Oliveira H., 2006. Studies on pectolytic Erwinia spp. In Portugal reveal unusual strains of E. carotovora subsp. atroseptica. Journal of Plant Pathology 88: 161-169. Darrasse A., Priou S., Kotoujansky A., Bertheau Y., 1994. PCR and restriction fragment length polymorphism of a pel gene as a tool to identify Erwinia carotovora in relation to potato diseases. Applied and Environmental Microbiology 60: 14371443. Dickey R.S., Kelman A., 1988. Erwinia carotovora or soft rot group. In: Schaad N.W. (ed.) Laboratory Guide for Identification of Plant Pathogenic Bacteria, pp. 44-59. APS Press, St. Paul, MN, USA. Dye D.W., 1968. A taxonomic study of the genus Erwinia. I-the “amylovora” group. New Zealand Journal of Science 11: 590607. Engelhard A.W., McGuire R.G., Jones J.B., 1986. Erwinia carotovora pv. carotovora, a pathogen of Kalanchoë blossfeldiana. Plant Disease 70: 575-577. Fiori M., Virdis S., Schiaffino A., 2005. Phenotypic and genetic characterization of Erwiniua carotovora spp. carotovora (Jones) Bergey et al. isolates from grafted tomato in Sardinia, Italy. Phytopathologia Mediterranea 44: 50-57.

Journal of Plant Pathology (2014), 96 (2), 271-279 Gallelli A., Galli M., De Simone D., Zaccardelli M., Loreti S., 2009. Phenotypic and genetic variability of Pectobacterium carotovorum isolated from artichoke in the Sele valley. Journal of Plant Pathology 91: 757-761. Gerhardt P., Murray R.G.E., Costilow R.N., Nester E.W., Wood W.A., Krieg N.R., Phillips G.B., 1981. Manual of Methods for General Bacteriology. American Society for Microbiology, Washington DC, , USA. Hahm S.S., Ham K.S., Shim M.Y., Choi J.J., Kwon K.H., Choi J.E., 2003. Occurrence of bacterial soft rot of lily bulb caused by Pectobacterium carotovorum subsp. carotovorum and Pseudomonas marginalis in Korea. The Plant Pathology Journal 19: 43-45. Hugh R., Leifson E., 1953. The taxonomic significance of fermentative versus oxidative metabolism of carbohydrates by various gram negative bacteria. Journal of Bacteriology 66: 24-26. Jaccard P., 1908. Nouvelles recherches la distribution florale. Bulletin de la Société Vaudoise des Sciences Naturelles 44: 223270. Kang H., Kwon S., Go S., 2003. PCR-based specific and sensitive detection of Pectobacterium carotovorum subsp. carotovorum by primers generated from a URP-PCR fingerprinting-derived polymorphic band. Plant Pathology 52: 127-133. Kim J.H., Joen Y.H., Kim S.G., Kim Y.H., 2007. First report on bacterial soft rot of graft-cactus Chamaecereus silvestrii caused by Pectobacterium carotovorum subsp. carotovorum in Korea. The Plant Pathology Journal 23: 314-317. King E.O., Ward M.K., Raney D.E., 1954. Two simple media for the demonstration of pyocyanin and fluorescin. The Journal of Laboratory and Clinical Medicine 44: 301-307. Krejzar V., Mertelík J., Pánková I., Kloudová K., Kudela V., 2008. Pseudomonas marginalis associated with soft rot of Zantedeschia spp. Plant Protection Science 44: 85-90. Lee Y.A., Chen K.P., Chang H., 2002. First report of bacterial soft rot of white flowered calla lily caused by Erwinia chrysanthemi in Taiwan. Plant Disease 86:1273. Lelliott R.A., Stead D.E., 1987. Methods for the diagnosis bacterial diseases of plants. In: Preece T.F. (ed.). Methods in Plant Pathology, pp. 119-121. Blackwell Scientific Publications, Oxford, UK. Liao C., Wells J., 1987. Diversity of pectolytic, fluorescent pseudomonads causing soft rots of fresh vegetables at produce markets. Phytopathology 77: 673-677. Louws F., Rademaker J., De Bruijn F., 1999. The three Ds of PCR-based genomic analysis of phytobacteria: diversity, detection, and disease diagnosis. Annual Review of Phytopathology 37: 81-125. Louws F.J., Fulbright D.W., Stephens C.T., De Bruijn F., 1994. Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Applied and Environmental Microbiology 60: 2286-2295. Ma B., Hibbing M.E., Kim H.S., Reedy R.M., Yedidia I., Breuer J., Glasner J.D., Perna N.T., Kelman A., 2007. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 97: 11501163.

Journal of Plant Pathology (2014), 96 (2), 271-279 Mahmoudi E., Soleimani M.J., Taghavi M., 2007. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers. Phytopathologia Mediterranea 46: 168-176. Mikiciński A., Sobiczewski P., Sulikowska M., Puławska J., Treder J., 2010. Pectolytic bacteria associated with soft rot of calla lily (Zantedeschia spp.) tubers. Journal of Phytopathology 158: 201-209. Norman D., Yuen J., Resendiz R., Boswell J., 2003. Characterization of Erwinia populations from nursery retention ponds and lakes infecting ornamental plants in Florida. Plant Disease 87: 193-196. Parkinson N., Stead D., Bew J., Heeney J., Tsror L., Elphinstone J., 2009. Dickeya species relatedness and clade structure determined by comparison of recA sequences. International Journal of Systematic and Evolutionary Microbiology 59: 23882393. Pérombelon M., 2002. Potato diseases caused by soft rot erwinias: an overview of pathogenesis. Plant Pathology 51: 1-12. Pérombelon M.C.M., Kelman A., 1980. Ecology of the soft rot erwinias Annual Review of Phytopathology 18: 361-387. Pitman A.R., Wright P.J., Galbraith M.D., Harrow S.A., 2008. Biochemical and genetic diversity of pectolytic enterobacteria causing soft rot disease of potatoes in New Zealand. Australasian Plant Pathology 37: 559-568. Rohlf F.J., 2000. NTSYSpc, Numerical taxonomy and multivariate analysis system. Version 2.1 Exeter Software. Applied Biostatistics Inc., New York, USA. Sambrook J., Russell D.W. (2001). Molecular cloning: A laboratory manual. 3rd Ed. Cold Spring Harbor Laboratory Press, New York, USA. Schaad N.W., Jones J.B., Chun W., 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd Ed. APS Press, St. Paul, MN, USA. Seo S.T., Furuya N., Lim C.K., Takanami Y., Tsuchiya K., 2002. Phenotypic and genetic diversity of Erwinia carotovora spp. carotovora strain from Asia. Journal of Phytopathology 150: 120-127. Scortichini M., Marchesi U., Di Prospero P., 2001. Genetic diversityof Xanthomonas arboricola pv. juglandis (synonyms: X. campestris pv. juglandis; X. juglandis pv. juglandis) strains from

Received December 4, 2012 Accepted December 8, 2013


279

different geographical areas shown by repetitive polymerase chain reaction. Journal of Phytopathology 149: 325-332. Snijder R.C., van Tuyl J.M., 2002. Evaluation of tests to determine resistance of Zantedeschia spp. (Araceae) to soft rot caused by Erwinia carotovora subsp. carotovora. European Journal of Plant Pathology 108: 565-571. Suslow T., Schroth M., Isaka M., 1982. Application of a rapid method for Gram differentiation of plant pathogenic and saprophytic bacteria without staining. Phytopathology 72: 917-918. Tavasoli E., Marefat A., Hassanzadeh N., 2011. Identity and genetic diversity of Pectobacterium spp., causal agents of potato soft rot in Zanjan, Iran. African Journal of Plant Science 5: 329-336. Terta M., Azelmat S., M’hand R.A., Achbani E.H., Barakate M., Bouteau F., Ennaji M.M., 2012. Molecular typing of Pectobacterium carotovorum isolated from potato tuber soft rot in Morocco. Annals of Microbiology 62: 1411-1417. Versalovic J., Schneider M., De Bruijn F., Lupski J.R., 1994. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods in Molecular and Cellular Biology 5: 25-40. Wright P., 1998. A soft rot of calla (Zantedeschia spp.) caused by Erwinia carotovora subspecies carotovora. New Zealand Journal of Crop and Horticultural Science 26: 331-334. Wright P., Burge G., 2000. Irrigation, sawdust mulch, and Enhancebiocide affects soft rot incidence, and flower and tuber production of calla. New Zealand Journal of Crop and Horticultural Science 28: 225-231. Yahiaoui-Zaidi R., Jouan B., Andrivon D., 2003. Biochemical and molecular diversity among Erwinia isolates from potato in Algeria. Plant Pathology 52: 28-40. Yap M.N., Barak J.D., Charkowski A.O., 2004. Genomic diversity of Erwinia carotovora subsp. carotovora and its correlation with virulence. Applied and Environmental Microbiology 70: 3013-3023. Yishay M., Burdman S., Valverde A., Luzzatto T., Ophir R., Yedidia I., 2008. Differential pathogenicity and genetic diversity among Pectobacterium carotovorum ssp. Carotovorum isolates from monocot and dicot hosts support early genomic divergence within this taxon. Environmental Microbiology 10: 2746-2759.